In vivo inhibition of c-MYC in the metastatic drug-resistant ovarian cancer cells down regulates the c-MYC-PD-L1-PAX8-p21 to achieve therapeutic efficacy

Abstract

Metastatic, drug-resistant ovarian cancer is the deadliest form of gynecological cancer afflicting women globally, with > 49% relapse rate following initial diagnosis, surgery and treatment. High-grade serous ovarian cancer is the most diagnosed type of ovarian cancer. In the USA, 21,000 patients are diagnosed annually, with > 50% of patients succumbing to the disease due to metastasis and treatment resistance. The mainstay treatment for ovarian cancer is platinum-based chemotherapy, such as cisplatin or carboplatin and in combination with a taxane (paclitaxel/docetaxel). However, patients often become resistant to it, due to the pervasive oncogenic signal driving cancer drug resistance. One such oncogene is c-MYC. 30–60% of high-grade serous and drug-resistant (paclitaxel and carboplatin) ovarian cancer overexpress c-MYC, leading to progressive disease and mortality. Herein, it was shown that the novel c-MYC mRNA drug 3’UTRMYC1-18 achieved a dose-dependent titratable downregulation of the c-MYC mRNA with a half-maximal inhibitory concentration superior to the standard-of-care drugs, and with anti-cancer migration and viability properties. By using patient-derived xenograft (PDX) in-vivo, it was shown that the c-MYC mRNA drug significantly inhibited ovarian cancer through the downregulation of c-MYC, programmed death-ligand 1, paired box gene 8 and p21. This drug provides a novel therapy to target drug-resistant ovarian cancer cells.

Graphical Abstract

Aggressive metastatic ovarian cancer cells with c-MYC, PD-L1, PAX8 and p21 upregulation were treated with 3’UTRMYC1-18. The destabilized 3’UTRMYC1-18 recognizes multiple exons on the target c-MYC mRNA. During translation, the ribosome stalls in-frame on the destabilized c-MYC mRNA, which triggers the EXOSC4-PELO and RNA exosome complex to degrade the c-MYC transcript, leading to the downregulation of the c-MYC-PD-L1-PAX8-p21 complex and, in turn, to the inhibition of the ovarian cancer cells. PD-L1, programmed death-ligand 1; PAX8, paired box gene 8; EXOSC4, exosome component 4; PELO, Pelota MRNA surveillance and ribosome rescue factor.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12885-025-15435-8.

Introduction

Approximately 21,000 women are diagnosed with deadly ovarian cancer annually in the USA [1–7]. High-grade serous ovarian cancer (HGSOC) is the deadliest type of gynecological cancer. Approximately 49% of women with ovarian cancer relapse following initial treatment and surgery [2]. The mainstay therapy for ovarian cancer is platinum-based therapy such as cisplatin or carboplatin and in combination with a taxane (paclitaxel/docetaxel) [5, 6]. A total of 60% of HGSOCs become resistant to paclitaxel, cisplatin and carboplatin, thus rendering it a serious medical challenge to improve the clinical outcome of these women in the USA and worldwide [5, 6]. This treatment resistance extends beyond the standard chemotherapies to include immunotherapies and immune checkpoint protein inhibitors. The c-MYC oncogene is the major driver of this resistance [2, 4, 8–11]. Evidence has emerged that ~ 60% of the chemoresistant metastatic ovarian cancers are driven by c-MYC expression [2, 4, 8–11].

c-MYC is a master transcription factor that binds the E-box basic helix loop helix sequences that comprise the c-MYC, n-MYC and l-MYC family members. The c-MYC is overexpressed in >74% of human cancers [12, 13]. This includes ovarian, breast, lung, brain, prostate, pediatric, pancreatic and colorectal cancers, as well as lymphomas. There are no clinically approved direct c-MYC inhibitors. Different targeting approaches have been attempted to control MYC; namely RNAi, anti-sense oligonucleotide, G-quadruplex inhibitors, bromodomain-containing protein 4 and cyclin-dependent kinase inhibitors, and Omomyc, with little therapeutic efficacy in vivo and real-world data. Therefore, novel effective MYC drugs need to be developed to address the problems of chemoresistance in the lethal metastatic c-MYC-driven ovarian cancers.

Programmed death-ligand 1 (PD-L1) is a surface marker in tumors that signals immune cell evasion. It is overexpressed in several cancers, including ovarian cancer. In particular, HGSOCs express high levels of PD-L1 and is marker of poor prognosis and of cancer cells evading immune cells with stemness progeny. Anti-PD-L1 inhibitors such as avelumab and atezolizumab has been used in combination therapy in various advanced, resistant and recurrent ovarian cancers clinical trials such as NCT03642132, NCT02580058, NCT03558139, NCT02915523, NCT03394885, NCT03353831 and NCT03695380. Moreso, immune checkpoint inhibitors such as Nivolumab and Ipilimumab has been tested in various Phase 1/2 clinical trials in advanced ovarian cancer NCT02737787, NCT03959761, NCT03522246, and NCT02498600.

The c-MYC is a key regulator of PD-L1. The c-MYC amongst other transcription factors bind the on the promoter of the PD-L1 to regulate its expression. Ovarian cancer cells express high levels of PAX8. PAX8 binds the enhancer region of the c-MYC leading to the upregulation of cell cycle proteins such as p21 and this causes tumor growth which in-turn promotes the upregulation of the c-MYC activities [12, 14].

Paired box gene 8 (PAX8) is a master transcription factor that directly binds to DNA and is implicated in organogenesis and cellular proliferation. The PAX8 protein has been implicated in the proliferation, viability, migration and invasion of ovarian cancer, as well as considered a regulator of mutant p53, which promotes the p21 to exert anti-apoptotic and proliferative effects [12].

c-MYC protein has no binding pockets for small molecule inhibitors because of its intrinsically disordered nature. Various attempts have been made to drug the c-MYC protein with limitations. The first attempt is RNAi, which has several orders of magnitude of high off-target effects. Anti-sense oligonucleotides have been used but show low cell penetrance. Some inhibitors of G-quadruplex, BRD4 and CDK4 inhibitors have also being tried but with limited success since they are unspecific and target POLII blockading. There is OMO-MYC which is a dominant negative mutant of the MYC protein. And lastly is MYCi975 which is a MYC-MAX inhibitor, the status of this molecule in regard to clinical work is not known.

Given these shortcomings of the current attempts at targeting c-MYC which has had limited success. We discovered that the oncogenic c-MYC mRNA is stabilized with mRNA poly U sequences on its 3’UTR [13, 15, 16]. These elements stabilize onco- MYC mRNA leading to robust onco-MYC protein production. To target c-MYC across various human cancers including metastatic ovarian cancer. We hypothesized that the destabilization of these elements driven by an mRNA de-capping promoter will trigger nonsense-mediated decay to degrade the target transcript. A novel mRNA therapeutic approach was developed, where mRNA stabilizing poly U sequences were engineered within the 3’UTR of c-MYC into the destabilized forms, triggering nonsense-mediated decay of the target transcript [17, 18]. The destabilized mRNA directly and specifically binds and recognizes the canonical and non-canonical E-box sequences on the c-MYC mRNA exons 1–3 and introns 1–2. The ribosome machinery tries to translate this region, encounters premature termination codons and recruits the RNA exosome complex of the Pelota MRNA surveillance and ribosome rescue factor (PELO)-exosome component 4 (EXOSC4)−60 S ribosomal protein L3 (RPL3), which degrades the destabilized mRNA, leading to the downregulation of the c-MYC protein.

For the in-vivo study, we complexed the 3’UTRMYC1-18 with iron oxide nanocage delivery vehicle in a 1:1 ratio. The process of this complexation and the structure of the complex determined by high resolution transmission electron microscope has been described extensively [13, 19]. This drug achieved therapeutic efficacy and inhibited drug-resistant ovarian cancer in vivo and in vitro. The drug was safe and well-tolerated with long-term survival outcomes and tumor inhibition.

Materials and methods

Development of the 3’UTRMYC1-18 mRNA drug

In our previous study, briefly we described the development of the c-MYC mRNA drug [13] and its mechanism of action. Stable mRNA poly U sequences were discovered on the 3’UTR of c-MYC, which were engineered into unstable forms, driven by an mRNA de-capping promoter. The destabilized mRNA drug directly binds their target mRNA recognition site, either in-frame or at the 3’UTR, or both, and triggers ribosome stalling. This stalling is sensed by the PELO-EXOSC4-RPL3 complex, which triggers the degradation of the target transcript. This does not affect normal healthy cells, as they do not differentially express EXOSC4, PELO and RPL3.

Cell culture

The following ovarian cancer cells were obtained for experiments. A2780 and OVCAR8 cells were obtained from Sigma Aldrich (Merck KGaA). The primary ovarian cancer cells, patient-derived xenograft (PDX) were OCI-9x, P5X and C5X, and were obtained from Dr Tan Ince, Chief Pathologist of the Weill Cornell New York Presbyterian Hospital, as a kind gift to Dr Awah. The A2780 and OVCAR8 cells were grown in RPMI medium supplemented with 10% FBS and antibiotics/antimycotics. The OCI-9X, P5X and C5X cells were grown in the primary ovarian cancer maintenance media (cat. no., 506390; US Biologicals). The cells grew to 80% confluency before use.

Dose-dependent half-maximal inhibitory concentration (IC50) determination and comparison with standard-of-care drugs

Dose-dependent titration of 3’UTRMYC1-18 was performed in a head-to-head comparison with the standard-of-care drugs (Olaparib, paclitaxel, cisplatin, Epirubicin, bevacizumab, and MYC-Max inhibitor (MYCi975); all from Selleck Chemicals). The drugs were serially diluted starting at 2.5–40 µg, and the cells were seeded at 5,000 cells/well in a 96-well plate. The cells were allowed to be attached for 24 h and the drugs were then added. The treated cells were incubated for 72 h, and using the cell titre glo (Promega G7570; Promega Corporation), the viability was read and normalized to that of the controls, and the data curve was fitted on the drug dose response chart using GraphPad Prism software (GraphPad, Inc.). The IC50 was then derived.

Reverse transcription quantitative-PCR

RNA was extracted using the Qiagen RNeasy kit (cat. no. 74104; Qiagen AB). The RNA was stored at −80˚C before use. To reverse-transcribe the RNA, a Superscript IV reverse transcriptase kit (cat. no.,18090200) was used to make cDNA. The qPCR primers were designed to target the exons of the c-MYC exon, and GAPDH was used as housekeeping gene control. All the primers used are already published. The ^ΔCT value was used to normalize the transcript expression. The qPCR primer used is listed below as previously described [13]: c-MYC (qPCR), 5’GTCACACCCTTCTCCCTTCG’3 forward and 3’CAGGTACAAGCTGGAGGTGG’5 reverse.

Scratch/wound healing assay

Briefly, 5,000 treated A2780 cells were seeded in 6-well plates and allowed to attach and reach 80% confluency. Subsequently, equal wound scratches were made. The distance of the wound closure was measured every 24 h for 4 days. The data was plotted using GraphPad Prism software (RRID: SCR_002798).

Iron oxide nanocage and 3’UTRMYC1-18 mRNA drug complexation

The iron oxide nanocage and the MYC mRNA drugs were complexed in a 1:1 (13,19) ratio, and the conjugates were incubated overnight prior to use at 4˚C. Subsequently, the drug conjugate was stable both at room temperature, at 4˚C or at −20˚C until use.

Ethics declarations

The present study was performed in accordance with the relevant guidelines and regulations. All methods are reported in accordance with the ARRIVE guidelines.

Animal studies

To validate the in vivo therapeutic efficacy of the c-MYC mRNA drug in the metastatic primary ovarian cancer PDX, Institutional Animal Care and Use Committee (IACUC) approval was obtained from the CUNY institutional review board. A total of 8 female NOD scid gamma mouse (NSG) mice aged 5–8 weeks and weighing 15–21 g were obtained from The Jackson Laboratory. Once received, the mice were allowed to acclimatize according to the protocol. A total of 10 million P5X cells were implanted orthotopically into the mice. After 35 days, the tumors were engrafted in the ovaries. On day 36, animals were randomized into two groups, according to tumor size and weight: the (i) Vector + nanocage and (ii) IC50 3’UTRMYC1-18 (10 µg) groups. Next, intravenous (tail vein) administration of the controls and the drug was performed through the tail vein, twice a week, until 77 days, after which the vector + nanocage group mice exceeded the tumor volume and were euthanized. The IC50 3’UTRMYC1-18 group were not dosed after 77 days till the end of the experiment on day 86. Tumor volumes, weight and body condition score were recorded daily. The animals were euthanized with CO₂ at the end of the study. The Log Rank Mantel test was used to determine statistical significance between the in vivo treatment groups. The Kaplan Meier survival curve was used to determine survival differences between the various treatment groups and controls. Animals were weighed daily, and their body condition score and tumor volume were measured using calipers as 1/2XLXWXW and recorded and documented.

Necropsy

Once the animals died, the fresh carcasses were dissected, and the tumors, ovaries, lungs, kidney, livers and brains were collected. The lungs were rinsed in 1X PBS, and images of the fresh organs were captured. Subsequently, fresh tumor tissues and organs were collected and frozen in −80˚C, and all the tissues were then placed in 4% paraformaldehyde, until they were sent to the pathologist lab for embedding and Hematoxylin and Eosin (H&E) staining.

H&E staining of tumors and organs

QC embedded and sectioned the tissues according to the standard protocol and JPD performed the H&E staining. Images were obtained on the EVOS FL microscope at a magnification of x40, and quantification was performed using ImageJ (RRID: SCR_003070; National Institutes of Health) (https://imagej.net/ij/) and quantified in Graph Pad Prism (version 10; RRID: SCR_002798).

Immunohistochemical (IHC) staining for c-MYC, PD-L1, PAX8 and p21 in tumors and organs

Briefly, IHC staining against c-MYC, PD-L1, PAX8 and p21 was performed on the tumors and organs of the treated animals and the controls. The Abcam IHC protocol (https://www.abcam.com/en-us/technical-resources/protocols/ihc-with-samples-in-paraffin) was used. The tissue slides were deparaffinized according to the protocol, and enzymatic antigen retrieval was performed using 1:1 trypsin concentrates and buffer. Washes were done with 1X Tris-buffered saline Tween 20 (TBST). Blocking was done using a protein block (cat. no. ab64212) for 1 h, after which washes were re-done. Next, slides were incubated with primary antibodies against overnight. Next, the day slides were washed with 1X TBST. The secondary antibody was added onto the slide and incubated for 1 h. Subsequently, slides were washed with 1X TBST. To detect the signals, we the DAB and concentrate and enhanced with enhancer. Next, counter-staining was performed and mounting media was added, followed by sealing with the cover slip. Images were obtained using EVOS Fl at a magnification of x40. Target stains were quantified using ImageJ (https://imagej.net/ij/) RRID: SCR_003070.

Statistical analysis

All experimental data were performed in replicate, and a minimum number of n = 3. A paired t-test was used to determine statistical significance between treated groups and controls. The Log Rank Mantel test was used to determine statistical significance between the in vivo treatment groups. The Kaplan Meier survival curve was used to determine survival differences between the various treatment groups and controls. All data was plotted using GraphPad Prism (version 10) RRID: SCR_002798.

Results

3’UTRMYC1-18 achieved a dose-dependent titratable inhibition of drug-resistant ovarian cancer cell lines and PDX primary ovarian cancer cells

The 3’UTR mRNA drug 3’UTRMYC1-18 was created to destabilize and degrade oncogenic c-MYC across several types of cancer, and it achieved complete pathological response in vivo with a significant (p = 0.008) survival outcome in the treated animals bearing various c-MYC-driven cancers. To validate this novel mRNA drug (3’UTRMYC1-18) in the metastatic drug-resistant ovarian cancer cell lines and PDX, a head-to-head dose-dependent IC50 determination was performed between 3’UTRMYC1-18 and the standard-of-care drugs (paclitaxel, Olaparib, Epirubicin, cisplatin, bevacizumab, and the MYCi975). It was found that 3’UTRMYC1-18 achieved an IC50 of 4.4 µM in A2780 cells, which was superior to that of the standard-of-care drugs (cisplatin, −7.8 µM; Olaparib, ->40 µM; bevacizumab, −18.22 µM; MYCi975, −20 µM) (Fig. 1A). 3’UTRMYC1-18 achieved an IC50 of 10 µM, superior to the IC50 of the standard-of-care drugs (Fig. 1B-C). 3’UTRMYC1-18 engaged the MYC mRNA in a dose-dependent manner (Fig. 1D) and degraded c-MYC mRNA in a dose-dependent manner. 3’UTRMYC1-18 inhibited ovarian cancer cell migration compared with the controls (Fig. 1E) and impaired cancer viability (Fig. 1F).

Fig. 1.

Dose-dependent inhibition of the primary ovarian cancer cells and cell lines, and c-MYC and migration ability of the ovarian cancer cells by 3’UTRMYC1-18. A Drug dose response curve of 3’UTRMYC1-18 in A2780 ovarian cancer cells in a head-to-head comparison with the standard-of-care drugs and MYCi975. n = 3. B-C Drug dose response curve of 3’UTRMYC1-18 with (B) P5X and (C) OCI-9X primary ovarian cancer cells in a head-to-head comparison with the standard-of-care drugs. n = 3. D Bar chart showing the dose-dependent downregulation of MYC mRNA by 3’UTRMYC1-18 in A2780 ovarian cancer cells. n = 3. E Bar chart showing the migration of the A2780 cancer cells following treatment with 3’UTRMYC1-18, vector or WT controls for 4 days. n = 3. F Bar chart showing the viability of the OVCAR8 ovarian cancer cells following treatment with 3’UTRMYC1-18 and control vector. n = 2. ***P = 0.00125 and ***P = 0.00033. P = ns, non-significant. WT, wild-type; MYCi975, MYC-Max inhibitor

3’UTRMYC1-18 inhibits ovarian cancer in vivo with significant survival outcomes

The in vivo therapeutic efficacy of the MYC mRNA drug in a drug-resistant ovarian cancer PDX was validated. Institutional review board IACUC approval was obtained. The ovarian cancer PDX was implanted, the P5 × (3). 10 Million cells were implanted orthotopically into female NSG mice aged 5–8 weeks and weighing 15–20 g. After 35 days, the tumors engrafted and were randomized into two groups, the vector + nanocage and IC50 3’UTRMYC1-18 groups (Fig. 2A). Tumor-bearing mice were treated twice a week with daily tumor volume recording (1/2XLXWXW), weight measurement (Fig. S1C) and body condition score recording. On day 77, the vector + nanocage-treated animals had exceeded the tumor volume limit and were euthanized, while the 3’UTRMYC1-18-treated mice remained alive until 86 days (Fig. 2A). On day 41 post-implantation, the tumor volume measurement showed clear segregation between the vector + nanocage-treated group and the 3’UTRMYC1-18. The 3’UTRMYC1-18-treated group exhibited a significant reduction in tumor volume (**P = 0.022), as compared with the control (Fig. 2B). The 3’UTRMYC1-18-treated group exhibited very significant survival outcomes (**P = 0.0043), as compared with the controls (Fig. 2C). In combination, the data demonstrated in vivo the therapeutic efficacy of the c-MYC mRNA drug in the metastatic drug-resistant ovarian cancer PDX.

Fig. 2.

In vivo validation of the ovarian cancer cell inhibition by 3’UTRMYC1-18. A Schematic depiction of the in vivo experiments. 10 Million P5X primary ovarian cancer cells were implanted orthotopically into the ovaries of the female NSG mice. After 35 days, the tumors were engrafted. On day 36, they were randomized into the vector + nanocage and IC50 3’UTRMYC1-18 treatment groups. The animals were dosed 2 times a week. After 77 days, the control and vector + nanocage-treated groups exceeded the tumor volume and were euthanized, while the IC50 3’UTRMYC1-18-treated group lived to 86 days. B Chart showing the daily tumor volumes of the tumors treated with vector + nanocage and IC50 3’UTRMYC-18. C Kaplan Meier survival curve of the vector + nanocage- and IC50 3’UTRMYC1-18-treated mice. D-E H&E staining images of tumors of the (D) vector + nanocage- and (E) IC50 3’UTRMYC1-18-treated tumors. All n = 4 mice per group. **P = 0.022 and ***p = 0.0043. H&E, Hematoxylin & Eosin; IC50, half-maximal inhibitory concentration

3’UTRMYC1-18 achieved on-target Inhibition of c-MYC, PD-L1, PAX8 and p21, leading to the inhibition of the ovarian and fallopian tubes tumors

To validate that 3’UTRMYC1-18 inhibited c-MYC in the primary tumor, H&E staining of the ovarian cancer PDX was performed (Fig. 2). It was found that the 3’UTRMYC1-18 inhibited the malignant pleomorphic ovarian cancer cells (Fig. 2E), as compared with the controls (Fig. 2D) with almost complete pathological response (Fig. S1A-B). To investigate whether 3’UTRMYC1-18 inhibited and reduced metastasis to the ovaries, H&E and IHC staining of the ovaries was performed with antibodies against c-MYC, PD-L1, PAX8 and p21. A very high level of c-MYC was found in the ovaries of the vector + nanocage-treated tumor-bearing mice (Fig. 3A-C and G). In the ovaries of the tumor-bearing mice treated with the IC50 dose (10 µg) of the 3’UTRMYC1-18, a reduction of > 90% in c-MYC expression was observed, as compared with the controls (Fig. 3D-F; quantified in Fig. 3H). The PD-L1 expression is known to be markedly elevated in ovarian tumors. Herein, it was found to be markedly elevated in the ovaries of vector + nanocage-treated mice (Fig. 3A-C and I). In the 3’UTRMYC1-18-treated mice, PD-L1 expression was reduced by 80% (Fig. 3D-F; quantified in Fig. 3I). The PAX8 protein has been implicated in the proliferation, viability, migration and invasion of ovarian cancer cells, as well as considered a regulator of mutant p53, which promotes p21 to exert an anti-apoptotic and proliferative function. The ovaries of the vector + nanocage- and 3’UTRMYC1-18-treated tumor-bearing mice underwent IHC staining for PAX8 and p21 expression. A very high level of PAX8 and p21 expression was observed in the vector + nanocage-treated mice (Fig. 3A-C; quantified in Fig. 3J and K) and the PAX8 and p21 expression was reduced by ~ 70% in 3’UTRMYC1-18-treated ovaries (Fig. 3D-F; quantified in Fig. 3J and K).

Fig. 3.

Downregulation of c-MYC, PD-L1, PAX8 and p21 by 3’UTRMYC1-18 inhibits ovarian cancer. A-C Images of H&E staining for c-MYC, PD-L1 and PAX8, and IHC staining for p21 showing ovarian tumors (A) 1, (B) 2 and (C) 3 from the vector + nanocage-treated group. D-F Images of H&E staining for c-MYC, PD-L1 and PAX8, and IHC staining for p21 showing ovarian tumors (D) 1, (E) 2 and (F) 3 from the IC50 3’UTRMYC1-18-treated group. All n = 3. G Bar chart showing the quantification of the number of malignant pleomorphic hyperchromatic cells in the lungs from the vector + nanocage- and IC50 3’UTRMYC1-18-treated groups. H-K Bar chart showing (H) c-MYC, (I) PD-L1, (J) PAX8 and (K) p21 expression by IHC in positive control lungs, and vector + nanocage-and IC50 3’UTRMYC1-18-treated lungs. All vector + nanocage, n = 3; IC50 3’UTRMYC1-18, n = 3. ***P = 0.00014, **P = 0.0026. H&E, Hematoxylin & Eosin; IHC, immunohistochemistry; PD-L1, programmed death-ligand 1; PAX8, paired box gene 8

In the fallopian tubes, no marked changes were identified between the vector + nanocage- and 3’UTRMYC1-18-treated tissues; H&E staining for c-MYC, PD-L1, PAX8 and p21 expression did not show marked changes either (Fig. S2A-F).

In combination, the therapeutic efficacy of 3’UTRMYC1-18 was demonstrated in vivo by the inhibition of c-MYC, PD-L1, PAX8 and p21 expression to downregulate metastasis in the ovaries.

3’UTRMYC1-18 inhibits liver and lung metastasis in aggressive metastatic ovarian cancer

The liver is the most common site of ovarian cancer metastasis. Liver tissues from the control and 3’UTRMYC1-18-treated tumor-bearing mice were stained. Metastasis was detected (1/3 mice) and malignant pleomorphic hyperchromatic cells (2/3 mice) were found in the livers from the vector + nanocage-treated group (Fig. 4A-C). No metastasis nor malignant cells were identified in the liver tissues (03) from 3’UTRMYC1-18-treated tumor-bearing mice (Fig. 4D-F). c-MYC expression was very high in the livers (3/3 mice) of the vector + nanocage-treated tumor-bearing mice (Fig. 4A-C), while it was low in the livers (2/3 mice) of the 3’UTRMYC1-18-treated tumor-bearing mice. Only 1 mouse had an elevated c-MYC expression (Fig. 4D-F).

Fig. 4.

3’UTRMYC1-18 inhibits liver metastasis from ovarian cancer by downregulating c-MYC, PAX8 and p21. A-C Images of H&E staining for c-MYC, PD-L1 and PAX8, and IHC staining for p21 showing livers (A) 1, (B) 2 and (C) 3 from the vector + nanocage-treated group. D-F Images of H&E staining for c-MYC, PD-L1 and PAX8, and IHC staining for p21 showing livers (D) 1, (E) 2 and (F) 3 from the IC50 3’UTRMYC1-18-treated group. All n = 3. G Bar chartno showing the quantification of the number of malignant pleomorphic hyperchromatic cells in the livers from the vector + nanocage- and IC50 3’UTRMYC1-18-treated groups. H Bar charts showing the quantification of the number of metastases in the livers from the vector + nanocage- and IC50 3’UTRMYC1-18-treated groups. I-L Bar chart showing the (I) c-MYC, (J) PD-L1, (K) PAX8 and (L) p21 expression by IHC in livers from the positive control, and vector + nanocage- and IC50 3’UTRMYC1-18- treated groups. The bar chart shows the PD-L1 expression by IHC in the positive control and in vector + nanocage- and the IC50 3’UTRMYC1-18-treated livers. All vector + nanocage, n = 3; IC50 3’UTRMYC1-18, n = 3. ***P = 0.00027. P = ns, non-significant. H&E, Hematoxylin & Eosin; IHC, immunohistochemistry; PD-L1, programmed death-ligand 1; PAX8, paired box gene 8

The lungs are a common site for ovarian cancer metastasis. Lungs were examined by H&E staining, and it was found that the vector + nanocage-treated lungs exhibited an increased number of malignant hyperchromatic pleomorphic cells and loss of the lung architecture (Fig. 5A-C). The 3’UTRMYC1-18-treated tumor-bearing mice exhibited a normal lung architecture and a significant reduction in the malignant hyperchromatic pleomorphic cells in the lung’s parenchyma (Fig. 5D-F). Staining for c-MYC revealed the downregulation of the c-MYC in the 3’UTRMYC1-18-treated tumor-bearing mice, as compared with the controls (Fig. 5A-F). There was a slight downregulation of PD-L1 and PAX8 in the 3’UTRMYC1-18-treated tumor-bearing mice, as compared with the controls (Fig. 5A-F). p21 Was slightly elevated in the lungs of the 3’UTRMYC1-18-treated mice, as compared with the controls. The quantified data can be seen in Fig. 5G-K. In conclusion, it was demonstrated that 3’UTRMYC1-18 inhibited metastatic ovarian cancer cells in the livers and lungs to achieve the significant survival outcome we observed.

Fig. 5.

3’UTRMYC1-18 inhibits lung metastasis from ovarian cancer by downregulating c-MYC, PD-L1 and PAX8. A-C H&E staining images for c-MYC, PD-L1 and PAX8, and IHC staining images for p21 of (A) lung 1, (B) lung 2 and (C) lung 3 from the vector + nanocage-treated group of the ovarian cancer-bearing mice. All n = 3. *P = 0.02 and ***P = 0.00014. D-F H&E staining images for c-MYC PD-L1 and PAX8, and IHC staining images for p21 of (A) lung 1, (B) lung 2 and (C) lung 3 from the IC50 3’UTRMYC1-18-treated ovarian cancer-bearing mice. G Bar charts showing the quantification of the number of malignant pleomorphic hyperchromatic cells in lungs from the vector + nanocage- and IC50 3’UTRMYC1-18-treated groups. (H-K) Bar chart showing (H) c-MYC, (I) PD-L1, (J) PAX8 and (K) p21 expression by IHC in positive control lungs, and vector + nanocage-and IC50 3’UTRMYC1-18-treated lungs. Vector + nanocage, n = 3; IC50 3’UTRMYC1-18, n = 3. H&E, Hematoxylin & Eosin; IHC, immunohistochemistry; PD-L1, programmed death-ligand 1; PAX8, paired box gene 8

Conclusion

The present study demonstrated that metastatic drug-resistant c-MYC-driven ovarian cancer can be inhibited both in vitro and in vivo by the novel c-MYC 3’UTR mRNA destabilizing drug. Its therapeutic efficacy was demonstrated both in vitro and in vivo with a very significant survival outcome in the 3’UTRMYC1-18-treated tumor-bearing mice.

The drug achieved on-target inhibition of c-MYC and both on the mRNA and protein levels. In vivo, the drug destabilized and inhibited c-MYC in the ovaries, livers and lungs. It was found that the inhibition of c-MYC led to the downregulation of PAX8, PD-L1 and p21 in the target organ, the ovaries.

PAX8 is a master transcription factor implicated in ovarian and other types of cancer. It is a member of the paired box domain family. It is plausible that the c-MYC downregulates PAX8 based on direct/indirect protein interactions. It has also been shown that PAX8 regulates c-MYC in p53 mutant uterine cancers, and that drugging PAX8 is an indirect way of targeting the c-MYC (14). Akin to this is the downregulation of p21, which is involved in cell cycling. The inhibition of c-MYC, a pro cell cycle proliferative molecule will invariably lead to the downregulation of p21. c-MYC and p21 are known to transcriptionally control each other.

PD-L1 is overexpressed in HGSOC and is a marker of poor prognosis. Various PD-L1 inhibitors have failed in clinical trials on ovarian cancers in which they are expressed. c-MYC is a direct regulator of PD-L1 through its binding site on the CD274 gene. It was shown herein that the 3’UTRMYC1-18-induced inhibition of the c-MYC concomitantly decreased the PD-L1 expression in ovarian and other cancers. Suggesting that this drug might be effective in targeting c-MYC- and PD-L1-positive ovarian cancers.

This downregulation of the c-MYC, PDL-1, PAX8 and p21 by 3’UTRMYC1-18 led to the inhibition of the liver and lung metastasis from the metastatic ovarian cancer cells. In combination, the inhibition of the primary ovarian tumor and metastasis to the lungs and liver led to a significant survival outcome in 3’UTRMYC1-18-treated mice. The findings of the present study supported that 3’UTRMYC1-18 can indeed downregulate c-MYC in metastatic ovarian cancer and inhibit the tumor, thus offering a potential treatment option for deadly ovarian cancers.

The data presented herein are readily translatable to metastatic ovarian cancer patients whose cancers overexpress c-MYC and are resistant to carboplatin and paclitaxel-based therapy. The presented data support that these patients would benefit from 3’UTRMYC1-18 as a monotherapy. It is plausible that a potential combination of 3’UTRMYC1-18 with cisplatin/paclitaxel may exert a synergistic effect. Nanodelivery enhanced the therapeutic efficacy of the drug. Iron oxide nanocages were well biodistributed and delivered the drug to the tumor site, liver, lungs and even the brain through systemic delivery. The metabolism and absorption of iron oxide nanocages is the same as that of ferritin; they are broken down to ferritin, which is stored in the liver, spleen and bone marrow, and are used in making new red blood cells. This explains why no anemia, cachexia and weight loss were observed in the animals that received the drug. The present study was performed both in metastatic ovarian cancer PDX and various drug-resistant ovarian cancer cell lines.

Limitations

While this data is very robust and clear, a limitation of the study could be that we did not use the genetically engineered modified mice carrying spontaneous ovarian cancers. While such models exist, they are not commercially available yet. In follow-up studies, this can be studied as the drug enters phase 1 clinical trial, given that the data from the present study supports investigational new drug that is submitted to the regulatory authorities worldwide for a first-in-human clinical trial of the 3’UTRMYC1-18 in pan c-MYC-driven cancers, including metastatic drug-resistant ovarian cancer.

Author’ contributions

CUA conceived, engineered, and synthesized the destabilized 3’UTR MYC mRNA drugs and performed experiments. CUA: performed the destabilized 3’UTR MYC mRNA drug screening and discovery and conceived experiment in lethal Ovarian cancers. PL, FA performed IC50 studies. CUA, JPD performed animal studies. QC performed molecular biology work, QC and JPD, LCI performed tissue embedding and sectioning and H&E stain, c-MYC, PD-L1, PAX8 and p21 IHC staining. HM invented IO nanocages. HM and SGP conjugated the mRNA and IO-nanocages. CUA wrote the manuscript, revised it, supervised the work, and oversaw the grant administration.

Funding

CUA is funded by the X-Seed Award 2 grant from the New York City Economic Development Corporation and Deerfield Management. HM was supported by the NY State Center for Advanced Technology (CAT) Program (014UTR07062023) for the nanocage design and structure analysis.

Data availability

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Declarations

Ethics approval and consent to participate

This study was performed in accordance with relevant guidelines and regulations. We obtained IACUC approved for the animal studies. All methods are reported in accordance with ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

CUA has filed patents based on these findings. HM and CUA have filed patents on nanocage delivery systems. All other authors declare that they have no competing interests.