Abstract
Background
Cancer-associated fibroblasts (CAFs) are key regulators in tumor microenvironment and tumor immunity, partly through MHC-II expression that modulates T-cell differentiation. However, the upstream cytokine signals controlling MHC-II expression in fibroblasts still remain poorly defined.
Methods
We examined MHC-II expression on fibroblasts under stimulation with interferon-γ (IFN-γ) and interleukin-1β (IL-1β) by using flow cytometry, transcriptomic analysis, and qRT-PCR. To dissect transcriptional regulation, we generated CIITA-overexpressing and CIITA-deficient fibroblast lines by lentiviral transduction and CRISPR/Cas9-mediated editing. Public scRNA-seq, ATAC-seq, and ChIP-seq datasets were further analyzed to validate molecular mechanisms.
Results
IFN-γ robustly up-regulated MHC-II expression on fibroblasts, while IL-1β selectively suppressed this induction without affecting PD-L1. Mechanistically, IL-1β attenuated IFN-γ–induced CIITA expression at the mRNA level but did not alter STAT1 abundance or phosphorylation. Functional assays confirmed that CIITA was indispensable for IFN-γ–driven MHC-II expression in fibroblasts. Integration of transcriptomic and epigenomic data demonstrated that CIITA directly bound MHC-II gene promoters and regulated chromatin accessibility.
Conclusions
Our study identifies an IFN-γ/STAT1/CIITA axis as the central regulator of MHC-II expression in fibroblasts and reveals IL-1β as a potent suppressor of this pathway. These findings highlight a novel cytokine-mediated regulatory mechanism underlying CAF-driven immunosuppression within the tumor microenvironment.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12964-025-02575-4.
Keywords: IFN-γ, IL-1β, Fibroblasts, MHC-II, CIITA
Introduction
Cancer-associated fibroblasts (CAFs), as key stromal components in the tumor microenvironment (TME), play a vital role in tumor development [1]. Based on spatial distribution and functional gene expression, CAFs can be subdivided into distinct subtypes: (1). myofibroblastic CAFs (myCAFs), which are located adjacent to tumor cells, contribute to extracellular matrix (ECM) remodeling and exhibit high levels of α-smooth muscle actin (α-SMA) and a transforming growth factor beta (TGF-β)-responsive gene signature. (2). inflammatory CAFs (iCAFs), typically found in fibroproliferative regions distant from tumor cells, show low α-SMA expression but high levels of interleukin-6 (IL-6) and inflammatory leukemia inhibitory factors. (3). antigen-presenting CAFs (apCAFs), which are marked by elevated expression of major histocompatibility complex class II (MHC-II) genes and CD74, and are implicated in T-cell regulation [2]. CAFs expressing MHC-II are critical modulators of immune dynamics within the TME. Specifically, apCAFs can activate CD4⁺T cells and promote their differentiation into regulatory T cells (Tregs) through MHC-II/TCR interactions, thereby facilitating immunosuppression [3].
MHC-II molecules function as antigen-presenting proteins that activate CD4⁺T lymphocytes by presenting processed peptides, thereby playing a central role in the initiation of adaptive immune responses [4, 5]. In the thymus, MHC-II presents a range of self-antigens to facilitate the maturation of CD4⁺T cells [6]. Under normal conditions, MHC-II is constitutively expressed by professional antigen-presenting cells (APCs), such as dendritic cells (DCs), macrophages, and activated B cells [7]. However, upon stimulation by interferon-γ (IFN-γ), MHC-II expression can also be induced in non-professional APCs, including fibroblasts, astrocytes, and endothelial cells [8–10].
The expression of MHC-II molecules is predominantly regulated at the transcriptional level, orchestrated by conserved cis-regulatory elements located within the proximal promoter of MHC-II genes, namely the W/S, X, and Y motifs [5]. While these elements are indispensable for transcriptional activation, they require the non-DNA-binding coactivator CIITA (class II transactivator) to initiate gene expression [11]. It has been well known that the transcription factor CIITA serves as the master regulator of MHC-II expression [12]. Rather than binding DNA directly, CIITA functions by recruiting and assembling a multi-protein transcriptional complex at the proximal promoter of MHC-II genes within the nucleus [13].
CIITA is constitutively expressed in professional APCs, whereas in non-professional APCs, its expression is inducible by IFN-γ [12]. The transcription of CIITA itself is governed by three independent promoters, PI, PIII, and PIV, each exhibiting cell-type specificity. PI is selectively active in myeloid lineages, including macrophages and conventional DCs. PIII operates in lymphoid cells, particularly B-cell and activated human T-cell subsets. In contrast, PIV is uniquely responsive to IFN-γ stimulation and is activated in IFN-γ-induced cell populations [14]. Activation of the CIITA PIV promoter involves a coordinated response mediated by several regulatory elements, including GAS, E-box, and IRF motifs [11]. Once expressed and translocated into the nucleus, CIITA facilitates the recruitment of RFX transcription factors to the MHC-II promoter, promoting the assembly of an enhanceosome-like complex that drives robust MHC-II transcription [4, 13, 15].
The expression of MHC-II molecules is modulated by a diverse array of cytokines [16]. Among them, IFN-γ, secreted by natural killer (NK) cells, natural killer T (NKT) cells, CD8⁺T cells, and CD4⁺T cells, is a well-established inducer of MHC-II expression [17, 18]. In non-hematopoietic cells such as fibroblasts, endothelial cells, and epithelial cells, IFN-γ triggers MHC-II expression through activation of the CIITA PIV promoter [14]. Additionally, in vitro studies suggest that other cytokines, including IL-27 and IL-18, may also stimulate MHC-II expression in epithelial cells [19, 20]. Pro-inflammatory cytokines such as IL-1, TGF-α, and TGF-β have been implicated in modulating MHC-II levels across different cell types [21–23]. Notably, IL-1 has been shown to suppress Treg-mediated tumor immune evasion by down-regulating MHC-II expression in fibroblasts [24]. Given this context, the present study investigated the molecular mechanisms by which IL-1 governed MHC-II expression in fibroblasts.
Materials and methods
Cell lines and primary fibroblast preparation
The mouse embryonic fibroblast cell line NIH3T3 was obtained from the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Thermo Fisher Scientific, USA) supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin under standard conditions. Primary dermal fibroblasts were isolated following the protocol described in our previous study [25]. Briefly, mouse ears were excised, finely minced, and enzymatically digested in DMEM containing 2.5 mg/mL collagenase D and 1.25 mg/mL pronase (both from Roche) at 37 °C for 1 h. The resulting cell suspension was filtered through a 70-μm cell strainer to remove undigested tissue fragments, followed by centrifugation and subsequent culture in a humidified atmosphere at 37 °C.
Reagents and antibodies
Recombinant mouse IFN-γ (Catalog #315–05–100) and IL-1β (Catalog #211-11B-10) were purchased from PeproTech. Antibodies against STAT1 (Rabbit mAb, Catalog #14994S) and GAPDH (Rabbit mAb, Catalog #5174S) were obtained from Cell Signaling Technology. The jetPRIME® transfection reagent was procured from Polyplus. Flow cytometry antibodies against I-A/I-E (clone M5/114.15.2, Catalog #107614) and CD274/PD-L1 (clone 10F.9G2, Catalog #124308) were purchased from BioLegend (eBioscience).
Immunofluorescence flow cytometry
Primary fibroblasts and NIH3T3 cells were seeded into 6-well plates (Corning) and allowed to adhere overnight in complete medium. Prior to cytokine stimulation, the culture medium was replaced with DMEM/Ham’s F-12 supplemented with 1% FBS to minimize background activation. Cells were left untreated or stimulated with IFN-γ (10 ng/mL) for 1, 4, or 24 h, either in the absence or presence of IL-1β. IL-1β (1 ng/mL) was added either 24 h prior to IFN-γ stimulation or concurrently. Surface expression levels of MHC-II and PD-L1 were assessed by immunofluorescent flow cytometry.
Transcriptomic analysis
Primary murine fibroblasts were stimulated with IL-1β, IFN-γ, or a combination of both cytokines. Following treatment, cells were lysed using TRIzol reagent, and total RNA was extracted from four experimental groups, each with three biological replicates. RNA samples were then fragmented and reversely transcribed to generate cDNA. After end repair, A-tailing, and adaptor ligation, the cDNA libraries were amplified by PCR and sequenced on an Illumina platform. The resulting short reads were aligned to the reference genome, and gene expression levels were quantified post-normalization. Differentially expressed genes (DEGs) were visualized using the R packages ggplot2 and pheatmap, facilitating comprehensive transcriptional comparisons across treatment groups.
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA was isolated from primary fibroblasts using TRIzol® Reagent (Invitrogen) according to the manufacturer’s protocol. Reverse transcription was performed using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara). qRT-PCR was conducted on an Applied Biosystems™ 7500 system (Thermo Fisher Scientific) with TB Green® Premix Ex Taq™ II (Takara). Relative gene expression was calculated using the 2−ΔΔCt method, and GAPDH was selected as the housekeeping gene. Primer sequences are provided in Table 1.
Table 1.
qRT-PCR primers used in the study
| Genes | Primer sequences (5’-) |
|---|---|
| GAPDH | F: AATGGATTTGGACGCATTGGT |
| R: TTTGCACTGGTACGTGTTGAT | |
| MHC-II | F: TGGGAGTCTTGACTAAGAGGTC |
| R: CTGACTTGCTATTTCTGAGCCAT | |
| PD-L1 | F: GCTCCAAAGGACTTGTACGTG |
| R: TGATCTGAAGGGCAGCATTTC | |
| STAT1 | F: TCACAGTGGTTCGAGCTTCAG |
| R: GCAAACGAGACATCATAGGCA | |
| CIITA | F: TGCGTGTGATGGATGTCCAG |
| R: CCAAAGGGGATAGTGGGTGTC | |
| IRF1 | F: ATGCCAATCACTCGAATGCG |
| R: TTGTATCGGCCTGTGTGAATG | |
| IRF2 | F: AATTCCAATACGATACCAGGGCT |
| R: GAGCGGAGCATCCTTTTCCA | |
| IRF3 | F: GAGAGCCGAACGAGGTTCAG |
| R: CTTCCAGGTTGACACGTCCG | |
| IRF4 | F: TCCGACAGTGGTTGATCGAC |
| R: CCTCACGATTGTAGTCCTGCTT | |
| IRF5 | F: AGAGACAGGGAAGTACACTGAAG |
| R: TGGAAGTCACGGCTTTTGTTAAG | |
| IRF6 | F: CTCTCCCCATGACTGACTTGG |
| R: CAGGTCCCCATAGAAGAGCC | |
| IRF7 | F: GAGACTGGCTATTGGGGGAG |
| R: GACCGAAATGCTTCCAGGG | |
| IRF8 | F: AGACCATGTTCCGTATCCCCT |
| R: CACAGCGTAACCTCGTCTTCC | |
| IRF9 | F: GCCGAGTGGTGGGTAAGAC |
| R: GCAAAGGCGCTGAACAAAGAG |
Western blotting analysis
Primary fibroblasts were lysed on ice in RIPA buffer (Sigma) supplemented with a protease inhibitor cocktail (Sigma). Protein extracts were resolved on 4–20% Tris–Glycine gels (Thermo Fisher Scientific) and transferred onto nitrocellulose membranes (Bio-Rad). Membranes were blocked with 5% blotting-grade blocker (Bio-Rad) and incubated overnight at 4 °C with primary antibodies against STAT1, and phosphorylated STAT1 (pSTAT1). GAPDH was adopted as the loading control. After washing, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Immunoreactive bands were visualized using the Pierce ECL Plus Substrate (Thermo Fisher Scientific).
Lentiviral transduction
Lentiviral vectors encoding CIITA and corresponding control viruses were synthesized and supplied by GENE (Shanghai, China). NIH3T3 cells were seeded in 96-well plates and incubated overnight until reaching 50–60% confluence. Cells were then transduced with lentivirus at a multiplicity of infection (MOI) of 25 and cultured for 48 h. Subsequently, transduced NIH3T3 cells were subjected to four treatment conditions: (1) medium alone for 48 h. (2) IL-1β (1 ng/mL) for 48 h. (3) medium for 24 h followed by IFN-γ (10 ng/mL) for 24 h. (4) IL-1β for 24 h followed by IFN-γ for 24 h. Surface expression of MHC-II and PD-L1 was analyzed by flow cytometry.
CRISPR-Cas9-mediated CIITA depletion
Targeted disruption of the Ciita gene was performed using CRISPR-Cas9 ribonucleoprotein (RNP) complexes containing hSpCas9 and chimeric guide RNAs (gRNAs). Two gRNAs targeting exons 2 to 12 of Ciita, sequence 1: 5′-CATGGTACTCAAGCCATATG GGG-3′ and sequence 2: 5′-ATAGGCACGCAATCCTGGGT AGG-3′, were selected via the online tool at http://crispr.mit.edu. Plasmids encoding these gRNAs were introduced into NIH3T3 cells by electroporation using the Neon Transfection System (Thermo Fisher Scientific) according to the manufacturer’s protocol. After 48 h, single-cell clones were isolated by limiting dilution into 96-well plates.
Genomic DNA from expanded clones was extracted using the Quick-DNA Miniprep Kit (Zymo Research). PCR amplification flanking the targeted exon region was performed with 2 × Taq Master Mix (Dye Plus; Vazyme, P112) using the primers: forward, 5′-CCTGCCACCATTACCCCAAT-3′; reverse, 5′-AAAGCCAGAAAACACCCTGC-3′. PCR products from 8–10 clones were subjected to Sanger sequencing (GENEWIZ, China) to identify insertions or deletions (indels). Clones harboring biallelic mutations were selected for downstream functional assays. The resulting cell lines included homozygous wild-type (+/+), heterozygous (+/−), compound heterozygous (+/− A, +/− B), and homozygous knockout (−/−) clones. All clones were cultured under the same conditions as parental NIH3T3 cells. Primer sequences for CIITA screening are detailed in Table 2.
Table 2.
CIITA screen primer sequences
| Site | Genes | Primer sequences (5’-) |
|---|---|---|
| Primers for Region 1 | Screen F1 | CCTGCCACCATTACCCCAAT |
| Screen R1 | AAAGCTCATCGTTCTGGGGG | |
| Primers for Region 2 | Screen F2 | TAAGTCTGGCTGCCTGAACA |
| Screen R2 | AAAGCCAGAAAACACCCTGC | |
| Primers for Region 3 | Screen F3 | CCTGCCACCATTACCCCAAT |
| Screen R3 | AAAGCCAGAAAACACCCTGC |
Single-cell RNA-seq (scRNA-seq) data processing
scRNA-seq data of the integrated fibroblast atlas were downloaded from FibroXplorer (https://www.fibroxplorer.com/download) [26]. The R software (version 3.6.3) was used to import the RData files for downstream analysis using the Seurat package (version 3.2.3). To assess differences between steady-state and perturbed conditions, fibroblasts from all experimental groups were further integrated. DEG patterns were visualized using the DotPlot function.
scRNA-seq data of enriched fibroblasts from a pancreatic ductal adenocarcinoma (PDAC) model were obtained from GEO (GSE129455) [27]. Following the Seurat pipeline, the expression matrices underwent dimensionality reduction and unsupervised clustering. CAFs were subsequently classified into three distinct subpopulations based on marker genes reported by the original authors. Visualization of expression levels was performed using the VlnPlot function.
CAFs derived from our previously published dataset were subjected to SCENIC (Single-Cell Regulatory Network Inference and Clustering) analysis [27]. Motif databases scoring gene promoter regions (up to 500 bp and 10 kb upstream of transcription start sites) were downloaded from https://resources.aertslab.org/cistarget/. Regulon activity scores were then compared between experimental groups.
ATAC-seq and ChIP-seq data processing
ATAC-seq datasets of fibroblasts were retrieved from GEO (GSE120083). ChIP-seq data for CIITA in human B cells were downloaded from GEO (GSE52941). The downloaded wig-format files were imported into the Integrative Genomics Viewer (IGV) software for visualization and analysis of STAT1 and CIITA binding at promoter regions of target genes.
Statistical analysis
Statistical analyses were conducted using GraphPad Prism software (version 8.0). Data were presented as mean ± standard error of the mean (SEM). Two-tailed unpaired Student’s t-tests were used for comparisons between two groups, while one-way ANOVA followed by appropriate post hoc tests was applied for multiple group comparisons. Statistical significance was defined as ns (not significant, P > 0.05), *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
Results
Up-regulation of MHC-II expression on fibroblasts in perturbed states
MHC-II molecules, critical antigen-presenting components of the adaptive immune response [4, 16], are predominantly expressed by professional APCs such as macrophages and DCs [14]. However, the expression and functional role of MHC-II on fibroblasts remain poorly characterized. To address this gap, we analyzed integrated scRNA-seq datasets encompassing both steady-state and perturbed-state fibroblast atlases from mice and humans [26] (Fig. 1A-C). Notably, transcripts encoding MHC-II-associated molecules, including H2-Ab1 (mouse homolog of human HLA-DRB1) and Cd74 (invariant chain), were detectable in subsets of fibroblasts across species (Fig. 1D-F).
Fig. 1.
MHC-II expression is up-regulated on human and mouse fibroblasts under perturbed conditions. A-C scRNA-seq data downloaded from https://www.fibroxplorer.com/download. Uniform manifold approximation and projection (UMAP) visualizations show the clustering of distinct cell populations based on the authors’ annotations [26]. A Steady-state mouse fibroblast atlas. B Perturbed-state mouse fibroblast atlas. C Perturbed-state human fibroblast atlas. D-F UMAP plots depicting expression of H2-Ab1 (mouse)/HLA-DRB1 (human) and Cd74 (CD74) in mouse and human fibroblasts. D Steady-state mouse fibroblasts. E Perturbed-state mouse fibroblasts. F Perturbed-state human fibroblasts. G-J Dot plots illustrating H2-Ab1 (HLA-DRB1) and Cd74 (CD74) expression across multiple tissues. G Various tissues in steady-state mouse fibroblasts. H Various tissues in perturbed-state mouse fibroblasts. I Comparison of steady vs. perturbed state in mouse fibroblasts across tissues. J Various tissues in perturbed-state human fibroblasts
Further dissection of the steady-state mouse fibroblast atlas revealed predominant expression of H2-Ab1 and Cd74 within fibroblasts derived from the spleen, omentum, and arteries (Fig. 1G). Strikingly, in perturbed conditions, these genes exhibited elevated expression in fibroblasts isolated from liver, artery, lung, and skin tissues (Fig. 1H). Comparative analysis demonstrated a significant up-regulation of H2-Ab1 and Cd74 in perturbed-state fibroblasts relative to steady-state, with the most pronounced increases observed in arterial and cutaneous fibroblast populations (Fig. 1I). Correspondingly, in perturbed human fibroblasts, HLA-DRB1 and CD74 were broadly expressed across colon and lung tissues (Fig. 1J). Collectively, these data indicated that MHC-II-related molecules were up-regulated on fibroblasts under perturbed conditions, suggesting an enhanced immunological role of fibroblasts during tissue stress or inflammation.
IL-1β suppresses IFN-γ–induced MHC-II expression on fibroblasts
To elucidate the signaling pathways regulating MHC-II expression in fibroblasts under perturbed conditions, we analyzed scRNA-seq data from a PDAC model [28]. CAFs were clearly stratified into three subtypes: iCAFs, myCAFs, and apCAFs (Fig. 2A). MHC-II-associated genes, including H2-Aa, H2-Ab1, and H2-Eb1, were predominantly expressed in apCAFs (data not shown). Given that STAT1 is a pivotal transcription factor downstream of IFN-γ signaling [29, 30], we observed specific enrichment of Stat1 transcripts in apCAFs (Fig. 2B), implicating IFN-γ signaling as a key driver of MHC-II upregulation in fibroblasts.
Fig. 2.
IL-1β suppresses IFN-γ-induced MHC-II expression in primary fibroblasts. A UMAP visualization identifies iCAF, myCAF, and apCAF subpopulations of CAFs in a PDAC model. B Violin plots showing Stat1 expression levels across iCAF, myCAF, and apCAF subsets. C Bar plot representing Stat1 regulon scores in CAFs from Foxp3cre and Il1r2fl/flFoxp3cre mice following anti-PD-1 treatment. D-G NIH3T3 cells or primary fibroblasts were treated under four conditions: medium 48 h, IL-1β (1 ng/mL) 48 h, medium 24 h + IFN-γ (10 ng/mL) 24 h, and IL-1β 24 h + IFN-γ 24 h. MHC-II and PD-L1 expression were assessed by flow cytometry. D, E NIH3T3 cells. F, G Primary fibroblasts. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (Student’s t-test)
To experimentally validate this, NIH3T3 fibroblasts were stimulated with IFN-γ, resulting in robust induction of MHC-II expression after 24 h, consistent with scRNA-seq findings (Fig. 2D, E; Supplementary Fig. 1A-D). Next, SCENIC analysis of fibroblasts from previously published datasets [24] revealed a marked decrease in Stat1 regulon activity in Il1r2fl/flFoxp3Cre mice (Fig. 2C), suggesting that IL-1β signaling might modulate MHC-II expression by antagonizing IFN-γ pathways.
To test this hypothesis, NIH3T3 cells were co-stimulated with IFN-γ and IL-1β. As predicted, IL-1β significantly attenuated IFN-γ-induced MHC-II expression, whereas the expression of PD-L1 remained unaffected (Fig. 2D, E). Notably, IL-1β alone did not alter MHC-II levels (Fig. 2D, E). These findings were recapitulated in primary murine fibroblasts, further confirming the inhibitory effect of IL-1β on IFN-γ–mediated MHC-II induction (Fig. 2F, G). Collectively, these data demonstrated that IL-1β directly suppressed IFN-γ-induced MHC-II expression on fibroblasts, revealing a novel regulatory axis in the modulation of fibroblast immunogenicity.
IL-1β does not alter STAT1 expression or phosphorylation but selectively suppresses MHC-II gene induction
To delineate the molecular mechanisms by which IFN-γ and IL-1β coordinately regulated MHC-II expression in fibroblasts, we conducted transcriptomic profiling of primary murine fibroblasts following stimulation with IFN-γ, IL-1β, or their combination. Co-stimulation resulted in the up-regulation of 1,657 genes (Fig. 3A). IFN-γ alone robustly induced canonical IFN-responsive genes such as Cd274, Irf1, Irf7, and Irf8, with IL-1β co-treatment exerting minimal impact on their expression (Fig. 3E). In contrast, key MHC-II genes, including H2-Ab1, H2-Aa, and Cd74, along with critical down-stream IFN signaling transcription factors Stat1 and Ciita, were significantly down-regulated upon IL-1β and IFN-γ co-stimulation (Fig. 3B-D).
Fig. 3.
IL-1β inhibits IFN-γ-induced expression of IRF1/2/8/9 in primary fibroblasts. A Number of genes up-regulated and down-regulated in primary murine fibroblasts following stimulation with IFN-γ and/or IL-1β. B-D Bar graphs depicting expression levels of H2-Aa, Stat1, and Ciita under four stimulation conditions based on transcriptomic analysis. E Heatmap displaying DEG profiles across four stimulation groups. F–H qRT-PCR quantification of genes involved in IFN-γ signaling in primary fibroblasts under four conditions: medium 48 h, IL-1β (1 ng/mL) 48 h, medium 24 h + IFN-γ (10 ng/mL) 24 h, and IL-1β 24 h + IFN-γ 24 h. F MHC-II and PD-L1 expression. G STAT1 and STAT3 expression. H Expression of IRF family members. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (Student’s t-test)
To further investigate whether IL-1β interfered with IFN-γ signaling or downstream transcriptional regulators, primary fibroblasts were pre-treated with IL-1β for 24 h or stimulated with IFN-γ alone for 24 h. Neither MHC-II nor PD-L1 expression was altered by IL-1β treatment alone after 48 h (Fig. 3F). IFN-γ stimulation induced pronounced up-regulation of both MHC-II and PD-L1 compared to controls, whereas simultaneous exposure to IL-1β significantly attenuated MHC-II induction without affecting PD-L1 levels (Fig. 3F). These data highlighted a selective suppressive effect of IL-1β on MHC-II expression, independent of alterations in STAT1 abundance or phosphorylation, underscoring its specific regulatory role in modulating fibroblast immunogenicity.
IFN-γ is a well-established cytokine that up-regulates MHC-II expression via the JAK-STAT signaling pathway [31, 32]. To investigate the potential role of IL-1β in modulating this pathway, we measured the mRNA levels of Stat1 and Stat3, key downstream effectors of IFN-γ signaling. Consistent with scRNA-seq data (Fig. 2A-C), IFN-γ stimulation significantly increased Stat1 and Stat3 expression in fibroblasts. However, the addition of IL-1β to the co-culture did not alter the IFN-γ–induced expression of these genes (Fig. 3G).
Several members of the IFN-regulatory factor (IRF) family, known transcription factors in IFN-γ signalling [33, 34], also showed marked up-regulation at the mRNA level upon IFN-γ treatment, including Irf1, Irf2, Irf7, Irf8, and Irf9 (Fig. 3H). To assess whether IL-1β inhibited MHC-II expression by down-regulating these IRFs, we examined their expression following combined IL-1β and IFN-γ stimulation. Co-treatment reversed the IFN-γ-mediated up-regulation of Irf1, Irf2, Irf8, and Irf9, but not Irf7 (Fig. 3H). Given previous findings that STAT1 and IRF1 can form a transcriptional complex to regulate downstream gene expression [35], our data suggested that IL-1β might suppress MHC-II expression at least in part by down-regulating Irf1.
Next, we performed the western blotting analysis to assess the expression and phosphorylation status of STAT1 in mouse primary fibroblasts stimulated with IFN-γ and IL-1β. Notably, the level of pSTAT1 markedly increased at 0.5 h post-IFN-γ stimulation compared to other time points. By 4 h, pSTAT1 levels decreased in both treatment groups, while total STAT1 expression showed a slight increase. At 24 h post IFN-γ stimulation, pSTAT1 was completely absent, whereas total STAT1 remained mildly elevated (Fig. 4A-B). These results indicated that IL-1β had minimal impact on both the expression and phosphorylation of STAT1, a central transcription factor in the IFN-γ signaling pathway.
Fig. 4.
IL-1β does not affect the expression or phosphorylation of STAT1 in primary fibroblasts. A Western blotting analysis of primary fibroblast lysates after stimulation with: medium 48 h, IL-1β (1 ng/mL) 48 h, IFN-γ (10 ng/mL) at 0.5 h, 1 h, 4 h, 24 h, and co-stimulation with IL-1β 24 h + IFN-γ at same time points. B Quantification of total and phosphorylated STAT1 (pSTAT1) levels under indicated conditions. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (Student’s t-test)
IL-1β inhibits IFN-γ–induced CIITA expression at the mRNA level
Previous studies have demonstrated that the transcription factor CIITA is constitutively expressed in APCs, whereas its expression in fibroblasts remains largely unexplored. To investigate this, we performed qRT-PCR to quantitatively assess CIITA expression in mouse primary fibroblasts stimulated with IFN-γ, using splenocytes from naïve mice as a positive control. As expected, CIITA expression was markedly higher in splenocytes compared to un-stimulated fibroblasts, and was rapidly induced in fibroblasts following IFN-γ stimulation (Fig. 5A). Based on these findings, we hypothesized that IL-1β might suppress MHC-II expression by down-regulating CIITA. Supporting this hypothesis, qRT-PCR analysis revealed that IL-1β significantly inhibited CIITA expression in fibroblasts (Fig. 5B). To further confirm the critical role of CIITA in MHC-II regulation, we generated CIITA-overexpressing mouse primary fibroblasts via lenti-viral transduction (Supplementary Fig. 2 A). Compared to controls, CIITA-overexpressing fibroblasts exhibited elevated MHC-II expression upon IFN-γ stimulation. Nevertheless, IL-1β treatment still suppressed MHC-II expression in these cells (Fig. 5C-D). Collectively, these results indicated that IL-1β inhibited IFN-γ-induced MHC-II expression in fibroblasts by down-regulating CIITA at the mRNA level.
Fig. 5.
IL-1β suppresses IFN-γ-induced Ciita expression at the mRNA level. A qRT-PCR analysis of Ciita expression in splenocytes, un-stimulated primary fibroblasts, and IFN-γ-stimulated primary fibroblasts. B Ciita mRNA levels in primary fibroblasts subjected to four stimulation conditions as in Fig. 4A. C Flow cytometric detection of MHC-II and PD-L1 expression in NIH3T3 cells after lenti-viral transfection for CIITA overexpression. D Bar plot quantifying MHC-II expression in NIH3T3 cells. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (Student’s t-test)
CIITA plays a critical role in regulating MHC-II expression in fibroblasts
To elucidate the role of CIITA in regulating MHC-II expression on fibroblasts, we analyzed publicly available ATAC-seq data from fibroblasts alongside ChIP-seq data of CIITA binding in B cells. This analysis revealed that CIITA bound to the promoter regions of key MHC-II genes, including HLA-DRA and HLA-DPA1, and fibroblasts exhibited high chromatin accessibility at these loci (Fig. 6A-B). These findings suggested that CIITA might directly regulate MHC-II gene expression in fibroblasts.
Fig. 6.
CIITA is critical for MHC-II expression in fibroblasts. A-B Genome browser tracks showing chromatin accessibility in human fibroblasts and CIITA binding to promoter regions of HLA-DRA and HLA-DPA1 genes in B cells. C-D Flow cytometric analysis of MHC-II and PD-L1 expression in wild-type NIH3T3 and CIITA-depleted NIH3T3 cells following stimulation under four conditions described in Fig. 4A. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (Student’s t-test)
To experimentally validate this regulatory role, we generated CIITA-depleted NIH3T3 cells using CRISPR/Cas9 technology (Supplementary Fig. 3A-B), and then assessed MHC-II induction upon IFN-γ stimulation. Compared to wild-type cells, CIITA-deficient NIH3T3 cells showed a significant reduction in MHC-II expression (Fig. 6C-D). Furthermore, IL-1β treatment had no additional effect on MHC-II expression in CIITA-depleted cells (Fig. 6C-D). Collectively, these results demonstrated that CIITA was indispensable for IFN-γ–mediated MHC-II expression in fibroblasts.
Discussion
CAFs are key components of the TME, where they facilitate tumor progression and immune evasion through secretion of growth factors, inflammatory cytokines, and remodeling of the ECM [36]. Accumulating evidence indicates that CAFs promote tumor growth by recruiting immunosuppressive cell populations, including myeloid-derived suppressor cells and neutrophils, thereby indirectly modulating T-cell activity to favor tumor expansion [37]. In addition, CAFs can exert direct immunosuppressive effects by engaging with and inducing apoptosis of CD8⁺T cells [38]. Notably, CAFs expressing MHC-II molecules have emerged as potential immune-modulatory players in pancreatic and breast cancers [39, 40]. While MHC-II expression is predominantly confined to professional APCs, it can be induced in other cell types by IFN-γ [13]. Unlike APCs, however, MHC-II⁺CAFs lack the necessary co-stimulatory molecules to effectively activate CD4⁺T cells, which may instead skew T-cell differentiation toward Tregs, thereby enhancing immune suppression [3]. Our recent studies have revealed that Tregs reinforce and amplify MHC-II expression on CAFs through elevated IL1R2 expression, which competitively sequesters IL-1β. This axis promotes Treg infiltration and functional maintenance within the TME, further contributing to immunosuppression [24]. Collectively, these findings highlight the critical role of MHC-II expression on CAFs and suggest it as an important target for tumor immunotherapy.
In this study, we demonstrated that IFN-γ robustly induced the expression of MHC-II on fibroblasts, whereas IL-1β significantly inhibited MHC-II expression in IFN-γ-stimulated fibroblasts. Therefore, the IL-1β/IL1R1 signaling pathway served as a critical mechanism to suppress the expression of MHC-II-related genes in fibroblasts and the generation of the MHC-II⁺CAF population. These findings provided an important foundation for further research into the regulatory interplay between IFN-γ and IL-1 signaling pathways in controlling MHC-II expression in fibroblasts. Subsequent qRT-PCR and Western blotting analyses confirmed that the IFN-γ/STAT1 pathway markedly up-regulated the expression of MHC-II and its associated genes in fibroblasts. The main limitation of our study is that all experimental validations were conducted in murine fibroblast models. Although these systems allowed us to rigorously dissect the IFN-γ–STAT1–CIITA axis and its regulation by IL-1β, species-specific differences in cytokine signaling and antigen presentation programs may affect the extrapolation of our findings to human systems. Recent single-cell and functional studies have increasingly highlighted the diversity and context dependence of MHC-II–expressing apCAFs across different human tumors, further underscoring the necessity of direct validation in human models [41, 42].
CIITA is a master transcriptional regulator of MHC-II gene expression [43]. It is constitutively expressed in professional APCs, but its expression in non-professional APCs, such as fibroblasts, is inducible by IFN-γ [15]. Our in vitro studies further demonstrated that CIITA played a key role in regulating MHC-II expression in fibroblasts. Primary murine fibroblasts were isolated, cultured, and stimulated with IFN-γ, IL-1β, or a combination of both cytokines. Transcriptome sequencing of these groups, along with controls, revealed that CIITA was significantly up-regulated in response to IFN-γ stimulation, while co-stimulation with IFN-γ and IL-1β significantly down-regulated CIITA expression. To further validate the role of CIITA, NIH3T3 fibroblast cell lines overexpressing Ciita were generated by lenti-viral transduction and then stimulated with IFN-γ, IL-1β, or their combination in vitro. Consistent with our hypothesis, IFN-γ significantly up-regulated MHC-II expression via CIITA induction, whereas IL-1β markedly inhibited this effect. Moreover, analysis of ATAC-seq and ChIP-seq data demonstrated that CIITA bound directly to the promoter regions of the HLA-DRA and HLA-DPA1 genes, with fibroblasts exhibiting high chromatin accessibility at these corresponding sites.
The IL-1β–CIITA axis may have important translational implications in human tumor stroma. IL-1β is a prominent proinflammatory cytokine in many human cancers and has been implicated in promoting tumor-associated inflammation and immune suppression [44, 45]. Preclinical studies show that IL-1β blockade can remodel the TME to favor antitumor immunity, and clinical development of IL-1β inhibitors (e.g., canakinumab) has motivated trials combining anti–IL-1 strategies with immune checkpoint blockade [46–48]. Mechanistically, because CIITA is the master regulator of MHC-II expression downstream of IFN-γ, modulation of IL-1 signaling may influence the abundance or phenotype of MHC-II⁺ CAF subsets and thereby alter CD4⁺ T cell differentiation and Treg recruitment in human tumors [49–51]. If IL-1β inhibition were to restore CIITA-driven MHC-II expression in a context where CAFs co-express adequate co-stimulatory signals, such interventions could reprogram CAF–T cell interactions toward enhanced antitumor immunity. Conversely, given that many MHC-II⁺ CAFs lack classical co-stimulatory molecules, careful evaluation in primary human CAF–T cell co-culture systems will be required to determine whether IL-1 blockade promotes productive CD4⁺ antitumor responses or inadvertently favors Treg induction [52]. These considerations provide a rational basis for testing combined IL-1β blockade and immune checkpoint inhibition in carefully selected tumor contexts, while underscoring the need for direct functional validation in human CAF systems prior to broad clinical translation [53, 54].
In summary, our findings indicated that the IFN-γ/STAT1/CIITA signaling axis played a pivotal role in up-regulating MHC-II expression in fibroblasts, with CIITA serving as a key regulatory factor in this pathway. Furthermore, IL-1β suppressed MHC-II expression by inhibiting CIITA, offering critical insights into the underlying mechanisms of MHC-II-mediated immunosuppression in CAFs.
Supplementary Information
Supplementary Material 1: Fig S1. IL-1β inhibits IFN-γ-induced MHC-II expression on primary fibroblasts at 24 hours.Primary fibroblasts and NIH3T3 cells were treated with IFN-γ, IL-1β, or a combination of IFN-γ plus IL-1β for 1 hour, 4 hours, and 24 hours. Expression levels of MHC-II and PD-L1 were quantified by flow cytometry.Quantitative comparison of MHC-II and PD-L1 expression on primary fibroblasts and NIH3T3 cells at 24 hours. Statistical significance: *P<0.05, **P<0.01,***P<0.001,****P<0.0001. Fig S2. Lenti-viral transfection and sorting strategy for CIITA overexpression.NIH3T3 cells were transfected with either control lenti-virus or CIITA-overexpressing lenti-virus. After 48 hours of culture, GFP-positive NIH3T3 cells were sorted by flow cytometry and subsequently cultured in vitro. Fig S3. PCR validation of CIITA depletion in NIH3T3 cells.Schematic diagram illustrating the PCR target regions for validation. Blue, green, and black shading correspond to Region 1, Region 2, and Region 3, respectively.Agarose gel electrophoresis of genomic DNA PCR products from wild-typeand CIITA-depleted NIH3T3 cells. Region 1: WT, 796 bp; KO, 0 bp. Region 2: WT, 995 bp; KO, 0 bp. Region 3: WT, 15,480 bp; KO, approximately 1,053 bp.
Abbreviations
- MHC-II
Major histocompatibility complex class II
- CAFs
Cancer-associated fibroblasts
- Treg
Regulatory T cell
- TME
Tumor microenvironment
- IFN-γ
Interferon-γ
- IL-1β
Interleukin-1β
- myCAFs
Myofibroblastic CAFs
- ECM
Extracellular matrix
- α-SMA
α-Smooth muscle actin
- TGF-β
Transforming growth factor beta
- iCAFs
Inflammatory CAFs
- APCs
Antigen-presenting cells
- DCs
Dendritic cells
- NK
Natural killer
- NKT
Natural killer T
Authors’ contributions
LC: Writing – original draft, Visualization, Validation, Soft-ware, Methodology, Investigation, Formal analysis, Project administration, Funding acquisition. HJ: Writing – review & editing, Visualization, Supervision, Software, Methodology, Formal analysis. BT: Writing – review & editing, Validation, Investigation, Data curation. RG: Writing – review & editing, Validation, Investigation, Data curation. JC: Writing – review & editing, Investigation, Data curation. SW: Writing – review & editing, Investigation, Data curation. ZF: Writing – review & editing, Methodology, Investigation. YL: Writing – review & editing, Methodology, Investigation. HM: Writing – review & editing, Data curation. XZ: Writing – review & editing, Validation, Supervision, Resources, Project administration. JJ: Writing – review & editing, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Conceptualization.
Funding
The present study was supported by Provincial-level Talent Program for National Center of Technology Innovation for Biopharmaceuticals (NCTIB2024JS0101), the National Natural Science Foundation of China (82473269, 82172689, 32270955), the Key R&D Project of Jiangsu Province (BE2022719 and BE2022721), Changzhou Clinical Medical Center (CZZX202201), Jiangsu Provincial Medical Key Discipline (YXZDXK202236), Prospective Research Program of Changzhou Xitaihu Development Foundation For Frontier Cell-Therapeutic Technology (2024P027, 2022P010), the Leading Talent of Changzhou “The 14th Five-Year Plan” High-Level Health Talents Training Project (2024CZLJ009), Changzhou Medical Center of Nanjing Medical University (CZKYCMCC202301), Changzhou Science and Technology Support Program (CE20235057), Changzhou Science and Technology Project (Applied Based Research CJ20230047, CZ20250020, CJ20250116) and Postgraduate Research & Practice Innovation Program of Jiangsu Province(KYCX23_3265).
Data availability
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
All animal experiments in this study were approved by the Ethics Committee of the Soochow University(202307A0609).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Lujun Chen, Hongwei Jiang and Bo Tan are contributed equally to this work.
Contributor Information
Xiao Zheng, Email: zhengxiao@suda.edu.cn.
Jingting Jiang, Email: jiangjingting@suda.edu.cn.
References
- 1.Zhang H, Yue X, Chen Z, Liu C, Wu W, Zhang N, et al. Define cancer-associated fibroblasts (CAFs) in the tumor microenvironment: new opportunities in cancer immunotherapy and advances in clinical trials. Mol Cancer. 2023;22:159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cords L, Tietscher S, Anzeneder T, Langwieder C, Rees M, de Souza N, et al. Cancer-associated fibroblast classification in single-cell and spatial proteomics data. Nat Commun. 2023;14:4294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Huang H, Wang Z, Zhang Y, Pradhan RN, Ganguly D, Chandra R, et al. Mesothelial cell-derived antigen-presenting cancer-associated fibroblasts induce expansion of regulatory T cells in pancreatic cancer. Cancer Cell. 2022;40:656-673 e657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Axelrod ML, Cook RS, Johnson DB, Balko JM. Biological consequences of MHC-II expression by tumor cells in cancer. Clin Cancer Res. 2019;25:2392–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Buxade M, Huerga Encabo H, Riera-Borrull M, Quintana-Gallardo L, Lopez-Cotarelo P, Tellechea M, et al. Macrophage-specific MHCII expression is regulated by a remote Ciita enhancer controlled by NFAT5. J Exp Med. 2018;215:2901–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Li W, Kim MG, Gourley TS, McCarthy BP, Sant’Angelo DB, Chang CH. An alternate pathway for CD4 T cell development: thymocyte-expressed MHC class II selects a distinct T cell population. Immunity. 2005;23:375–86. [DOI] [PubMed] [Google Scholar]
- 7.Kambayashi T, Laufer TM. Atypical MHC class II-expressing antigen-presenting cells: can anything replace a dendritic cell? Nat Rev Immunol. 2014;14:719–30. [DOI] [PubMed] [Google Scholar]
- 8.Kerdidani D, Aerakis E, Verrou KM, Angelidis I, Douka K, Maniou MA, Stamoulis P, Goudevenou K, Prados A, Tzaferis C, et al. Lung tumor MHCII immunity depends onin situ antigen presentation by fibroblasts. J Exp Med 2022;219:e20210815. [DOI] [PMC free article] [PubMed]
- 9.Vardjan N, Gabrijel M, Potokar M, Svajger U, Kreft M, Jeras M, et al. IFN-gamma-induced increase in the mobility of MHC class II compartments in astrocytes depends on intermediate filaments. J Neuroinflammation. 2012;9:144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Scott NA, Zhao Y, Krishnamurthy B, Mannering SI, Kay TWH, Thomas HE. IFNγ-induced MHC class II expression on islet endothelial cells is an early marker of insulitis but is not required for diabetogenic CD4(+) T cell migration. Front Immunol. 2018;9:2800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Dong Y, Tang L, Letterio JJ, Benveniste EN. The Smad3 protein is involved in TGF-beta inhibition of class II transactivator and class II MHC expression. J Immunol. 2001;167:311–9. [DOI] [PubMed] [Google Scholar]
- 12.Roche PA, Furuta K. The ins and outs of MHC class II-mediated antigen processing and presentation. Nat Rev Immunol. 2015;15:203–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wijdeven RH, van Luijn MM, Wierenga-Wolf AF, Akkermans JJ, van den Elsen PJ. Hintzen RQ. Neefjes J: Chemical and genetic control of IFNgamma-induced MHCII expression. EMBO Rep; 2018. p. 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Reith W, LeibundGut-Landmann S, Waldburger JM. Regulation of MHC class II gene expression by the class II transactivator. Nat Rev Immunol. 2005;5:793–806. [DOI] [PubMed] [Google Scholar]
- 15.Muhlethaler-Mottet A, Di Berardino W, Otten LA, Mach B. Activation of the MHC class II transactivator CIITA by interferon-gamma requires cooperative interaction between Stat1 and USF-1. Immunity. 1998;8:157–66. [DOI] [PubMed] [Google Scholar]
- 16.Oh J, Shin JS. Molecular mechanism and cellular function of MHCII ubiquitination. Immunol Rev. 2015;266:134–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Fuchs A, Vermi W, Lee JS, Lonardi S, Gilfillan S, Newberry RD, et al. Intraepithelial type 1 innate lymphoid cells are a unique subset of IL-12- and IL-15-responsive IFN-gamma-producing cells. Immunity. 2013;38:769–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Loh L, Ivarsson MA, Michaelsson J, Sandberg JK, Nixon DF. Invariant natural killer T cells developing in the human fetus accumulate and mature in the small intestine. Mucosal Immunol. 2014;7:1233–43. [DOI] [PubMed] [Google Scholar]
- 19.Diegelmann J, Olszak T, Goke B, Blumberg RS, Brand S. A novel role for interleukin-27 (IL-27) as mediator of intestinal epithelial barrier protection mediated via differential signal transducer and activator of transcription (STAT) protein signaling and induction of antibacterial and anti-inflammatory proteins. J Biol Chem. 2012;287:286–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Wittmann M, Purwar R, Hartmann C, Gutzmer R, Werfel T. Human keratinocytes respond to interleukin-18: implication for the course of chronic inflammatory skin diseases. J Invest Dermatol. 2005;124:1225–33. [DOI] [PubMed] [Google Scholar]
- 21.Rohn W, Tang LP, Dong Y, Benveniste EN. IL-1 beta inhibits IFN-gamma-induced class II MHC expression by suppressing transcription of the class II transactivator gene. J Immunol. 1999;162:886–96. [PubMed] [Google Scholar]
- 22.Lee YJ, Han Y, Lu HT, Nguyen V, Qin H, Howe PH, et al. TGF-beta suppresses IFN-gamma induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J Immunol. 1997;158:2065–75. [PubMed] [Google Scholar]
- 23.Han Y, Zhou ZH, Ransohoff RM. TNF-alpha suppresses IFN-gamma-induced MHC class II expression in HT1080 cells by destabilizing class II trans-activator mRNA. J Immunol. 1999;163:1435–40. [PubMed] [Google Scholar]
- 24.Chen L, Huang H, Zheng X, Li Y, Chen J, Tan B, Liu Y, Sun R, Xu B, Yang M, et al. IL1R2 increases regulatory T cell population in the tumor microenvironment by enhancing MHC-II expression on cancer-associated fibroblasts. J Immunother Cancer 2022;10:e004585.
- 25.Khan M, Gasser S. Generating primary Fibroblast cultures from mouse ear and tail tissues. J Vis Exp. 2016;107:53565. [DOI] [PMC free article] [PubMed]
- 26.Buechler MB, Pradhan RN, Krishnamurty AT, Cox C, Calviello AK, Wang AW, et al. Cross-tissue organization of the fibroblast lineage. Nature. 2021;593:575–9. [DOI] [PubMed] [Google Scholar]
- 27.Aibar S, Gonzalez-Blas CB, Moerman T, Huynh-Thu VA, Imrichova H, Hulselmans G, et al. SCENIC: single-cell regulatory network inference and clustering. Nat Methods. 2017;14:1083–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Elyada E, Bolisetty M, Laise P, Flynn WF, Courtois ET, Burkhart RA, et al. Cross-species single-cell analysis of pancreatic ductal adenocarcinoma reveals antigen-presenting cancer-associated fibroblasts. Cancer Discov. 2019;9:1102–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ramana CV, Gil MP, Schreiber RD, Stark GR. Stat1-dependent and -independent pathways in IFN-gamma-dependent signaling. Trends Immunol. 2002;23:96–101. [DOI] [PubMed] [Google Scholar]
- 30.Legrier ME, Bieche I, Gaston J, Beurdeley A, Yvonnet V, Deas O, et al. Activation of IFN/STAT1 signalling predicts response to chemotherapy in oestrogen receptor-negative breast cancer. Br J Cancer. 2016;114:177–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rimando JC, Chendamarai E, Rettig MP, Jayasinghe R, Christopher MJ, Ritchey JK, et al. Flotetuzumab and other T-cell immunotherapies upregulate MHC class II expression on acute myeloid leukemia cells. Blood. 2023;141:1718–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Shuai K, Liu B. Regulation of JAK-STAT signalling in the immune system. Nat Rev Immunol. 2003;3:900–11. [DOI] [PubMed] [Google Scholar]
- 33.Tailor P, Tamura T, Ozato K. IRF family proteins and type I interferon induction in dendritic cells. Cell Res. 2006;16:134–40. [DOI] [PubMed] [Google Scholar]
- 34.Erickson AK, Gale M Jr. Regulation of interferon production and innate antiviral immunity through translational control of IRF-7. Cell Res. 2008;18:433–5. [DOI] [PubMed] [Google Scholar]
- 35.Garcia-Diaz A, Shin DS, Moreno BH, Saco J, Escuin-Ordinas H, Rodriguez GA, et al. Interferon receptor signaling pathways regulating PD-L1 and PD-L2 expression. Cell Rep. 2017;19:1189–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mao X, Xu J, Wang W, Liang C, Hua J, Liu J, et al. Crosstalk between cancer-associated fibroblasts and immune cells in the tumor microenvironment: new findings and future perspectives. Mol Cancer. 2021;20:131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Zhang C, Fei Y, Wang H, Hu S, Liu C, Hu R, et al. CAFs orchestrates tumor immune microenvironment-a new target in cancer therapy? Front Pharmacol. 2023;14:1113378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Freeman P, Mielgo A. Cancer-associated Fibroblast mediated inhibition of CD8+ cytotoxic T cell accumulation in tumours: mechanisms and therapeutic opportunities. Cancers (Basel). 2020;12:2689. [DOI] [PMC free article] [PubMed]
- 39.Dart A. Presenting fibroblasts. Nat Rev Cancer. 2022;22:193. [DOI] [PubMed] [Google Scholar]
- 40.Sebastian A, Hum NR, Martin KA, Gilmore SF, Peran I, Byers SW, Wheeler EK, Coleman MA, Loots GG. Single-cell transcriptomic analysis of tumor-derived Fibroblasts and normal tissue-resident Fibroblasts reveals Fibroblast heterogeneity in breast cancer. Cancers (Basel). 2020;12:1307. [DOI] [PMC free article] [PubMed]
- 41.Song J, Wei R, Liu C, Zhao Z, Liu X, Wang Y, et al. Antigen-presenting cancer associated fibroblasts enhance antitumor immunity and predict immunotherapy response. Nat Commun. 2025;16:2175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Weber F, Reese KL, Pantel K, Smit DJ. Cancer-associated fibroblasts as a potential novel liquid biopsy marker in cancer patients. J Exp Clin Cancer Res. 2025;44:127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Masternak K, Muhlethaler-Mottet A, Villard J, Zufferey M, Steimle V, Reith W. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev. 2000;14:1156–66. [PMC free article] [PubMed] [Google Scholar]
- 44.Rebe C, Ghiringhelli F. Interleukin-1beta and cancer. Cancers (Basel). 2020;12:1791. [DOI] [PMC free article] [PubMed]
- 45.Baker KJ, Houston A, Brint E. IL-1 family members in cancer; two sides to every story. Front Immunol. 2019;10:1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Lee JM, Tsuboi M, Kim ES, Mok TS, Garrido P. Overcoming immunosuppression and pro-tumor inflammation in lung cancer with combined IL-1beta and PD-1 inhibition. Future Oncol. 2022;18:3085–100. [DOI] [PubMed] [Google Scholar]
- 47.Garrido P, Pujol JL, Kim ES, Lee JM, Tsuboi M, Gomez-Rueda A, et al. Canakinumab with and without pembrolizumab in patients with resectable non-small-cell lung cancer: CANOPY-N study design. Future Oncol. 2021;17:1459–72. [DOI] [PubMed] [Google Scholar]
- 48.Solomon BJ, Tan DSW, de Castro G Jr, Cobo M, Garassino MC, Zhang J, et al. The Impact of the Tumor Microenvironment on the Effect of IL-1beta Blockade in NSCLC: Biomarker Analyses from CANOPY-1 and CANOPY-N Trials. Cancer Res Commun. 2025;5:632–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Steimle V, Siegrist CA, Mottet A, Lisowska-Grospierre B, Mach B. Regulation of MHC class II expression by interferon-gamma mediated by the transactivator gene CIITA. Science. 1994;265:106–9. [DOI] [PubMed] [Google Scholar]
- 50.Koncina E, Nurmik M, Pozdeev VI, Gilson C, Tsenkova M, Begaj R, et al. IL1R1(+) cancer-associated fibroblasts drive tumor development and immunosuppression in colorectal cancer. Nat Commun. 2023;14(1):4251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Leon Machado JA, Steimle V. The MHC class II transactivator CIITA: not (Quite) the odd-one-out anymore among NLR proteins. Int J Mol Sci. 2021;22:1074. [DOI] [PMC free article] [PubMed]
- 52.Liu L, Wan W, Chang Y, Ao L, Xu Y, Xu X. Crosstalk between heterogeneous cancer-associated fibroblast subpopulations and the immune system in breast cancer: key players and promising therapeutic targets. J Exp Clin Cancer Res. 2025;44:263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zhao Z, Xu D, Zhang Y. Synergistic effect of canakinumab with epidermal growth factor receptor tyrosine kinase inhibitors versus with chemotherapy for non-small cell lung cancer. Transl Lung Cancer Res. 2024;13:1183–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Lee JM, Pujol JL, Zhang J, Leonov O, Tsuboi M, Kim ES, et al. CANOPY-N: a phase 2 study of canakinumab or pembrolizumab, alone or in combination, as neoadjuvant therapy in patients with resectable, stage IB-IIIA NSCLC. JTO Clinical and Research Reports. 2025;6:100859. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Material 1: Fig S1. IL-1β inhibits IFN-γ-induced MHC-II expression on primary fibroblasts at 24 hours.Primary fibroblasts and NIH3T3 cells were treated with IFN-γ, IL-1β, or a combination of IFN-γ plus IL-1β for 1 hour, 4 hours, and 24 hours. Expression levels of MHC-II and PD-L1 were quantified by flow cytometry.Quantitative comparison of MHC-II and PD-L1 expression on primary fibroblasts and NIH3T3 cells at 24 hours. Statistical significance: *P<0.05, **P<0.01,***P<0.001,****P<0.0001. Fig S2. Lenti-viral transfection and sorting strategy for CIITA overexpression.NIH3T3 cells were transfected with either control lenti-virus or CIITA-overexpressing lenti-virus. After 48 hours of culture, GFP-positive NIH3T3 cells were sorted by flow cytometry and subsequently cultured in vitro. Fig S3. PCR validation of CIITA depletion in NIH3T3 cells.Schematic diagram illustrating the PCR target regions for validation. Blue, green, and black shading correspond to Region 1, Region 2, and Region 3, respectively.Agarose gel electrophoresis of genomic DNA PCR products from wild-typeand CIITA-depleted NIH3T3 cells. Region 1: WT, 796 bp; KO, 0 bp. Region 2: WT, 995 bp; KO, 0 bp. Region 3: WT, 15,480 bp; KO, approximately 1,053 bp.
Data Availability Statement
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.






