Lipoxin A4 alleviates sepsis-induced acute liver injury by inhibiting inflammatory response and iron overload via JAK2/STAT3 signaling

Abstract

Sepsis is a systemic inflammatory response syndrome with high clinical morbidity and mortality. Acute liver injury (ALI) is a prevalent and severe complication in patients with sepsis. Studies have found that sepsis patients often have iron metabolism disorders. Lipoxin A4 (LXA4), as an inflammatory inhibitor, has an alleviating effect on many inflammation-related diseases. We aimed to examine the impact of exogenous LXA4 on Sepsis-induced acute liver injury (SALI) in an in vivo model and explore the possible mechanism involved. Through bioinformatics analysis and experimental verification, we found that LXA4 ameliorates LPS-induced ALI histological abnormalities and decreases the release of pro-inflammatory cell factors. LXA4 attenuated the content of ROS by up-regulating SOD enzymatic activity and GSH levels while reducing MDA production. Furthermore, LXA4 attenuated iron deposition by increasing FPN1 expression in ALI mice. Further studies have shown that LXA4 regulates the expression of hepcidin via the JAK2/STAT3 signaling pathway to alleviate LPS-induced sepsis. Our research findings indicate that LXA4 exerted a protective effect against iron overload and oxidative stress in ALI mice.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-30995-2.

Introduction

As a life-threatening systemic inflammatory syndrome, sepsis remains the leading cause of worldwide ICU mortality^1,2. Notably, the liver is one of the most vulnerable organs concerned with severe complications of sepsis³. Acute liver injury due to sepsis (SALI) is associated with critically ill patients with poor prognosis and high mortality⁴. Currently, there are no available treatment method for SALI. Moreover, the mechanism has not been fully clarified⁵. Therefore, it is urgent to find novel ways to treat SALI and to discover therapeutic drugs for feasible treatment.

Recently, people have gained added knowledge about the relationship between trace element metabolism and the pathogenesis of sepsis⁶. Previous studies have also found that sepsis patients may exhibit symptoms of unregulated iron metabolism, mainly characterized by cellular iron accumulation and serum iron reduction⁷. When the exportation of intracellular iron was impeded, the iron was gradually deposited. This results in oxidative damage and even cell death, which leads to tissue damage and organ disorders. Meanwhile, reduced serum iron will lead to hypoferraemia⁸. Therefore, restoring imbalanced iron metabolism in patients with SALI may alleviate sepsis. As such, regulating iron metabolism may be a new strategy for SALI treatment.

The metabolism of iron is mainly regulated by a small antibacterial polypeptide hepcidin, synthesized and secreted by the liver (encoded by the Hamp gene), which functions primarily by internalizing or degrading ferroportin (FPN)⁹. FPN is the only protein known to export iron out of cells. Therefore, when the function of FPN is blocked, the output of intracellular iron will be inhibited¹⁰. This, in turn, leads to less iron entering the circulation¹¹. In addition to the influence of iron level in the body, hepcidin expression is regulated by several signaling pathways. IL-6 mainly mediates hepcidin through the JAK2/STAT3 signaling pathway under inflammatory conditions¹². JAK2 is subsequently activated after IL-6 binds to its autoreceptor. JAK2 then phosphorylates its downstream target STAT3 to activate it. Then the phosphorylated STAT3 forms a dimer and transfers to the nucleus, binds to transcriptional regulatory regions to regulate the expression of hepcidin¹³.

Lipoxins (LXs), C₂₀H₃₂O₅, are an eicosane compounds containing four conjugated double bonds and three hydroxyl groups discovered by Serhan and colleagues in 1984¹⁴. The natural lipoxin, lipoxin A4 (LXA4), is an effective regulator of leukocyte function, including migration, degranulation, phagocytosis, and formation of pro-inflammatory mediators¹⁵. Lipoxin, as an endogenous anti-inflammatory mediator, also has a dual pro-inflammatory effect. Notably, it is extends across a spectrum of inflammatory disorders, such as periodontitis^16,17, nephritis¹⁸, arthritis¹⁹, cystic fibrosis²⁰ and atherosclerosis^21,22.

While LXA4’s anti-inflammatory and antioxidative actions are well-characterized, its specific role in regulating iron homeostasis during SALI—particularly whether hepcidin-dependent mechanisms underlie iron overload amelioration—remains unexplored. Here, we demonstrate that LXA4 attenuates hepatic iron overload in SALI by suppressing JAK2/STAT3-mediated hepcidin expression, thereby suggesting a novel therapeutic strategy for treating SALI by modulating iron dysregulation.

Materials and methods

Data collection

The chip sequencing information of the SALI group and normal group (GSE22009 and GSE60088, respectively) comes from the GEO database (http://www.ncbi.nlm.nih.gov/geo/). GSE22009 contains 6 samples (including 3 sepsis-liver, 3 normal-liver), and GSE60088 includes 8 samples (5 sepsis-liver, 3 normal-liver). Raw data were processed in R using the limma package. Expression matrices were normalized with normalize Between Arrays(), followed by log₂ transformation (log₂(exp + 1)). Differentially expressed genes were identified using the limma package based on the empirical Bayes method and visualized through heatmaps, volcano maps, and box plots (|log₂FC| > 1 and p.adj value < 0.05, Benjamini–Hochberg FDR correction). Furthermore, iron metabolism’s linkage to sepsis was statistically evaluated using Pearson correlation.

The targets associated with LXA4 are predicted in the “Homo sapiens” setting by Swiss TargetPrediction (STP, http://www.swisstargetprediction.ch/) and Genecards database (https://www.genecards.org/). Using the R package cluster-Profiler for enrichment of KEGG function analysis, we used the STRING database (https://string-db.org/) for Protein-protein interaction (PPI) analysis. Finally, visualization was carried out using Cytoscape software (version 3.10.2).

Animals

Male mice (8-week-old BALB/c) were obtained from Beijing Charles River Company. Mice were housed under pathogen-free conditions at 21 ± 2℃. Additionally, they had ad libitum access to food and water under a 12-hour light-dark cycle.

Animals were assigned to control, LPS, and LPS + LXA groups using block randomization (n = 6 per group)‌. Mice received intraperitoneal injection of LPS (Solarbio, Beijing, China) at 10 mg/kg of body weight or the same amount of NS to build a sepsis mouse model or a control. For the LPS + LXA4 group, 10 mg/kg body weight LPS intraperitoneal injection and 10 µg/kg body weight LXA4 (Cayman, USA) intraperitoneal injection 1 h later^23,24. All mice were anesthetized with 3% isoflurane following LPS stimulation for 6 (for mRNA, protein, and serum analysis) or 12 h (for tissue iron measurements), and then euthanized with cervical dislocation²⁴. Blood samples and various tissues were collected in a −80 °C freezer until analysis.

Ethics statement

The experimental protocols have been approved by the Experimental Animal Ethics Committee of Hebei Medical University (Approval no. IACUC-Hebmu-2024042). All methods were carried out in accordance with relevant guidelines and regulations. All methods are reported in accordance with ARRIVE guidelines.

Histopathological analysis

To assess histopathology, fresh animal liver, lung, and kidney tissue were paraffin-embedded and sliced into 5 μm sections, which were previously fixed with 4% paraformaldehyde, followed by H&E staining. The results were observed under the microscope after dewatering and sealing.

RNA sequencing analysis

The RNA samples were extracted from the livers of mice, and Beijing Allwegene Tech completed the sequencing work.

ELISA

To obtain mouse serum, blood samples were centrifuged for 20 min at 1000 g at 4 °C. The levels of IL-6 and TNF-α were then determined following the ELISA kit analysis and manufacturer guidelines. A multifunctional microplate detector measured the final OD values.

Neutrophilic granulocyte percentage

Blood samples of mice were collected in anticoagulant tubes, and then the neutrophil percentage was detected by the TEK8500 series automatic five-classification hematology analyzer (Tecom, Jiangxi, China).

Quantitative real-time PCR (qPCR)

The total RNA of mouse liver was extracted by E.Z.N.A.® Total RNA Kit Ⅱ (Omega Bio-Tek, USA) according to the instructions. cDNA was subsequently synthesized using MonScript™ RTⅢ Super Mix with dsDNase (Two-Step). qPCR was carried out using MonAmp™ ChemoHS qPCR Mix (Monad Biotech, Wuhan, China) and Heal Force X960 Automatic Medical PCR Analyzer analysis system. The primers are listed in Table 1.

Table 1.

Primer sequences used for qPCR.

Gene	Forward (5’→3’)	Reverse (5’→3’)
Actin	AGGCCCAGAGCAAGAGAGGTA	TCTCCATGTCGTCCCAGTTG
Il-6	TGTGCAATGGCAATTCTGAT	CCAGAGGAAATTTTCAATAGGC
Tnf-α	TACTGAACTTCGGGGTGATTGGTCC	CAGCCTTGTCCCTTGAAGAGAACC
Il-1β	CCAGCAGGTTATCATCATCATCC	CTCGCAGCACATCAAC
INOS	TGTGGCTGTGCTCCATAGTTTC	TGGAACACAGGGGTGATGCT
Hamp	AGACATTGCGATACCAATGCA	GCAACAGATACCACACTGGGAA

Immunohistochemistry (IHC)

Following graded dewaxing and rehydration of paraffin sections, heat-induced antigen retrieval was performed, with subsequent quenching of endogenous peroxidase activity. After treatment with 3% BSA, primary antibody incubation was performed on paraffin-embedded sections at 4 °C overnight. The primary antibodies were shown as follows: IL-6 (Servicebio, Wuhan, China), TNF-α (Servicebio, Wuhan, China), IL-1β (Servicebio, Wuhan, China), and iNOS (Servicebio, Wuhan, China). After incubation of HRP-conjugated Goat anti-Rabbit IgG (Servicebio, Wuhan, China), DAB color development was performed, and cell nuclei were redyed. The treated paraffin sections were dehydrated, sealed, and viewed under a microscope (Olympus, Japan).

Measurement of oxidant and antioxidant markers

Hepatic SOD activity was measured using a colorimetric activity kit (BC5615, Solarbio, Beijing, China). Hepatic MDA and GSH levels were analyzed with commercial kits (MDA: BC0025, GSH: BC1170), both from Solarbio, Beijing, China. All analyses were carried out in compliance with the manufacturer’s plan.

Perl’s staining

The paraffin sections of mouse spleen tissues were dewaxed in water and stained with Prussian blue solution (Servicebio, Wuhan, China), which is mixed by A and B in equal proportions for 1 h. After nuclear staining with Prussian blue solution C (Servicebio, Wuhan, China), the slices could be dehydrated and sealed, and then observed under a microscope (Leica, Germany).

Western blotting

Following previously established protocols, Western blotting was conducted²⁵. The primary antibodies were as follows: GAPDH (#ET1601-4, 1:10000, HUABIO, Hangzhou, China), FTL (#ET1705-54, 1:2000, HUABIO, Hangzhou, China), FTH (#A1144, 1:1000, ABclonal, Wuhan, China), FPN1 (#DF13561, 1:1000, Affinity, Jiangsu, China), TFR1 (#MTP11-S, mouse anti-mouse, 1:10000, Invitrogen, USA), DMT1 (#A10231, ABclonal, Wuhan, China), total and phospho-JAK2 (Tyr 1007/1008) (#3230, #3771, 1:1000, Cell Signaling, USA), total and phospho-STAT3 (Tyr705) (#CY5165, #CY6566, 1:1000, Abways, Shanghai, China), Then we incubated the PVDF membrane with Goat anti-Rabbit (#S9002, 1:5000, Report, China) or Goat anti-Mouse (#A23910, 1:500, Abbkine, Wuhan, China) IgG Cross-Adsorbed Secondary Antibody, DyLightTM 800 at room temperature. Finally, the Odyssey^® CLX dual-color infrared laser imaging system (LI-COR, USA) was used to observe the results.

Statistical analysis

Data analysis was conducted using GraphPad Prism version 8.0. The data were presented as the mean ± SD. One-way ANOVA followed by Student’s t-test (where appropriate) was used. Statistical significance was defined as P < 0.05.

Results

Iron metabolism gene expression in SALI mice shows significant differences

To determine whether there were abnormalities in iron metabolism in SALI mice, we analyzed differentially expressed genes (DEGs) between SALI and healthy mice using the GEO database. The analysis of heatmaps and volcano plots revealed significant differences in gene expression between the SALI mice and healthy mice (Fig. 1a, b). Moreover, the box plot indicated significant variations in the expression of iron metabolism genes within the SALI group (Fig. 1c). The Pearson correlation analysis showed a significant association between Hamp and serum amyloid a (Saa2), an inflammatory marker associated with sepsis (Fig. 1d).

Fig. 1.

Analysis of gene expression differences between the healthy and SALI group. a Heatmap of the healthy group and SALI group. b Volcano plot of differences between the healthy group and SALI group. c The iron metabolism-related DEGs between the healthy group and the SALI group. d Significant positive correlation between Hamp and Saa2.

LXA4 attenuated organ damage in septic mice and its potential targets

The physiological state of the animals in each group was observed before sampling. Compared with the control group, LPS-treated mice showed obvious inflammatory reactions, including fever, significantly accelerated respiratory rate, less movement, lethargy, curling up, hair raising, secretions in the corner of the eye, and diarrhea. Simultaneously, mice treated with LXA4 showed some relief from these symptoms.

To assess the protective effect of LXA4 against LPS-induced histological alterations, HE staining was used to observe the pathological damage of the liver, lung, and kidney. Compared with the control group, LPS-induced mice exhibited marked histological abnormalities. Moreover, the hepatic Kupffer cell population exhibited a marked proliferation in LPS-challenged mice, and the arrangement of liver cells was disordered. In the LPS group, inflammatory cell infiltration increased, neutrophils appeared, the alveolar cavity became smaller, and the alveolar wall thickened. Furthermore, the mice’s kidney tissue became loose compared to the control group, and the glomeruli had distinct dividing bands. However, these pathological changes were reversed by LXA4 treatment (Fig. 2a–c).

Fig. 2.

LXA4 ameliorated histological abnormalities in LPS-injected mice. a–c H&E staining image of the liver, lung, and kidney tissue. n = 6, Bars = 50 μm. d The Venn diagram represents the intersection of SALI and LXA4-related genes. e PPI analysis of key targets associated with SALI. f The bar chart describes the KEGG pathways related to SALI. The depth of the color shows the magnitude of the P value.

By integrating the SPT and Genecards databases, we identified 151 potential targets of LXA4. These targets were subsequently cross-analyzed with 1,822 targets associated with SALI, resulting in the identification of 91 common genes (Fig. 2d). Then, these targets were uploaded to the STRING website to establish a PPI network. The topological analysis shows that IL-6, IL-1β, AKT1, MMP9, STAT3, and CXCL are the core targets (Fig. 2e). To further define the prospective pathways of LXA4 in SALI therapy, we conducted a KEGG pathway enrichment analysis. The results show that the PI3K-Akt, MAPK, IL-17, TNF, and JAK-STAT pathway (Fig. 2f) was significant^26–28. These findings reveal that the IL-6, TNF, and JAK-STAT signaling axis mediates the therapeutic effect of LXA4 on SALI.

The influence of LXA4 on RNA sequencing of liver tissue transcriptomes

To define the LXA4’s mechanism of action and provide a reliable theoretical basis for our next experiment, we conducted the RNA-sequence experiment. The mRNA expression profiles of liver tissues were analyzed in the three groups (n = 3). DEGs were systematically identified through pairwise comparisons using stringent criteria. Differential expression of mRNA volcano plot as shown in Fig. 3a and b. RNA sequencing also revealed that 3,753 upregulated and 3,835 downregulated DEGs in LPS-treated mice versus controls. LXA4 administration subsequently reversed this trend, demonstrating 439 upregulated and 956 downregulated DEGs relative to the LPS group (Fig. 3c). Additionally, the Venn diagram analysis identified 877 DEGs shared among all three experimental groups (Fig. 3d). The monitoring of key factors affecting inflammation and iron metabolism also showed that LXA4 affects their transcription levels (Fig. 3e). Thus, this demonstrates LXA4’s essential role in modulating both inflammatory responses and iron homeostasis.

Fig. 3.

Transcriptomic RNA sequencing of DEGs in liver tissues. a The volcano map depicts DEGs between the LPS-treated mice and controls, and b DEGs between the LPS and LXA4-treated mice. c The up-regulation and down-regulation of DEGs were observed in the control, LPS, and LPS + LXA4 group. d Venn plot of the DEGs. e Heatmap analysis of several key factors affecting inflammation and iron metabolism among the control, LPS, and LPS + LXA4 treated groups (n = 3). Red signifies high expression, blue indicates lower expression.

LXA4 alleviated inflammation in LPS-induced ALI mice

We aimed to verify RNA-seq findings and evaluate the impact of LXA4 on LPS-induced murine inflammation. We measured the levels of IL-6 and TNF-α in serum. It was found that IL-6 and TNF-α increased markedly under the action of LPS, while LXA4 reversed these increases (Fig. 4a-b). Notably, the content of neutrophils in plasma is associated with bacterial infection. LPS administration significantly increased circulating neutrophil percentages versus control mice. This effect was substantially reversed by LXA4 co-administration (Fig. 4c). In the liver of mice, LXA4 was able to distinctly mitigate the LPS-induced enhancement of IL-6, TNF-α, IL-1β, and iNOS mRNA (Fig. 4d-g). Subsequent liver immunohistochemical results also showed that the same markers associated with acute infection were significantly increased following LPS stimulation. While LXA4 could significantly reduce the expression of these markers (Fig. 4h). Thus, it is suggested that LXA4 can reduce LPS-mediated acute inflammation in murine models.

Fig. 4.

The protective effect of LXA4 on inflammatory injury. a, b ELISA measured serum IL-6 and TNF-α levels. c Mice’s peripheral blood neutrophil percentage. d–g The mRNA expressions of IL-6, Tnf-α, Il-1β, and INOS in liver tissues were examined by qPCR. h The liver immunohistochemical staining of IL-6, TNF-α, IL-1β, and iNOS. n = 6, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, LPS vs. Control; ^# P < 0.05, ^## P < 0.01, LPS + LXA4 vs. LPS. Bars = 50 μm.

LXA4 alleviated oxidative stress levels in LPS-induced ALI mice

Next, we focused on LXA4’s modulation of oxidative stress in LPS-induced septic mice. We were pleasantly surprised to find that LXA4 exhibited both anti-inflammatory and antioxidative effects in the livers of septic mice. Specifically, LXA4 recovered the decrease of SOD (Fig. 5a) and GSH (Fig. 5b) caused by LPS, while attenuating LPS-mediated MDA elevation (Fig. 5c).

Fig. 5.

Oxidative stress in mouse liver tissue. a–c SOD, MDA, and GSH content in the liver of mice. n = 6, * P < 0.05, *** P < 0.001, LPS vs. Control; ^# P < 0.05, LPS + LXA4 vs. LPS.

LXA4 attenuated hepatic hepcidin expression in LPS-induced ALI mice

Studies have shown that there may be iron metabolism disorders in patients with sepsis²⁹. The results of RNA-seq also suggested that the Hamp gene, which regulates iron metabolism, is significantly downregulated after LXA4 injection. These indicate that LXA4 may affect the regulation of iron homeostasis. Therefore, we observed the changes of Hamp and its target protein FPN1 in the liver of mice. Under the stimulation of LPS, Hamp mRNA in the liver of mice was significantly increased (Fig. 6a), corresponding to the decrease of FPN1 levels in the liver (Fig. 6b, c). LXA4 could also reduce the changes of Hamp mRNA induced by LPS and restore the expression of FPN1. Thus, these results suggest that LXA4 can ameliorate inflammation during sepsis in mice by regulating the expression of hepcidin.

Fig. 6.

Effect of LXA4 on hepcidin. a The expression levels of Hepatic Hamp mRNA were examined using qPCR. b, c FPN1 protein level in liver tissue. The internal control for the target protein (GAPDH) was detected by continuous incubation from the same membrane. n = 6, * P < 0.05, **** P < 0.0001, LPS vs. Control; ^# P < 0.05, ^## P < 0.01, LPS + LXA4 vs. LPS.

LXA4 regulated iron homeostasis in LPS-induced ALI mice

Since excessive iron can aggravate the production of ROS and lipid peroxidation³⁰, murine iron homeostasis was assessed. Since the primary organ for iron storage is the spleen, we also measured the iron levels in the spleen. As demonstrated in Fig. 7a-b, LXA4 administration reduced pathological iron accumulation in the spleen of LPS-challenged mice. Simultaneously, the serum iron level of LPS mice showed a downward trend, and LXA4 increased the serum iron level (Fig. 7c). Ferritin, as the primary protein used to store iron ions in living organisms, consists of ferritin light chain (FTL) and ferritin heavy chain (FTH) subunits³¹ Western blot test on the mouse liver showed that FTL and FTH in the LPS group were overtly increased (Fig. 7d-f). Transferrin Receptor 1(TFR1) was also decreased relative to controls (Fig. 7d, g). FTL and FTH expression in the LPS + LXA4 group was significantly declined (Fig. 7d-f), and TFR1 expression was observably elevated compared with the LPS group (Fig. 7d, g). LXA4 can also lessen the increase of Divalent Metal Transporter 1(DMT1) induced by LPS (not significant) (Fig. 7d, h). These results once again prove that LXA4 is likely to be involved in the regulation of iron metabolism.

Fig. 7.

Iron levels and iron metabolism-related protein expression. a, b Perl’s Prussian blue staining and statistical analysis of the mouse spleen, the blue part represents iron deposits. c Iron levels in mouse serum. d–h The hepatic expression of iron metabolism-related proteins was quantitated. The internal control for each target protein (GAPDH) was detected by continuous incubation from the same membrane. n = 6, * P < 0.05, ** P < 0.01, **** P < 0.0001, LPS vs. Control; ^# P < 0.05, ^## P < 0.01, ^### P < 0.001, LPS + LXA4 vs. LPS. Bars = 50 μm.

LXA4 suppressed JAK2/STAT3 signaling in LPS-induced ALI mice

Following LPS treatment, Gene Set Enrichment Analysis (GSEA) showed an increase in gene expression associated with IL-6/JAK2/STAT3 signaling, which is closely related to the liver injury response. LXA4 possibly exerted therapeutic effects by suppressing the JAK2/STAT3 pathway (Fig. 8a-b). Western blot results further revealed that p-JAK2 and p-STAT3 levels were obviously increased following LPS stimulation. However, these were attenuated by LXA4 (Fig. 8c-e). Therefore, these results suggest that LXA4 downregulated hepatic hepcidin by decreasing IL-6/JAK2/STAT3 signaling, thereby regulating iron metabolism levels.

Fig. 8.

LXA4 suppresses JAK2/STAT3 phosphorylation. a, b GSEA analysis of the JAK2/STAT3 pathway. c-e p-JAK2, JAK2, p-STAT3 and STAT3 protein levels in liver. The internal control for each target protein (GAPDH) was detected by continuous incubation from the same membrane. n = 6, **** P < 0.0001, LPS vs. Control; ^### P < 0.001, LPS + LXA4 vs. LPS.

Discussion

LXA4, an endogenous anti-inflammatory mediator, has extensive anti-inflammatory functions and is a brake signal for inflammation³². Studies have found that LXA4 can relieve keratitis caused by Aspergillus fumigatus through ALX/FPR2³² and Nrf2/HO-1³³ signaling pathways. Notably, LXA4 is induced by adrenal hormones during labor and promotes the resolution of inflammation during this process³⁵. Accumulating evidence suggests that LXA4 exerts beneficial effects on a variety of inflammatory diseases^36–38. LXA4 has also been shown to be relevant for the treatment of sepsis, such as alleviating organ damage during sepsis³⁹ and affecting immune-related cells^40,41. However, research on the mechanism of how LXA4 reduces SALI is incomplete. Thus, we constructed a mouse model of SALI to explore the specific relationship. In this study, LXA4 alleviated LPS-induced acute injury in mice, manifested as reduced histological damage and decreased release of pro-inflammatory cytokines.

Our HE staining results suggested that LXA4 could attenuate LPS-induced septic injury in the liver, spleen, and kidney of mice. Bioinformatics analysis and RNA-seq data also indicated that abnormal iron metabolism in SALI and inflammation-related signaling pathways might perform key roles in the treatment of SALI with LXA4. The results of serum ELISA, blood routine, liver qPCR, and IHC demonstrated that LXA4 alleviated LPS-induced inflammation.

In addition to its anti-inflammatory effects, many other functions of LXA4 have been discovered. LXA4 may ameliorate oxidative stress injury and subsequent thrombotic response in vascular endothelial cells⁴¹. Notably, oxidative stress is a critical driver in the pathophysiology of SALI^42,43. Hepatic ROS production is significantly elevated following LPS administration⁴⁴. MDA, SOD, and GSH are frequently utilized as key indicators for assessing oxidative stress^46–48. In this study, SOD and GSH were downregulated, MDA was overexpressed after LPS treatment, all of which were effectively reversed by LXA4 administration. Therefore, these results suggest that LXA4 significantly enhanced hepatic antioxidant defenses in SALI mice.

Previous studies have found abnormal iron metabolism in patients with sepsis^49,50. Analyzing the relevant data in the GEO database shows significant dysregulation of iron metabolism genes in the SALI group. Excessive free iron in cells can participate in the Fenton reaction, producing free radicals that cause oxidative stress and ultimately lead to tissue damage^51–53. Unexpectedly, this study revealed differential expression of Hamp, a key gene in iron homeostasis regulation. The specific relationship between sepsis and iron metabolism remains unclear, as is whether LXA4 affects iron metabolism during sepsis. Therefore, we examined the changes of FPN1, the target protein of hepcidin, and the changes of FTL, FTH, TFR1, and DMT1, which are related to iron metabolism⁵⁴. Notably, LPS stimulation affected the content of these proteins in the liver. Additionally, LXA4 was able to restore normal levels of these proteins. Prussian blue staining of the spleen also showed that LXA4 reduced LPS-induced iron deposition in spleen tissue. Thus, our data suggested that LXA4 may have an effect on iron metabolism in mice with sepsis, and its anti-inflammatory effect may be achieved by regulating iron homeostasis.

To determine the specific mechanism by which LXA4 affects iron metabolism, we further examined the signaling pathway regulating Hamp. Because IL-6-activated STAT3 is the critical transcription regulator of hepcidin during inflammation[4], we focused on the IL-6/JAK2/STAT3 signaling axis. The results of GSEA and Western blot indicate that LXA4 regulates iron metabolism by attenuation of IL-6 secretion, blockade of JAK2/STAT3 signaling, and downstream repression of hepatic hepcidin.

In summary, our research data suggests that LXA4 regulates iron metabolism through hepcidin, thereby alleviating LPS-induced ALI during sepsis (Fig. 9). LPS may increase hepcidin production through IL-6-mediated JAK2/STAT3 signaling axis. Moreover, hepcidin inhibits the expression of its target protein FPN1, leading to intracellular iron overload. Subsequently, excessive iron causes tissue oxidative damage. After treatment with LAX4, the iron overload and inflammation of SALI mice were alleviated. This study reveals the mechanism by which LXA4 regulates hepcidin through the JAK2/STAT3 signaling pathway, thereby opening new avenues for targeted therapy in sepsis-associated liver injury. However, the exact pathway by which LXA4 mitigates SALI by orchestrating iron metabolism is yet to be fully elucidated, calling for dose-response studies and validation of causal relationships in hepatocyte models.

Fig. 9.

Potential mechanisms by which LAX4 alleviates LPS-induced ALI by regulating iron metabolism.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Xingyu Li and Wanrong Xiao: Validation, Investigation, Formal analysis, Writing - Original Draft. Bo Zhao: Formal analysis, Validation. Zhuo Chen: Writing – original draft. Jiaming Han: Investigation. Yuhua Lei and Juan Zhao: Conceptualization, Writing - Review & Editing, Project administration, Funding acquisition.

Funding

This work was supported by Hebei Natural Science Foundation (H202206390).

Data availability

Due to technical issues, the original FASTQ files are temporarily unavailable. However, all key experimental results and analyses are presented in the manuscript, and the conclusions are fully supported by the provided evidence. We will update the data availability once the issue is resolved.

Declarations

Competing interests

The authors declare no competing interests.