Abstract
Background
The inflammation and cellular dysfunction in periodontitis largely depend on N6-methyladenosine (m6A) modification-related epigenetics. However, the role of methyltransferase-like 3 (METTL3)-differentiated m6A modification of desmocollin 1 (DSC1) in periodontitis remains to be investigated.
Methods
Periodontal ligament (PDL) tissues were collected from patients with periodontitis and healthy volunteers, and a periodontitis model was constructed using lipopolysaccharide (LPS) and human periodontal ligament fibroblasts (HPLF). METTL3 and DSC1 levels in the specimens and cells were measured using quantitative reverse-transcription polymerase chain reaction. Proliferation, apoptosis, and inflammatory changes were analyzed using CCK-8, EdU, flow cytometry, and enzyme-linked immunosorbent assay, respectively. Additionally, m6A RNA immunoprecipitation was conducted to analyze the influence of METTL3 on the m6A modification of the DSC1 gene.
Results
The expression levels of METTL3 and DSC1 were lower in patients with periodontitis compared to those in the healthy group. LPS treatment inhibited the survival of HPLF cells, promoting apoptosis and inflammation; alternatively, DSC1 overexpression alleviated the LPS-induced damage to periodontitis cells. Furthermore, METTL3 positively regulated the DSC1 level and enhanced its stability through m6A modification. Silencing METTL3 partially reversed the alleviating effect of DSC1 upregulation on inflammation and cellular dysfunction related to periodontitis in HPLF cells.
Conclusion
These findings suggest that METTL3 mediates the m6A modification of DSC1 to alleviate periodontitis-associated inflammation and cellular dysfunction.
Key words: METTL3, m6A modification, DSC1, Periodontitis
Introduction
Periodontitis is a chronic and multifactorial inflammatory disease characterized by alveolar bone resorption, loss of attachment, formation of periodontal pockets, gingival inflammation, and loosening of teeth.1 In 2021, more than one billion people had severe periodontitis, representing an age-standardized prevalence of 12.50% globally. By 2050, over 1.5 billion people are expected to experience severe periodontitis.2 The progression and severity of periodontitis largely depend on genetic factors; in addition to the typical expression profiles of genes in affected periodontal tissues, epigenetic factors have recently been described as important contributors to the pathogenesis of periodontitis.3,4 Therefore, it is essential to explore the epigenetic mechanisms underlying cellular dysfunction in periodontitis.
Desmocollin 1 (DSC1) is a transmembrane desmosomal protein that plays a key role in maintaining intercellular adhesion.5 Previous studies have primarily focused on its regulatory function on cellular behavior.6,7 In recent years, scientific research has revealed the role of DSC1 in periodontitis. Deep sequencing analysis was performed on gingival tissue from patients with periodontitis, followed by computational annotation and quantification of mRNA structure, which resulted in the identification of 62 downregulated genes, mainly consisting of cytoskeletal and structural proteins, with DSC1 ranking fifth.8 Kim et al.9 collected subepithelial connective tissues from 7 cases of refractory periodontitis under sterile conditions, conducted a gene expression profiling analysis on the isolated total RNA using microarrays, and reported the downregulation of DSC1. Furthermore, DSC1 is downregulated in systemic aggressive periodontitis.10 However, to date, there have been no reports on the fundamental role of DSC1 in periodontitis.
In recent years, researchers have focused on the most widespread RNA epigenetic modification in eukaryotic organisms, namely the N6-methyladenosine (m6A) modification.11 M6A participates in downstream gene translation and mRNA degradation during the transcription process from DNA to RNA, under the action of methyltransferases, demethylases, and reader proteins.12 Analysis of genome-wide association studies of periodontitis suggests that m6A-related single-nucleotide polymorphisms may represent potential functional variants involved in this disease.13 The primary methyltransferase, methyltransferase-like 3 (METTL3), has been reported to alleviate periodontal damage by inhibiting the activation of inflammasomes; mechanistically, it upregulates the m6A modification of TNFAIP3, ultimately aiding in the treatment of periodontitis.14 However, the mechanism by which METTL3 modifies DSC1 through m6A modification and the combined effect of both in periodontitis remain unclear.
In this study, we confirmed the varying levels of DSC1 in periodontitis and elucidated its regulatory role in periodontitis-associated inflammation and cellular dysfunction. The regulatory mechanism of DSC1 by METTL3 was also revealed to be dependent on m6A modification. The results of this study represent significant translational implications, suggesting that the METTL3-m6A-DSC1 pathway may provide a promising therapeutic strategy for periodontitis.
Methods
Periodontal ligament (PDL) tissue
Clinical tissue specimens were provided by Wuhan Fourth Hospital with approval from its Ethics Committee. All procedures involving human participants were conducted in accordance with the ethical standards outlined in the Declaration of Helsinki. Written informed consent was obtained from all patients prior to sample collection. Periodontitis was diagnosed and classified in accordance with the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. Patients with a clinical attachment loss of ≥3 mm, a probing depth of ≥4 mm, and radiographic evidence of alveolar bone resorption length were included in the periodontitis group. The inclusion criteria in this study were as follows: (1) patients diagnosed with periodontitis in our hospital; (2) availability of PDL tissue specimens obtained during periodontal flap surgery; (3) absence of other periodontal or systemic inflammatory diseases; (4) provision of written informed consent to participate in the study. The exclusion criteria included: (1) use of antibiotics, anti-inflammatory drugs, or immunosuppressants within the previous 3 months; (2) pregnancy or lactation; (3) a smoking history; (4) incomplete clinical data, or if the sample preservation did not meet the research requirements.
Sixteen PDL tissues were collected from patients with periodontitis by scraping the roots during periodontal flap surgery or from the roots of extracted teeth. Likewise, healthy PDL tissues were obtained from 16 healthy volunteers who underwent tooth extractions for orthodontic purposes. After collection, the specimens were stored at −80°C. The clinical and demographic characteristics of the patients included in this study are listed in Table 1.
Table 1.
Characteristics of periodontitis patients and healthy control.
| Characteristics | Healthy control mean ± SD/ no. (%) | Periodontitis mean ± SD/ no. (%) | P |
|---|---|---|---|
| Total | 16 (100) | 16 (100) | |
| Age (years) | 47.76 ± 10.62 | 50.02 ± 7.23 | .4875 |
| Sex (male) | 6 (37.5) | 5 (31.3) | .7097 |
| BMI | 22.61 ± 4.62 | 23.25 ± 4.11 | .6800 |
| PD (mm) | 1.61 ± 0.38 | 5.40 ± 1.36 | <.0001 |
| CAL (mm) | 0.72 ± 0.12 | 3.97 ± 0.91 | <.0001 |
| ABL (%) | 0.28 ± 0.06 | 36.02 ± 0.51 | <.0001 |
| BOP (%) | 9.30 ± 1.83 | 46.14 ± 6.46 | <.0001 |
| GI | 0.45 ± 0.99 | 2.38 ± 0.67 | <.0001 |
| PI | 0.88 ± 0.35 | 2.58 ± 0.26 | <.0001 |
ABL, alveolar bone resorption length; BMI, body mass index; BOP, bleeding in probing; CAL, clinical attachment level; GI, gingival index; PD, probing pocket depth; PI, plaque index.
Human PDL fibroblast (HPLF) cell culture and construction of the periodontitis model
HPLF cells (no. CP-H136) acquired from Procell were cultured in human periodontal fibroblast complete culture medium (CM-H136, Procell) and incubated at 37°C with 5% CO2. When the cells grew stably, HPLF was treated with 1 μg/mL of lipopolysaccharide (LPS; Invitrogen,) for 24 hours to establish a periodontitis model.15
Quantitative reverse-transcription polymerase chain reaction (qRT-PCR)
Extraction of total RNA from PDL tissues and HPLF cells was carried out using the Trizol method (ThermoFisher), and RNA concentration was detected using the Quant-iT RiboGreen RNA kit (ThermoFisher). RNA (1 μg) was reverse-transcribed to cDNA, complying with the SuperScript II Reverse Transcription Kit (no. 18064071, Thermo Fisher), and qRT-PCR was conducted as described in PrimeScript RT-PCR Kit (no. 1 RR014A; Takara). GAPDH was selected as the reference gene and analyzed for DSC1, METTL3, RANKL, and OPG mRNA expression utilizing the 2-ΔΔCt method. The primer sequences are presented in Table 2.
Table 2.
The primers used for qRT-PCR.
| Gene | Sequence (5′-3′) | |
|---|---|---|
| DSC1 | Forward | GTATGTGTTTTCTTCTGACAG |
| Reverse | CATACACAAAAGAAGACTGTC | |
| METTL3 | Forward | AAGCTGCACTTCAGACGAA |
| Reverse | GGAATCACCTCCGACACTC | |
| RANKL | Forward | GCTTGAAGCTCAGCCTTTTGCTCAT |
| Reverse | GGGGTTGGAGACCTCGATGCTGATT | |
| OPG | Forward | GAACCCCAGAGCGAAATACA |
| Reverse | TATTCGCCACAAACTGAGCA | |
| GAPDH | Forward | GCACCGTCAAGGCTGAGAAC |
| Reverse | TGGTGAAGACGCCAGTGGA |
Cell transfection
The overexpression vectors for DSC1 or METTL3 (OE-DSC1 or OE-METTL3), along with a negative control for the overexpression group (OE-NC), METTL3 small interfering RNA (si-METTL3), and a negative control for siRNA (si-NC), were constructed by RiboBio in China. The Lipofectamine 3000 (Thermo Fisher) reagent was used to transfect 2 μg of the overexpression vectors or 100 nM siRNAs into 5 × 104 LPS-treated HPLF cultured for 48 hours in an incubator (37°C) filled with 5% CO2. The si-METTL3 transfection efficiency is shown in Supplementary Figure 1.
CCK-8 assay
HPLF cells (1 × 105) were added to 96-well plates and incubated at 37°C for 48 hours, following which 10 μL of CCK-8 solution (Beyotime) was added and incubated for an additional 2 hours. Subsequently, a microplate reader was used to measure the absorbance at a wavelength of 450 nm.
EdU assay
The Cell-Light EdU Apollo567 In Vitro Kit (no. C10310-1; RiboBio) was used to determine the HPLF cell proliferation levels. Cells (1 × 105) were cultured in 96-well plates for 48 hours, then treated with an additional 50 μM/well of EdU working solution and incubated for 2 hours. Subsequently, the cells were fixed with a 4% formaldehyde solution for 30 minutes, followed by a 30-minutes incubation with Apollo staining solution, and then stained with DAPI for an additional 30 minutes (to color the nuclei). The EdU-positive cells (red) were visualized using a fluorescence microscope.
Flow cytometry assay
The Annexin V-FITC Apoptosis detection kit (No. C1062S; Beyotime) was used to assess apoptosis in the HPLF cells. The cells (5 × 104) were harvested by centrifuging at 1000 × g for 5 minutes, and the supernatant was discarded. Annexin V binding buffer (195 μL) was added to the precipitate to gently resuspend the cells. Then, 5 μL of Annexin V-FITC was added and mixed gently, followed by the addition of 10 μL of propidium iodide staining solution. The cells were incubated in the dark at 25°C for 15 minutes, then transferred to an ice bath and analyzed using flow cytometry (MoFlo Astrios EQ, Beckman Coulter).
Enzyme-linked immunosorbent assay (ELISA)
The levels of proinflammatory cytokines in the culture supernatants of HPLFs were measured using commercial ELISA kits for IL-1β (no. PI305, Beyotime), IL-6 (No. PI330, Beyotime), and TNF-α (No. PT518, Beyotime). Briefly, HPLF cell supernatants were centrifuged at 900 × g for 20 minutes, followed by the addition of 100 μL of each sample or standard to the precoated plates and incubation at 37°C for 2 hours. After washing, biotin-conjugated detection antibodies (IL-1β, IL-6, and TNF-α) and HRP-streptavidin were sequentially added. The reaction was developed using 3,3′,5,5′-tetramethylbenzidine (TMB) substrate and terminated with stop solution; the absorbance was measured at 450 nm using a microplate reader.
m6A RNA immunoprecipitation (Me-RIP)
The Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) was used for experiments as described in the instruction manual. Briefly, 300 μg of total RNA isolated from HPLF cells was treated with fragmentation buffer at 94°C for 5 minutes to cleave the RNA into ∼100-nucleotide fragments. The fragmented RNA was incubated with 5 μg of anti-m6A or anti-immunoglobulin (Ig)G antibody (negative control) and then integrated with Protein A/G beads for 1 hour to facilitate binding. After extensive washing with immunoprecipitation buffer, the immunoprecipitated RNA was reverse-transcribed to cDNA, and the DSC1 levels were examined via qRT-PCR.
Western blotting assay
HPLF cells (1 × 106) were collected and lysed with enhanced RIPA lysate (Beyotime), following which the protein concentration was determined using a BCA protein quantification kit (Beyotime). Proteins (20 μg) were separated by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes (Millipore). The membranes were sealed in 5% skimmed milk for 1 hour at 25°C, followed by treatment with primary antibodies (overnight at 4°C). The next day, the membranes were washed and incubated with an HRP-labeled secondary antibody for 1 hour at 25°C. Subsequently, the membranes were examined using an enhanced chemiluminescence solution (Biomiga), and the grayscale of each band was quantified via ImageJ software. Antibodies were obtained from ABclonal: the primary antibodies included DSC1 (A10061), METTL3 (A19079), NF-κB p65 (A2547), and GAPDH (A19056), while the secondary antibody was (no. AS014).
RNA stability analysis
HPLF cells (1 × 106) from the OE-NC and OE-METTL3 groups were treated with 2 μg/mL of the transcription inhibitor actinomycin D (Merck) for 0, 4, or 8 hours to block transcription. The cell samples were collected, RNA was extracted, and the mRNA expression level of DSC1 was analyzed by qRT-PCR.
Statistical analysis
A P-value of <.05 was considered statistically significant. All data were analyzed using GraphPad Prism (version 10.0; GraphPad Software) and are presented as mean ± the standard deviation (SD). For statistical analysis, Student’s t-test (2 groups) and 1-way analysis of variance followed by Tukey’s test (multiple groups) were used.
Results
DSC1 expression was low in periodontitis
GSE10334, an mRNA microarray, comprised 183 periodontitis samples and 64 healthy samples. With an adjusted P-value of <.01 and a logFC of ≤2, only 1 gene, DSC1, was identified from the microarray (Figure 1A). Next, DSC1 was analyzed in PDL tissues from healthy volunteers or patients with periodontitis using qRT-PCR. Data indicated that the mRNA expression of DSC1 in periodontitis patients was significantly downregulated to approximately 0.3-fold of that in healthy controls (Figure 1B). Furthermore, DSC1 levels in LPS-treated periodontitis model HPLF cells exhibited a nearly 0.6-fold reduction compared to those in the controls (Figure 1C).
Fig. 1.
Low DSC1 expression in periodontitis. A, The mRNA microarray, GSE10334, comprised 183 periodontitis samples and 64 healthy samples. With an adjusted P < .01 and logFC < −2, only 1 gene (DSC1) was identified. B, DSC1 levels were examined in PDL tissues from healthy volunteers or patients with periodontitis using qRT-PCR. C, DSC1 levels in LPS-treated established periodontitis model HPLF cells and controls were examined via qRT-PCR. **P < .01 vs control.
Overexpression of DSC1 promotes HPLF cell survival and inhibits apoptosis and inflammation in periodontitis
The biological function of DSC1 on LPS-treated HPLF cells was examined. Data from the CCK-8 analysis revealed that LPS-treated HPLF cells (ie, periodontitis HPLF cells) exhibited a survival reduction of more than 55% compared to the control group, while DSC1 overexpression enhanced survival by nearly 1.5-fold (Figure 2A). qRT-PCR analysis showed that the RANKL/OPG ratio was increased in periodontitis HPLF cells, but decreased following DSC1 overexpression (Figure 2B). Furthermore, EdU analysis revealed a decrease in EdU positivity in periodontitis HPLF cells, which was reversed by increased DSC1 (Figure 2C). Conversely, in the flow cytometry experiment, the apoptosis rate of HPLF cells in periodontitis was increased, while DSC1 upregulation partially repaired the LPS-induced apoptosis (Figure 2D). Additionally, the ELISA results indicated that the levels of inflammatory factors (IL-1β, IL-6, and TNF-α) in periodontitis HPLF cells were substantially increased, while the addition of OE-DSC1 reduced these inflammatory levels (Figure 2E). Western blotting showed that NF-κB p65 protein expression was elevated in periodontitis HPLF cells, and its expression was reduced by OE-DSC1 (Figure 2F). These findings indicated that DSC1 overexpression could alleviate damage to LPS-induced periodontitis cells.
Fig. 2.
Overexpression of DSC1 promotes the survival of periodontitis HPLF cells, while inhibiting apoptosis and inflammation. A, The viability rate of HPLF cells in the control, LPS, LPS + OE-NC, and LPS + OE-DSC1 groups was examined using the CCK-8 assay. B, The RANKL/OPG ratio of HPLF cells in the control, LPS, LPS + OE-NC, and LPS + OE-DSC1 groups was calculated using qRT-PCR. C, The EdU-positive rate of HPLF cells in the control, LPS, LPS + OE-NC, and LPS + OE-DSC1 groups was examined using EdU assay. D, The apoptosis rate of HPLF cells in the control, LPS, LPS + OE-NC, and LPS + OE-DSC1 groups was examined using flow cytometry. E, The levels of inflammatory factors (IL-1 β, IL-6, and TNF-α) in HPLF cells from the control, LPS, LPS + OE-NC, and LPS + OE-DSC1 groups were examined using ELISA. F, The NK-κB p65 protein expression in HPLF cells from the control, LPS, LPS + OE-NC, and LPS + OE-DSC1 groups was measured by western blotting. *P < .05, **P < .01 vs control; ##P < .01 vs LPS + OE-NC.
METTL3 mediated the m6A modification of DSC1
METTL3 mRNA expression in periodontitis tissues was reduced to approximately 0.55-fold that in healthy controls (Figure 3A). The Pearson analysis revealed a positive linear correlation between METTL3 and DSC1 expression (Figure 3B). Subsequently, a certain level of m6A modification of DSC1 was observed, which was further increased after METTL3 overexpression (Figure 3C). In addition, the mRNA and protein contents of DSC1 in HPLF cells were upregulated by 5.4-fold and >1.5-fold after METTL3 upregulation (Figure 3D and 3E). Moreover, the DSC1 level was consistently higher in the OE-METTL3 groups than in the OE-NC groups, suggesting that METTL3 overexpression enhanced DSC1 mRNA stability (Figure 3F).
Fig. 3.
METTL3 mediates m6A modification of DSC1. A, METTL3 levels were examined in PDL tissues from healthy volunteers or patients with periodontitis via qRT-PCR. B, The linear relationship between METTL3 and DSC1 expression was proved using the Pearson test. C, DSC1 enrichment in HPLF cells from the OE-NC and OE-METTL3 groups co-incubated with IgG or m6A was revealed via Me-RIP. **P < .01 vs IgG-OE-NC; ##P < .01 vs IgG-OE-METTL3; ^^P < .01 vs m6A-OE-NC. D, mRNA levels of DSC1 in HPLF cells from the OE-NC and OE-METTL3 groups were revealed via qRT-PCR. **P < .01 vs OE-NC. E, Protein levels of DSC1 in HPLF cells from the OE-NC and OE-METTL3 groups were revealed via western blotting. **P < .01 vs OE-NC. F, The stability of DSC1 levels was assessed in HPLF cells from the OE-NC and OE-METTL3 groups treated with actinomycin D. *P < .05 vs OE-NC.
Low METTL3 expression reversed the mitigating effect of DSC1 overexpression on periodontitis
The CCK8 assay revealed that METTL3 knockdown counteracted the increase in viability caused by DSC1 overexpression in LPS-induced periodontitis HPLF cells (Figure 4A). qRT-PCR data indicated that the reduction in the RANKL/OPG ratio due to DSC1 overexpression was reversed by METTL3 knockdown in these cells (Figure 4B). The increased EdU-positive rate of HPLF cells in periodontitis, attributed to DSC1 upregulation, was reduced by METTL3 downregulation (Figure 4C). Low expression of METTL3 reversed the antiapoptosis effect of DSC1 overexpression in LPS-treated HPLF cells (Figure 4D). Silent METTL3 upregulated the inflammatory abrogation induced by high levels of DSC1 in periodontitis HPLF cells (Figure 4E). Furthermore, METTL3 knockdown enhanced the impaired NF-κB p65 protein expression caused by DSC1 overexpression in periodontitis HPLF cells (Figure 4F). These findings indicate that low METTL3 expression can rescue the mitigating effect of DSC1 upregulation on periodontitis.
Fig. 4.
Low METTL3 expression reverses the alleviation effect of DSC1 overexpression on periodontitis. A, The viability rate of HPLF cells in the control, LPS, LPS + OE-NC, LPS + OE-DSC1, LPS + OE-DSC1 + si-NC, and LPS + OE-DSC1 + si-METTL3 groups was examined using CCK-8 analysis. B, RANKL/OPG ratio of HPLF cells in the control, LPS, LPS + OE-NC, LPS + OE-DSC1, LPS + OE-DSC1 + si-NC, and LPS + OE-DSC1 + si-METTL3 groups was calculated using qRT-PCR. C, The EdU-positive rate of HPLF cells in the control, LPS, LPS + OE-NC, LPS + OE-DSC1, LPS + OE-DSC1 + si-NC, and LPS + OE-DSC1 + si-METTL3 groups was examined using EdU assay. D, The apoptosis rate of HPLF cells in the control, LPS, LPS + OE-NC, LPS + OE-DSC1, LPS + OE-DSC1 + si-NC, and LPS + OE-DSC1 + si-METTL3 groups was assessed using flow cytometry. E, The levels of inflammatory factor (IL-1 β, IL-6, and TNF-α) in HPLF cells from the control, LPS, LPS + OE-NC, LPS + OE-DSC1, LPS + OE-DSC1 + si-NC, and LPS + OE-DSC1 + si-METTL3 groups were examined using the ELISA. F, The NK-κB p65 protein expression in HPLF cells from the control, LPS, LPS + OE-NC, LPS + OE-DSC1, LPS + OE-DSC1 + si-NC, and LPS + OE-DSC1 + si-METTL3 groups was measured using Western blotting. *P < .05, **P < .01 vs control; #P < .05, ##P < .01 vs LPS + OE-NC. ^P < .05, ^^P < .01 vs LPS + OE-DSC1 + si-NC.
Discussion
Periodontitis is a noncommunicable disease in which LPS from periodontal pathogens, along with other virulence factors, stimulates host macrophages and other inflammatory cells, leading to the production of various proinflammatory cytokines.16,17 In this study, we investigated the changes in DSC1 expression in HPLF cells in a periodontitis model and its functional effects on inflammation, apoptosis, and cell survival. Additionally, m6A modification plays a crucial role in periodontitis-associated inflammation and cellular dysfunction. In this study, we identified the m6A methyltransferase METTL3 as a key regulator of DSC1 through differential m6A modification. This is the first study to suggest that METTL3 mediates the m6A modification of DSC1, regulating inflammation and cellular dysfunction in periodontitis.
Over the years, the role of DSC1 in human diseases, including tumors,18 atherosclerosis,19 and Alzheimer’s disease,20 has garnered increasing attention from researchers. Furthermore, the differential expression of DSC1 has also been reported in periodontitis. DSC1 is an important candidate gene for characterizing invasive periodontitis, closely related to humoral immune response and organic damage/abnormalities.21 Abe et al.22 reported that DSC1 was downregulated by more than 50% in the gingival tissue affected by periodontitis. This downregulation may be related to the stimulation of leukocyte transendothelial migration and impairment of intercellular communication in periodontitis. We examined PDL tissues from patients with periodontitis and found that DSC1 levels were lower than those in healthy individuals. Furthermore, we established an HPLF cell periodontitis model in vitro using LPS and found that the reduced cell survival rate, along with increased apoptosis and inflammation caused by periodontitis, could be reversed by overexpression of DSC1, indicating the therapeutic effect of DSC1 on periodontitis.
M6A methylation modification is crucial for gene expression as it regulates the stability of gene transcripts and is associated with the progression of various diseases. Previous studies have shown that METTL3 regulates the injury of periodontitis. For example, Zhang et al.23 reported that METTL3 knockdown impaired ribosome biogenesis and oxidative phosphorylation in osteoblasts during periodontitis, thereby exacerbating the local inflammatory status and alveolar bone loss in mice; alternatively, METTL3 overexpression enhanced ribosomal and mitochondrial function. Li et al.24 discovered that METTL3 promotes the m6A modification of IRE1α in the endoplasmic reticulum, upregulating its expression and regulating the inflammatory response in periodontitis model cells and animals, ultimately impacting the disease. Hence, METTL3 is regarded as an important m6A modification factor in periodontitis. In the present study, METTL3 was expressed at low levels in patients with periodontitis and in the periodontitis model cells. Additionally, its knockdown inhibited the survival of the periodontitis model cells, promoting apoptosis and inducing inflammation. These results are consistent with previous reports on the inhibition of periodontitis inflammatory response and cellular dysfunction by METTL3. Furthermore, we explored the mechanism between METTL3 and DSC1 for the first time, with data elucidating that METTL3 promotes the m6A modification of DSC1, thereby stabilizing DSC1 mRNA expression in periodontitis. The knockdown of METTL3 partially reversed the alleviating effect of DSC1 upregulation on periodontitis-associated inflammation and cellular dysfunction, indicating that the METTL3–DSC1 axis may contribute to the modulation of periodontal inflammation and fibroblast function. It is important to note that METTL3 influences periodontitis through multiple downstream targets and pathways, including those involved in osteoblast ribosome biogenesis, YAP m6A modification, and the PI3K/Akt signaling pathway.23,25,26 Further studies are needed to elucidate these interconnected mechanisms in greater detail.
In this study, METTL3/DSC1 was only tested in cell models, and the role of this axis in the alveolar bone tissues of animals with periodontitis remains unknown. Additionally, the correlation between METTL3 and DSC1 expression and periodontitis severity in patients—and whether these markers can help predict the need for surgical treatment—warrants further investigation.
Conclusion
This study uncovered the molecular mechanisms underlying periodontitis-associated inflammation and cellular dysfunction, revealing that both DSC1 and METTL3 are downregulated in this condition. Additionally, METTL3 was found to promote DSC1 expression by upregulating the m6A modification of DSC1. Our study suggests that DSC1 and METTL3 play a crucial role in delaying periodontitis-associated inflammation and cellular dysfunction, indicating that targeting the METTL3-m6A-DSC1 axis might have therapeutic significance for periodontitis.
Consent to participate
All patients have signed an informed written consent.
Consent for publication
All participants provided consent for publication.
Authors' contributions
Acquisition, analysis, or interpretation of data: Qin Su.
Drafting of the manuscript: Qin Su, Jiao Chen.
Conducted the experiments: Qin Su.
Concept and design: Jiao Chen.
Read and approved this manuscript: Qin Su, Jiao Chen.
Ethics approval
This research has been approved by the Ethics Committee of Wuhan Fourth Hospital (Wuhan, China). The processing of clinical samples had been in strict compliance with the ethical standards of the Declaration of Helsinki. All patients provided their written informed consent.
Funding
This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
Declaration of competing interest
None disclosed.
Availability of data and material
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Footnotes
Supplementary material associated with this article can be found in the online version at doi:10.1016/j.identj.2025.109347.
Appendix. Supplementary materials
References
- 1.Kwon T., Lamster I.B., Levin L. Current concepts in the management of periodontitis. Int Dent J. 2021;71:462–476. doi: 10.1111/idj.12630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Nascimento G.G., Alves-Costa S., Romandini M. Burden of severe periodontitis and edentulism in 2021, with projections up to 2050: the global burden of disease 2021 study. J Periodontal Res. 2024;59:823–867. doi: 10.1111/jre.13337. [DOI] [PubMed] [Google Scholar]
- 3.Masumoto R., Kitagaki J., Fujihara C., et al. Identification of genetic risk factors of aggressive periodontitis using genomewide association studies in association with those of chronic periodontitis. J Periodontal Res. 2019;54:199–206. doi: 10.1111/jre.12620. [DOI] [PubMed] [Google Scholar]
- 4.Loos B.G., Van Dyke T.E. The role of inflammation and genetics in periodontal disease. Periodontol 2000. 2020;83:26–39. doi: 10.1111/prd.12297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Choi H.Y., Ruel I., Malina A., et al. Desmocollin 1 is abundantly expressed in atherosclerosis and impairs high-density lipoprotein biogenesis. Eur Heart J. 2018;39:1194–1202. doi: 10.1093/eurheartj/ehx340. [DOI] [PubMed] [Google Scholar]
- 6.Bartolome R.A., Pintado-Berninches L., Martin-Regalado A., et al. A complex of cadherin 17 with desmocollin 1 and p120-catenin regulates colorectal cancer migration and invasion according to the cell phenotype. J Exp Clin Cancer Res. 2024;43:31. doi: 10.1186/s13046-024-02956-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Lapcik P., Sulc P., Janacova L., et al. Desmocollin-1 is associated with pro-metastatic phenotype of luminal a breast cancer cells and is modulated by parthenolide. Cell Mol Biol Lett. 2023;28:68. doi: 10.1186/s11658-023-00481-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kim Y.G., Kim M., Kang J.H., et al. Transcriptome sequencing of gingival biopsies from chronic periodontitis patients reveals novel gene expression and splicing patterns. Hum Genomics. 2016;10:28. doi: 10.1186/s40246-016-0084-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kim D.M., Ramoni M.F., Nevins M., Fiorellini J.P. The gene expression profile in refractory periodontitis patients. J Periodontol. 2006;77:1043–1050. doi: 10.1902/jop.2006.050254. [DOI] [PubMed] [Google Scholar]
- 10.Guzeldemir-Akcakanat E., Sunnetci-Akkoyunlu D., Orucguney B., et al. Gene-expression profiles in generalized aggressive periodontitis: a gene network-based microarray analysis. J Periodontol. 2016;87:58–65. doi: 10.1902/jop.2015.150175. [DOI] [PubMed] [Google Scholar]
- 11.Wei G. RNA m6A modification, signals for degradation or stabilisation? Biochem Soc Trans. 2024;52:707–717. doi: 10.1042/BST20230574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Oerum S., Meynier V., Catala M., Tisne C. A comprehensive review of m6A/m6Am RNA methyltransferase structures. Nucleic Acids Res. 2021;49:7239–7255. doi: 10.1093/nar/gkab378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lin W., Xu H., Wu Y., Wang J., Yuan Q. In silico genome-wide identification of m6A-associated SNPs as potential functional variants for periodontitis. J Cell Physiol. 2020;235:900–908. doi: 10.1002/jcp.29005. [DOI] [PubMed] [Google Scholar]
- 14.Zhou X., Yang X., Huang S., et al. Inhibition of METTL3 alleviates NLRP3 inflammasome activation via increasing ubiquitination of NEK7. Adv Sci (Weinh) 2024;11 doi: 10.1002/advs.202308786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wu X., Zhang G., Feng X., Li P., Tan Y. Transcriptome analysis of human periodontal ligament fibroblasts exposed to Porphyromonas gingivalis LPS. Arch Oral Biol. 2020;110 doi: 10.1016/j.archoralbio.2019.104632. [DOI] [PubMed] [Google Scholar]
- 16.Sanz M., Marco Del Castillo A., Jepsen S., et al. Periodontitis and cardiovascular diseases: consensus report. J Clin Periodontol. 2020;47:268–288. doi: 10.1111/jcpe.13189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Teughels W., Feres M., Oud V., Martin C., Matesanz P., Herrera D. Adjunctive effect of systemic antimicrobials in periodontitis therapy: a systematic review and meta-analysis. J Clin Periodontol. 2020;47(Suppl 22):257–281. doi: 10.1111/jcpe.13264. [DOI] [PubMed] [Google Scholar]
- 18.Wang Y., Chen C., Wang X., et al. Lower DSC1 expression is related to the poor differentiation and prognosis of head and neck squamous cell carcinoma (HNSCC) J Cancer Res Clin Oncol. 2016;142:2461–2468. doi: 10.1007/s00432-016-2233-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Choi H.Y., Iatan I., Ruel I., et al. Docetaxel as a model compound to promote HDL (high-density lipoprotein) biogenesis and reduce atherosclerosis. Arterioscler Thromb Vasc Biol. 2023;43:609–617. doi: 10.1161/ATVBAHA.122.318275. [DOI] [PubMed] [Google Scholar]
- 20.Ramos M.C., Tenorio R., Martinez-Garcia A., et al. Association of DSC1, a gene modulated by adrenergic stimulation, with Alzheimer's disease. Neurosci Lett. 2006;408:203–208. doi: 10.1016/j.neulet.2006.09.005. [DOI] [PubMed] [Google Scholar]
- 21.Sunnetci-Akkoyunlu D., Guzeldemir-Akcakanat E., Alkan B., et al. Altered expression of MZB1 in periodontitis: a possible link to disease pathogenesis. J Periodontol. 2023;94:1285–1294. doi: 10.1002/JPER.23-0224. [DOI] [PubMed] [Google Scholar]
- 22.Abe D., Kubota T., Morozumi T., et al. Altered gene expression in leukocyte transendothelial migration and cell communication pathways in periodontitis-affected gingival tissues. J Periodontal Res. 2011;46:345–353. doi: 10.1111/j.1600-0765.2011.01349.x. [DOI] [PubMed] [Google Scholar]
- 23.Zhang Y., Kong Y., Zhang W., et al. METTL3 promotes osteoblast ribosome biogenesis and alleviates periodontitis. Clin Epigenetics. 2024;16:18. doi: 10.1186/s13148-024-01628-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li L., Wang Y., Gao L., Wu S., Jin Y. Curcumin-carbon dots suppress periodontitis via regulating METTL3/IRE1alpha signaling. Crit Rev Eukaryot Gene Expr. 2025;35:25–35. doi: 10.1615/CritRevEukaryotGeneExpr.2024054463. [DOI] [PubMed] [Google Scholar]
- 25.Sun X., Meng X., Piao Y., Dong S., Dong Q. METTL3 promotes the osteogenic differentiation of human periodontal ligament cells by increasing YAP activity via IGF2BP1 and YTHDF1-mediated m(6)A modification. J Periodontal Res. 2024;59:1017–1030. doi: 10.1111/jre.13297. [DOI] [PubMed] [Google Scholar]
- 26.Chen H., Peng L., Wang Z., He Y., Zhang X. Influence of METTL3 knockdown on PDLSC osteogenesis in E. coli LPS-induced inflammation. Oral Dis. 2024;30:3225–3238. doi: 10.1111/odi.14763. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




