The Ighmbp2-R604X mouse presents with the most severe SMARD1 clinical symptoms resulting in failure to thrive, respiratory and feeding deficits, aspiration and severe axon and muscle pathology

Abstract

Spinal muscular atrophy with respiratory distress type 1 (SMARD1) and Charcot Marie Tooth type 2S (CMT2S) are due to mutations in immunoglobulin mu binding protein two (IGHMBP2). We generated the Ighmbp2-R604X mouse (R605X-humans) to understand how alterations in IGHMBP2 function impact disease pathology. The IGHMBP2-R605X mutation is associated with patients with SMARD1 or CMT2S. The impact of this mutation is substantial, Ighmbp2^R604X/R604X mice have a decreased lifespan (6 days) and weight, and failure to thrive consistent with SMARD1 symptoms. Significant respiratory changes were present along with disease pathology of the phrenic nerve and diaphragm muscle fibers. Ighmbp2^R604X/R604X mice also presented with signs of milk aspiration and lung pathology. Interestingly, P0 Ighmbp2^R604X/R604X mice had visible milk spots, but demonstrated reduction of the milk spot by P3, indicating deficits in suckling. Alterations in hindlimb electrophysiology were consistent with the pathology of the sciatic nerve, hindlimb neuromuscular junction and muscle. Injection of the ssAAV9-WT-IGHMBP2 vector extended Ighmbp2^R604X/R604X survival a few days. Ighmbp2^R604X/R604X phenotypes are consistent with the most severe SMARD1 clinical symptoms and for the first time a Ighmbp2 mouse model demonstrates that milk aspiration and loss of the ability to suckle impact survival.

1. Introduction

Mutations in immunoglobulin mu DNA binding protein two (IGHMBP2) give rise to two diseases: spinal muscular atrophy with respiratory distress (SMARD1) and Charcot Marie Tooth (CMT2S). SMARD1 is an autosomal recessive motor neuron disease that affects children during infancy, resulting in early death, and is distinguished from 5q-linked spinal muscular atrophy (SMA) by the genetic mutation and the clinical pathology. The primary clinical symptom, respiratory failure, is due to diaphragmatic paralysis, typically manifesting between 6 weeks to 13 months of age (Grohmann et al., 2001; Grohmann et al., 1999; Guenther et al., 2007; Porro et al., 2014; Rudnik-Schoneborn et al., 2004; Viollet et al., 2002). SMARD1 clinical symptoms include distal lower limb muscle atrophy followed by proximal muscle weakness that results from anterior horn cell deterioration, intrauterine growth retardation, difficulties sucking, failure to thrive, autonomic nervous system and sensory defects, scoliosis and kyphosis (Grohmann et al., 2001; Grohmann et al., 1999; Kaindl et al., 2008; Porro et al., 2014; Rudnik-Schoneborn et al., 2004; Viollet et al., 2002). SMARD1 presents with a variable disease onset, severity and symptoms. There is no clear patient correlation between the type of mutation and clinical presentation.

CMT2S patients present with a slow but progressive distal muscle weakness that manifests much later than SMARD1 and there is no respiratory impairment. Initial CMT2S symptoms include delayed milestones and difficulty walking. Nerve conduction studies show a reduction to absence of CMAP and sensory action potential, while deep tendon reflexes are nearly absent. There is typically no reduction in lifespan and patients must rely on palliative care (Cottenie et al., 2014; Liu et al., 2017; Schottmann et al., 2015; Wagner et al., 2015).

IGHMBP2 is a member of the superfamily one (SF-1) DNA/RNA helicases that includes Up-frame shift 1(UPF1) and Senataxin (Bohnsack et al., 2023; Chen et al., 2004; Fairman-Williams et al., 2010; Grohmann et al., 2001; Guenther et al., 2009; Moreira et al., 2004; Perlick et al., 1996). Mutations in any of these helicases results in neurodegeneration despite having distinct cellular functions. While the function of IGHMBP2 that results in SMARD1/CMT2S has not been clearly defined, IGHMBP2 has proposed roles in immunoglobulin-class switching, premRNA maturation, transcription regulation, pre-rRNA processing and translation (Chen et al., 1997; de Planell-Saguer et al., 2009; Fukita et al., 1993; Guenther et al., 2009; Vadla et al., 2023). More recent studies provide evidence for IGHMBP2 function within translation (Park et al., 2024; Prusty et al., 2024; Vadla et al., 2024).

The IGHMBP2 gene is comprised of 15 exons encoding 993 amino acids. Patient mutations are distributed throughout all 15 coding exons and within each of the proposed functional domains (helicase, R3H, zinc finger). Pathogenic variants in IGHMBP2 occur in patients either as homozygous recessive or compound heterozygous mutations. We demonstrated that IGHMBP2-D565N and IGHMBP2-H924Y mutations result in diminished IGHMBP2 biochemical activity that correlates with disease severity and pathology (Ricardez Hernandez et al., 2025; Vadla et al., 2024). Consistent with these studies, we demonstrated that the IGHMBP2-D565N mutation significantly reduces the binding affinity with the disease modifier, activator of basal transcription (ABT1) while the IGHMBP2-H924Y mutation slightly alters IGHMBP2-ABT1 binding affinity (Vadla et al., 2024).

The Ighmbp2 mouse models, C57BL/6 J-Ighmbp2^nmd/nmd and FVB-Ighmbp2^nmd/nmd possess a spontaneous mutation in Ighmbp2. This mutation creates a cryptic splice site, resulting in aberrant splicing of ~80 % of Ighmbp2 mRNA transcripts and SMARD1 pathology (Grohmann et al., 2004; Maddatu et al., 2004; Shababi et al., 2016; Shababi et al., 2019; Villalon et al., 2018). There are also SMARD1 mouse models based on patient mutations: Ighmbp2^D564N/D564N, Ighmbp2^C46X/C46X, Ighmbp2C495X/C495X, Ighmbp2R602C/R602C, and Ighmbp2D564N/H922Y (Ricardez Hernandez et al., 2025; Smith et al., 2022). The Ighmbp2^D564N/D564N mouse demonstrates SMARD1 pathology and was the first model demonstrating quantitative respiratory dysfunction as measured by plethysmography, a key clinical feature distinguishing SMARD1 from CMT2S IGHMBP2 mutations (Smith et al., 2022). Interestingly, the Ighmbp2^D564N/H922Y model has two survival cohorts, one with respiratory dysfunction and the other not; both cohorts develop motor function deficits at the same time and with the same severity (Ricardez Hernandez et al., 2025). The Ighmbp2^{C495del/C495del} and Ighmbp2^{L362del/L362del} mouse models demonstrate SMARD1 pathology and display irregular breath rates (Holbrook et al., 2024). There are several reported Ighmbp2 models of CMT2S including the Ighmbp2^H922Y/H922Y, Ighmbp2^{E365del/E365del} and Ighmbp2^Y918C/Y918C mice (Martin et al., 2023; Ricardez Hernandez et al., 2025).

The IGHMBP2-R605X mutation, located in domain 2A of the IGHMBP2 helicase domain, introduces a premature stop codon predicted to produce a truncated IGHMBP2 protein with loss of the IGHMBP2 R3H and zinc finger domains. Based on the Leiden open variation database (LOVD³), there are over 17 pathogenic truncating mutations within IGHMBP2; fourteen of those mutations are within the helicase domain (amino acids 19–641). We were interested in the IGHMBP2-R605X mutation as there are two reported patients with compound IGHMBP2-R605X mutations that result in SMARD1/respiratory distress at 91 and 365 days of life as well as three patients with compound IGHMBP2-R605X mutations with CMT2S clinical symptoms, with symptoms initiating at 3+ years of life (Cottenie et al., 2014; Grohmann et al., 2003; Guenther et al., 2007). LOVD³ also identified a single IGHMBP2^R605X/R605X patient that at six months had respiratory failure and muscular hypotonia (Trujillano et al., 2017). To determine how the IGHMBP2-R605X mutation could generate such clinically diverse symptoms, we generated the orthologous mutation (R604X) in mice. In this manuscript, we report that the Ighmbp2-R604X (humans IGHMBP2-R605X) mice presented with some of the most severe symptoms observed in SMARD1 patients including failure to thrive, reduced suckling, aspiration of milk, severe respiratory distress and reduced motor function. Intracerebral ventricular (icv) injection of ssAAV9-IGHMBP2 extended survival by a few days, likely due to the extent of disease pathology already present in Ighmbp2^R604X/R604X mice and the inherently slower expression kinetics of ssAAV vectors like the ssAAV9-IGHMBP2 vector.

2. Materials and methods

2.1. Generation of the FVB-Ighmbp2 mice

Animal procedures were carried out in accordance with procedures approved by the NIH and MU Animal Care and Use Committee. Animals were housed using standard animal husbandry with free access to water and food.

For all experiments, litter sizes were culled (5–7 pups/litter) to foster maternal care. Due to the short lifespan of the Ighmbp2^R604X/R604X mice, mice were used in all experiments without sex bias. The mouse Ighmbp2-R604X mutation corresponds to the human IGHMBP2-R605X mutation. The Ighmbp2^+/R604X mouse was generated in collaboration with the MU Animal Modeling Core using CRISPR technologies. CRISPR editing was done in FVB-zygotes. An enhanced-specificity Cas9 (eSPCas9) protein was used to reduce off-target effects. Any predicted off-target site with less than a 2 bp mismatch (including DNA or RNA bulges) or with less than 3 bp mismatches if no mismatches were in the 12 bp seed region of the sgRNA was PCR amplified and sequenced to ensure no erroneous edits were made. The sgRNA was ordered as chemically modified synthetic sgRNA (Synthego). The repair template was chemically synthesized as a 199 bp single stranded DNA oligo (ssODN) (IDT). The ssODN was complementary to the non-target strand and contained symmetrical homology arms. The Ighmbp2-R604X single guide RNA (sgRNA) sequence: 5′- ATGTTGCTGTTACCCGTGCT −3′. The repair template sequence (sgRNA sequence disrupted by the desired mutation): 5′- ATCCCTGCCTCTCTCATCTCTGGCTTTTCTTCAGGT-GAAGTTGGTTTTCTGGCTGAGGA-CAGGCGGATTAATGTTGCTGTTACCCGTGCTTAGCGGCACGTGG-CAGTCATCTGTGATTCCCACACTGTCAACAACCATGCTTTTTTGAA-GACCTTGGTGGATTATTTCACAGAGCATGGGGAGGTACGCA-CAGCCTTTGA-3′. The TAG indicated in bold is the premature stop codon with TA modified in the repair template. Founder mice genotypes were confirmed by sequencing and none of the founders contained off-site mutations. Founders were outcrossed to FVB wild type mice (Jackson Laboratory) to establish the colony. Animals were extensively backcrossed prior to studies.

2.2. Genotyping

Genotyping of neonatal pups was performed at P0. Genomic DNA was obtained using the DNA isolation protocol from Jackson Labs. The Ighmbp2-R604X mutant allele was determined using FWD 5′- TTCAGGTGAAGTTGGTTTTCTGGC-3′ and REV 5’-GTATTCAAAGGCTGTGCGTACCTCC-3′ primers and GoTaq. PCR conditions were step 1: 94 °C denaturing for 3:00 min, step 2: 30 cycles of 94 °C denaturing for 30 s, 60 °C annealing for 30 s, and 68 °C extension for 1:00 min, step 3: final extension was 68 °C for 5 min. Amplicons for the R604X assay were digested with DdeI (NEB) and separated on a 4 % agarose gel to differentiate wild type from mutant alleles. Wild type restriction enzyme digestion products were 161 bp, 151 bp, and 23 bp. Mutant restriction enzyme digestion products were 161 bp, 115 bp, 36 bp, and 20 bp.

2.3. Motor function assessments

The hindlimb suspension test measured neonate hindlimb muscle strength from P2-P7 as latency to fall. Neonatal mice were suspended from their hindlimbs from the edge of a 50-ml conical tube with gauze padding at the bottom of the tube. The time from suspension until the fall of the mouse was recorded up to thirty seconds. Each mouse was recorded three times daily with the average of the three scores recorded as the daily average.

2.4. Milk spot assessments

The presence of a milk sac/spot was used as an indication of the mouse pup suckling/feeding. Measured on the left side of the pup, the milk sac is fully visible when milk is present. The presence of a milk spot was scored from P0 to P8 when the milk spot became difficult to access due to the presence of hair on non-mutant mice. The score of 2 indicated the presence of a full milk sac, the score of 1 indicated the presence of a partially full milk sac and the score of 0 indicated no milk was observed in the milk sac.

2.5. Head-out plethysmography

Mice were placed in customized head-out pup chambers equipped with warming beds (Data Sciences International/Harvard Bioscience, Holliston, MA) with a low chamber volume for acquiring low amplitude respiratory signals. Gaps surrounding the neck were sealed using 3 M Impregum F base and catalyst. Ventilation was assessed at P2. The mice were acclimated to the chamber while breathing room air (21 % O₂ + 0 % CO₂ + 79 % N₂) for 5 min before ventilatory measurements were recorded for baseline conditions for an additional 30 min. The mice were then challenged by exposing them to 5 min of hypercapnia (7 % CO₂, 21 % O₂, balanced N₂) and subsequently with hypoxia (10.5 % O₂) + hypercapnia (7 % CO₂, balanced N₂) for 5 min (gas concentrations controlled by a gas mixer; CWe, Inc., Ardmore, PA). A pressure calibration signal, ambient pressures, and chamber pressures were utilized for automated calculation of breath-by-breath respiratory parameters [frequency (f-breaths/min), inspiratory time (Ti-sec), expiratory time (Te-sec), tidal volume (VT-mL), minute ventilation (VE-mL/min), peak inspiratory flow (PIF-mL/s), and peak expiratory flow (PEF-mL-sec)] at 10-s intervals using FinePointe Software (Data Sciences International/Harvard Bioscience, Holliston, MA). VT, VE, and mean inspiratory flow (VT/Ti-mL/s) were normalized to body weight (per g). For each treatment, five consecutive time points were selected, averaged, and analyzed. Selection of data points was based on consistency between readings (Lind et al., 2020). Data were rejected if there was evidence of pressure fluctuations caused by gross body movements.

2.6. Lung hematoxylin and eosin staining and milk aspiration

For lungs, protocols were adapted based off of the methods in (Karpinski et al., 2014; Silva et al., 2022). The lungs were not inflated to identical pressures in these procedures. Briefly, fresh lung tissues were harvested and fixed in 4 % PFA for 24 h at 4 °C on a shaker prior to freezing and embedding. Lungs were cryosectioned at 10 μm. Tissue slides were fixed with acetic acid alcohol for 5 min, rinsed in tap water twice for 15 s and then hematoxylin (catalog: 411165000, ThermoFisher Scientific) stained for 1 min. Slides were then rinsed in ammonia water for 15 s, dehydrated in 95 % ethanol twice for 15 s and eosin Y (catalog: 152885000, ThermoFisher Scientific) stained for 15 s. Slides were then rinsed twice for 15 s in 95 % ethanol, 100 % ethanol, and xylene. Tissues were covered with Permount mounting medium (catalog: SP15–500, ThermoFisher Scientific). Three individual images/mouse were acquired at 20× magnification using a Leica DM5500 B microscope (Leica Microsystem Inc.) and analyzed blindly. P5/P6 mice were used for these analyses.Thickening of the alveolar wall was scored 0–18 points. Each image/mouse was scored 0–6 with 0 = no thickening of alveolar wall (1 cell layer thick), 1–2 = mild thickening, 3–4 = moderate thickening of alveolar wall, 5 = extensive thickening of alveolar wall, 6 = complete thickening. Hyaline membrane was scored as acellular deposits devoid of hematoxylin staining in alveolar region but stained with eosin stain and was scored 0–6 points. Each image/mouse was scored 0–2 with 0 = no acellular debris, 1 = partial build up of acellular debris, 2 = significant build up of acellular debris. Observed enhanced injury was scored 0–18 points. Each image/mouse was scored 0–6 with 0 = no damage, 1 = minimum damage, 2 = mild damage, 3 = moderate damage, 4 = pronounced damage, 5 = extensive damage, 6 = completely damaged. Atelectasis (complete or partial collapse of distal air spaces) was scored 0–12. Each image/mouse was scored 0–4 with 0 = no collapse, 1 = slight collapse, 2 = 50 % collapse, 3 = nearly full 75 % collapse, 4 = full collapse of distal air spaces.

Milk aspiration was determined by immunohistochemistry. Fresh lung tissues were harvested and fixed in 4 % PFA for 24 h at 4 °C on a shaker prior to freezing and embedding. Lungs were cryosectioned at 10 μm. A pre-absorbed primary antibody (1:500 catalog: orb2239, Biorbyt) with a Goat anti-rabbit Alexa Fluor 647 (1:500, catalog: A-21244, Invitrogen) secondary antibody were used. Alveolar walls were readily visualized under the green laser (excitation 488 nm) due to natural tissue autofluorescence. Three to four 10× images of one lung section were scored blindly with five animals per genotype (P5-P6) scored. Alveoli were counted with a plus or minus for detection of milk protein inside the alveolar space (+/+ = 708 total alveoli scored with 118+ alveoli/mouse, +R604X = 683 total alveoli scored with 102+ alveoli/mouse, R604X/R604X = 593 total alveoli scored with 91+ aveoli/mouse).

2.7. Phrenic and sciatic nerve dissection and processing

P5/P6 phrenic and sciatic nerves were fixed with 8 % glutaraldehyde in phosphate buffer and embedded in resin (Poly/Bed^® 812; catalog:21844–1; Polysciences Inc.). After fixation, nerves were incubated in 2 % osmium tetroxide in phosphate buffer for 45 min followed by rinses in ascending ethanol concentrations (50 %, 70 %, 80 %, 95 %, and 100 %) and propylene oxide. Samples were then incubated in a 1:1 propylene oxide: resin mixture for 1 h, incubated in resin overnight, placed in a resin mold, and cured at 60 °C for 8 h. Semi-thin sections of 1 μm were stained with alkaline toluidine blue, cover-slipped with Permount mounting medium (ThermoFisher Scientific), and visualized by light microscopy at 100× magnification (Leica DM5500 B, Leica Microsystems Inc.). Image quantification was performed in a blind manner using the semi-automated MyelTracer software (Kaiser et al., 2021). Myelinated fiber counts were counted using ImageJ (FIJI).

2.8. NMJ immunohistochemistry

Whole mount preparations were post-fixed in 4 % PFA following muscle dissection of P5-P7 mice. Anti-neurofilament heavy chain (NF-H) (1:2000, catalog:AB5539, Millipore) and anti-synaptic vesicle 2 (SV2) (1:200, catalog:YE269, Life Technologies) primary antibodies were used. Donkey anti-chicken Alexa Fluor 488 (1:400, catalog:703–545–155, Jackson ImmunoResearch) and goat anti-rabbit Alexa Fluor 488 (1:200, catalog:111–545–003, Jackson ImmunoResearch) secondary antibodies were used to label the axon and synaptic terminal. Acetylcholine receptors were labelled with Alexa Fluor 594-conjugated α-bungarotoxin (1:200, catalog:B13423, Life Technologies). Three individual images were acquired at 20× magnification using a Leica DM5500 B microscope (Leica Microsystem Inc.) and analyzed blindly. Images were analyzed based on the end plate overlap with the synaptic terminal. Endplates with missing overlapping terminals were considered fully denervated, endplates with partial overlap were considered partially denervated, and endplates with complete overlap were considered fully innervated.

2.9. Diaphragm and skeletal muscle immunohistochemistry

Animals were sacrificed and tissues were dissected from P5-P7 mice. Fresh tissue was flash frozen in liquid nitrogen-chilled 2-methyl-2-butene then embedded in OCT compound (Tissue-Tek© OCT Compound, catalog: 4583, Sakura Finetek USA) and flash frozen again. Tissues were cryosectioned in 10 μm sections were co-stained with anti-Laminin primary antibody (1:200; catalog: L9393; Millipore Sigma), myosin heavy chain (MyHC) type 1 (1:10, catalog: BA-D5-s, Iowa Developmental Studies Hybridoma Bank), MyHC type 2 A (1:50, catalog: SC-71-s, Iowa Developmental Studies Hybridoma Bank), MyHC type 2B (1:5, catalog: BF-F3-s, Iowa Developmental Studies Hybridoma Bank). Secondary antibody for laminin was Goat anti-Rabbit, Alexa Fluor^™ 647 (1:500, catalog: A21244, ThermoFisher Scientific), (MyHC) type 1 Goat anti-Mouse, Alexa Fluor^™ 350 (1:500, catalog: A21140, ThermoFisher Scientific), MyHC type 2A Goat anti-Mouse, Alexa Fluor^™ 555 (1:500, catalog: A21127, ThermoFisher Scientific), and MyHC type 2B Goat anti-Mouse, Alexa Fluor^™ 488 (1:500, catalog: A21042, ThermoFisher Scientific). For the analysis of embryonic muscle fiber type, fresh 10 μm histological sections were co-stained with anti-Laminin primary antibody (1:200; catalog: L9393; Millipore Sigma) and eMyHC (embryonic) (1:5, catalog: F1.652, Iowa Developmental Studies Hybridoma Bank). Secondary antibody for laminin was Goat anti-Rabbit, Alexa Fluor^™ 647 (1:500, catalog: A21244, ThermoFisher Scientific) and eMyHC Goat anti-Mouse, Alexa Fluor^™ 555 (1:500, catalog: A21127, ThermoFisher Scientific). Muscle fiber area and diameter were analyzed in a blinded manner using SMASH, semi-automatic muscle analysis using segmentation of histology (Smith and Barton, 2014).

2.10. Electrophysiology studies

Measurements were obtained from the right gastrocnemius muscle and recorded following sciatic nerve stimulation in P4 mice, as previously described (Arnold et al., 2014). Briefly, mice were anesthetized with isoflurane using a Somnoflo vaporizer and mouse pup anesthesia cone (2 % for induction (150 mL/min) and 1.5 % (100 mL/min for maintenance) and placed on a warming mat set at 37 °C. An active ring electrode was placed over the proximal portion of the gastrocnemius muscle, and a reference ring electrode was placed over the metatarsals of the right hind paw (Alpine Biomed, Skovlunde, Denmark). Spectra 360 electrode gel was applied to decrease impedance (Parker Laboratories, Fairfield, NJ). A common reference electrode was placed on the tail. Two 28-gauge monopolar needle electrodes (Teca, Oxford Instruments Medical, New York, NY) were placed 0.5 cm away from the right sciatic nerve in the region of the proximal thigh. A portable electrodiagnostic system (Cadwell Sierra Summit, Kennewick, WA) was used to stimulate the sciatic nerve (0.1 ms pulse, 1–10 mA intensity) and record responses. Maximum CMAP was determined be delivering a supramaximal stimulation to the sciatic nerve. To determine MUNE, a total of 10 incremental responses were recorded while gradually increasing stimulation intensity. A incremental response was accepted if it showed a stable, repeatable amplitude and had an amplitude differences of at least 25 uV compared with the prior response. The 10 incremental responses were averaged to calculate the average single motor unit potential (SMUP) amplitude. To calculate MUNE, the maximum CMAP amplitude was divided by SMUP. RNS was performed by delivering trains of supramaximal stimulations at 10 Hz, and decrement was calculated as the percentage amplitude difference from the 10th to the 1st response with the following equation: % Amplitude decrement = [(Amplitude of 10th response - Amplitude 1st response)/Amplitude of 1st response] * 100 %. Compound muscle action potential (CMAP), motor unit number estimation (MUNE) and repetitive nerve stimulation (RNS) decrements were performed as previously reported (Arnold et al., 2014).

2.11. Generation of ssAAV9-IGHMBP2 virus and ICV injections

The single-stranded AAV9-IGHMBP2 viral vector has been previously described (Shababi et al., 2016; Smith et al., 2022). Viral particles were generated in HEK293T cells (ATCC^® CRL-3216^™) using 25-kDa polyethyleneimine and purified using three CsCl density-gradient ultracentrifugation steps followed by dialysis against PBS buffer. Number of viral genomes were determined by qPCR using SYBR green (catalog:1902522, Thermo Fisher Scientific). The animals were intracerebral ventricular (icv) injected at P0 and P1 with ssAAV9-IGHMBP2 and total of 1.3 × 10¹¹ viral genomes. Genomic DNA was extracted from the lumbar region of the spinal cord of the injected mice and controls. The presence of the vector was detected by PCR using the following primers: SV40-Forward 5′-GGATGTTGCCTTTACTTCTAGGCC and IGHMBP2-Reverse 5′-GCGTCTCTCTCGAGCTCCAG with a melting temperature of 60 °C. For qPCR, spinal cords were dissected from P6 Ighmbp2^R604X/R604X + ssAAV9-IGHMBP2, uninjected Ighmbp2^R604X/R604X mice, and Ighmbp2^+/+ mice, flash frozen in liquid nitrogen, and stored at −80 °C until processing. Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Cat. No. 74104) according to the manufacturer’s protocol, including on-column DNase I digestion (Qiagen RNase-Free DNase Set, Cat. No. 79254) to eliminate genomic DNA contamination. RNA concentration and purity were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific). For cDNA synthesis, 2 μg of total RNA was reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, Cat. No. 18090050). Quantitative PCR was performed on a CFX Real-Time PCR Detection System (Bio-Rad) with SYBR Green PCR Master Mix (Applied Biosystems, Cat. No. 4309155). Viral transgene expression was quantified using primers specific for the vector using forward (SV40) 5’-GGATGTTGCCTTTACTTCTAGGCC-3′ and reverse (IGHMBP2) 5′- GCGTCTCTCTCGAGCTCCAG-3’primers, with a melting temperature of 60 °C. The quantification was determined by comparison to a standard curve generated from serial dilutions of the target template.

2.12. Statistics

All experiments were performed in at least three biological replicates for reproducibility of data. The statistics analyses performed for each experiment using GraphPad Prism are included within the figure legends. P values less than 0.05 were considered statistically significant. The number of animals within cohorts is indicated within the figure legends. Survival analyses were determined using survival data summary. Statistical analyses for weight, nerve analyses, and electrophysiology were determined using one-way ANOVA with Tukey’s multiple comparison analyses. Statistical analyses for muscle fiber type were determined using one-way ANOVA with Dunnett’s multiple comparison analyses. Statistical analyses for milk spot, plethysmography, NMJ, were determined using two-way ANOVA with Tukey’s multiple comparison analyses.

2.13. Study approval

All experimental procedures were approved by the University of Missouri’s Institutional Animal Care and Use Committee and were performed according to the guidelines outlined in the Guide for the Use and Care of Laboratory Animals.

3. Results

3.1. Ighmbp2^R604X/R604X mice had significantly reduced lifespan and weight with failure to thrive

IGHMBP2 is an RNA/DNA helicase of the SF1 family of helicases with a helicase core domain and C-terminal R3H and AN-1 zing finger (ZnF) domains (Fig. 1A). The IGHMBP2-R605X mutation is located within the helicase domain (Fig. 1A). We generated the orthologous IGHMBP2-R605X mutation (Ighmbp2-R604X) in FVB mice using CRISPR-Cas9, changing the nucleotide sequence at amino acid 604 from CGG to TAG (Fig. 1B). To understand how the Ighmbp2-R604X mutation impacted disease, we bred Ighmbp2^+/R604X mice and examined survival and weight in Ighmbp2^+/R604X, Ighmbp2^R604X/R604X and age-matched wild type mice. Survival was significantly reduced in Ighmbp2^R604X/R604X mice with an average lifespan of six days (P < 0.0001); survival was not affected in Ighmbp2^+/R604X and wild type mice followed to weaning (Fig. 1C–D). Ighmbp2^R604X/R604X mice did not demonstrate a significant difference in weight at birth (mean +/+ = 1.33 g, +/R604X = 1.37 g, R604X/R604X = 1.34 g); however, there was a rapid decline in weight from P0 to P3 (mean +/+ = 2.56 g, +/R604X = 2.66 g, R604X/R604X = 1.76 g) (Fig. 1C, E). There was no statistical difference between age-matched wild type and Ighmbp2^+/R604X mice in weight. The mean weight at P6 was significantly different between wild type (4.35 g ± 0.66) and Ighmbp2^+/R604X (4.51 g ± 0.52) mice when compared to Ighmbp2^R604X/R604X (1.94 g ± 0.29) mice, but not between wild type and Ighmbp2^+/R604X mice (Fig. 1C, E). These results show that Ighmbp2^R604X/R604X mice have a reduced lifespan and failure to thrive.

Fig. 1.

Ighmbp2^R604X/R604X mice had significantly reduced lifespan and weight. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) A schematic representing the IGHMBP2 protein with the IGHMBP2-R605X mutation indicated (IGHMBP2-R604X in mice). (B) A schematic demonstrating the CGG to TAG genomic alteration of the mouse Ighmbp2 gene to generate the Ighmbp2^+/R604X mouse. (C) Representative images of P0 (postnatal day) and P6 wild type and Ighmbp2^R604X/R604X mouse pups. (D) Survival curve for wild type, Ighmbp2^+/R604X, and Ighmbp2^R604X/R604X mice followed for 21 days. Survival was 21 days for wild type and Ighmbp2^+/R604X mice while the mean survival for Ighmbp2^R604X/R604X mice was 6 days (P < 0.0001). Wild type = 21 animals, Ighmbp2^+/R604X = 24 animals, and Ighmbp2^R604X/R604X = 45 animals, n total = 90. DF = 2, (E) Weight measured for 21 days. The mean weight was wild type = 6.97 g, Ighmbp2^+/R604X = 6.86 g, Ighmbp2^R604X/R604X = 1.83 g (P = 0.0003, SE diff = 1.2, +/+ and R604X/R604X; P = 0.0003 +/R604X and R604X/R604X, SE diff = 1.2) (F(DFn,Dfd 2,51), P = 0.0001). Wild type = 26 animals, Ighmbp2^+/R604X = 26 animals, and Ighmbp2^R604X/R604X = 30 animals, n total = 82. DF = 51. Statistical analyses: Survival data summary for survival, one-way ANOVA with Tukey’s multiple comparison for weight. Values are expressed as mean, n = number of mice, DF = degrees of freedom, SE diff = standard error of the difference. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.2. Ighmbp2^R604X/R604X mice showed rapid decline of milk spot

Due to the progressive loss of weight, we scored the presence of the milk sac/spot, an indicator of successful suckling by the pup. In the same animals, we compared survival, weight and the milk spot from P0 to P8 (Fig. 2). Mice pups were given a score of 2.0 for a full milk spot, 1.0 for a partially full milk spot and 0 for no milk spot observed. By P3, there was a statistical difference between wild type (score 2.0) and Ighmbp2^R604X/R604X mice (score 1.2, P < 0.0001) and Ighmbp2^+/R604X (score 1.9) and Ighmbp2^R604X/R604X mice (Fig. 2C). At P4, when there was a significant weight difference (mean +/+ = 3.34 g, +/R604X = 3.01 g, R604X/R604X = 2.21 g, P < 0.0001), the milk spot score for Ighmbp2^R604X/R604X mice was statistically different (+/+ = 2.0, +/R604X = 2.0, R604X/R604X = 0.75, P < 0.0001) (Fig. 2B–C). Interestingly, all Ighmbp2^R604X/R604X mice analyzed had a visible milk spot at P0; however, the milk spot declined in most instances quite rapidly. There was a correlation between decreased survival, failure to gain weight and reduction of a milk spot (Fig. 2A–D). These results suggest that the rapid reduction in lifespan and weight was at least in part due to the reduction/absence of nutrition associated with reduced suckling (reduction in milk spot).

Fig. 2.

Ighmbp2^R604X/R604X mice had a rapid decline of milk spot while maintaining latency to fall. Wild type (black, n = 13), Ighmbp2^+/R604X (orange, n = 12), and Ighmbp2^R604X/R604X (blue, n = 12). A study of survival, weight, milk spot and latency to fall of same cohort of wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice for 8 days. (A) Survival curve with 25 % survival at P7 for Ighmbp2^R604X/R604X mice. (B) Weight measured for 8 days. P4 mean weight wild type = 3.34 g, Ighmbp2^+/R604X = 3.01 g, Ighmbp2^R604X/R604X = 2.21 g (P < 0.0001 +/+ and R604X/R604X, SE diff = 0.17, DF = 288) (F(DFn,DFd) F(2,24) = 3.27, P = 0.0556). (C) Presence of milk spot. Score of 2 = full milk spot, 1 = partial milk spot, 0 = no milk spot present. P4 wild type = 2, Ighmbp2^+/R604X = 2, Ighmbp2^R604X/R604X = 0.75 (P < 0.0001, SE diff = 0.13 +/+ and R604X/R604X; P < 0.0001, SE diff = 0.13 +/R604X and R604X/R604X, DF = 289) (F(DFn,DFd) interaction F(16,289) = 14.96, P < 0.0001; row factor F(8,289) = 10.88, P < 0.0001; column factor F(2,289) = 331, P < 0.0001). (D) Diagram showing correlation between survival, weight and presence of milk spot. (E) Latency to fall measured from P2-P7. Mean wild type = 24.0 s, Ighmbp2^+/R604X = 26.4 s, Ighmbp2^R604X/R604X = 24.1 s (NS), DF = 15, SE diff = 2.2 (F (DFn,DFd) F(2,15) = 0.0723, P = 0.5015). Statistical analyses: Survival data summary for survival n = 37 animals, DF = 2; one-way ANOVA with Tukey’s multiple comparison for weight and one-way ANOVA with Tukey’s multiple comparison for latency to fall, two-way ANOVA with Tukey’s multiple comparison for milk spot. Values are expressed as mean, n = number of mice, NS = not significant, DF = degrees of freedom, SE diff = standard error of the difference. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.3. Latency to fall in Ighmbp2^R604X/R604X mice was not affected

Since lifespan was dramatically reduced in Ighmbp2^R604X/R604X mice, we were unable to accomplish most motor function assessments; however, latency to fall was measured from P2-P7 (Fig. 2E). For this assessment, neonatal mice were suspended from their hindlimbs from the edge of a 50-ml conical tube with gauze padding at the bottom of the tube. The time from suspension until the fall of the pup was recorded up to thirty seconds. Each mouse was recorded three times daily with the average of the three scores recorded as the daily average.

There was no statistical difference in latency to fall between age-matched wild type, Ighmbp2^+/R604X, and Ighmbp2^R604X/R604X mice (mean +/+ = 24.0 s, +/R604X = 26.4 s, R604X/R604X = 24.1 s); however, it was apparent that wild type and Ighmbp2^+/R604X had reduced latency to fall time due to their extensive movement as they reached P7. In contrast, Ighmbp2^R604X/R604X mice just hung from the tube and the reduced latency to fall was likely attributed to their reduced muscle strength (Fig. 2E).

3.4. Ighmbp2^R604X/R604X mice presented with extensive changes in respiration and lung pathology

SMARD1 patients present with respiratory changes early in life. The previously described SMARD1 Ighmbp2^D564N/D564N mouse showed significant respiratory changes and did not respond to altered CO₂ and O₂ conditions (Smith et al., 2022). Interestingly, the previously described short-lived Ighmbp2^D564N/H922Y cohort developed respiratory differences later and mounted a response to altered CO₂ and O₂ conditions (Ricardez Hernandez et al., 2025). To determine whether respiration significantly impacted survival in Ighmbp2^R604X/R604X mice, we performed head-out plethysmography at P2 using customized pup chambers due to the reduced size and weight of the animals. Respiration was analyzed under three conditions normoxia (21 % O₂ + 0 % CO₂ + 79 % N₂), hypercapnia (7 % CO₂, 21 % O₂, balanced N₂) (HC), and hypercapnia (7 % CO₂) + hypoxia (10.5 % O₂, balanced N₂) (HC + HX). Normoxia serves as the baseline condition for the parameters measured. Conditions of hypercapnia and hypercapnia + hypoxia provide a potent stimulation to the central (activated by high CO₂) and peripheral (activated by low O₂) chemoreceptors that in turn stimulate the central pattern generator for respiratory drive and increased ventilation (increased respiratory frequency and tidal volume) as observed in wild type mice. The following eight parameters were measured: frequency (f), tidal volume (VT), minute ventilation (VE), mean inspiratory flow (VT/TI), peak inspiratory flow (PIF), peak expiratory flow (PEF), inspiratory time (Ti) and expiratory time (Te) (Fig. 3). Ighmbp2^R604X/R604X mice experienced significant respiratory changes when compared to wild type or Ighmbp2^+/R604X mice under all parameters measured except inspiratory time (Fig. 3). There were no significant respiratory differences between wild type and Ighmbp2^+/R604X mice under any conditions (Fig. 3). Respiratory frequency was significantly decreased in Ighmbp2^R604X/R604X mice when compared to wild type or Ighmbp2^+/R604X mice under all conditions (Fig. 3A). Ighmbp2^R604X/R604X mice did show elevated, but not significant, changes in frequency from normoxia to hypercapnia and hypercapnia + hypoxia; however, frequency remained significantly reduced compared to wild type mice (Fig. 3A). Tidal volume was similar under normoxia conditions for all mice measured; however, unlike wild type and Ighmbp2^+/R604X mice, Ighmbp2^R604X/R604X mice did not adequately respond to reduced O₂ and elevated CO₂ conditions (HC + HX) (Fig. 3B). Minute ventilation, which accounts for frequency and tidal volume, affirms that Ighmbp2^R604X/R604X mice experience significant respiratory changes and unlike wild type and Ighmbp2^+/R604X mice do not mount a response to altered CO₂ and O₂ conditions (Fig. 3C). These results suggest that in addition to experiencing respiratory dysfunction during all conditions, chemoreception is altered in Ighmbp2^R604X/R604X mice. To understand if respiration was impacted by respiratory muscle strength or respiratory obstruction we measured flow rates. Mean inspiratory flow (MIF-average flow rate of air during inspiration) was similar between all mice under normoxia; however, MIF was significantly decreased in Ighmbp2^R604X/R604X mice under hypercapnia and hypercapnia + hypoxia conditions (Fig. 3D). Peak inspiratory flow, the maximum airflow achieved during inspiration, was significantly different in Ighmbp2^R604X/R604X mice under all three conditions (N, HC, HC + HX) affirming that Ighmbp2^R604X/R604X mice showed difficulty in the inspiratory phase of respiration (Fig. 3E). When peak expiratory flow (PEF) was measured for wild type and Ighmbp2^+/R604X mice there were no significant differences under any conditions; however, Ighmbp2^R604X/R604X mice showed significantly reduced PEF under hypercapnia and hypercapnia + hypoxia suggesting Ighmbp2^R604X/R604X mice also showed difficulty in the expiratory phase of respiration (Fig. 3F). Collectively, these data show that Ighmbp2^R604X/R604X mice are taking slower breaths with less force suggesting that respiratory muscle weakness, axonal degeneration, NMJ denervation and/or lung pathology are contributing to reduced inspiratory and expiratory flow impacting proper respiration; air flow is exacerbated during reduced O₂ and increased CO₂ respiratory conditions. Ighmbp2^R604X/R604X mice did not show differences in inspiratory time under any conditions but there was significantly prolonged expiratory time under normoxia that was reduced under challenged respiratory conditions (Fig. 3G–H). In summary, PIF is significantly decreased under all conditions and during challenges for PEF. This, in addition to altered expiratory time under all conditions suggests airway resistance in Ighmbp2^R604X/R604X mice.

Fig. 3.

Ighmbp2^R604X/R604X mice presented with extensive changes in respiration. Wild type (black-9 mice), Ighmbp2^+/R604X (orange-5 mice), and Ighmbp2^R604X/R604X (blue-12 mice). Head-out plethysmography was measured at P2 under conditions of normoxia, hypercapnia (HC) and hypercapnia + hypoxia (HC + HX). (A) Frequency (breaths/min) (normoxia P = 0.0044, +/+ (127.10) and R604X/R604X (69.22); P = 0.0016, +/R604X (146.0) and R604X/R604X; HC P = 0.0427, +/+ (147.5) and R604X/R604X (104.2); P = 0.0285, +/R604X (159.9) and R604X/R604X; HC + HX P = 0.0194, +/+ (154.1) and R604X/R604X (105.3); P = 0.0064, +/R604X (172.6) and R604X/R604X, (F(DFn,DFd) interaction F(4,69) = 0.01, P = 0.9581; row factor F(2,69) = 3.5, P = 0.0350; column factor F(2,69) = 19.9, P < 0.0001). (B) Tidal volume (milliliters/g) (HC P = 0.0086, +/R604X (0.0143) and R604X/R604X (0.0096); HC + HX P = 0.0065, +/+ (0.0134) and R604X/R604X (0.0094), P = 0.0014, +/R604X (0.0150) and R604X/R604X; P = 0.0114, +/+ normoxia and HC + HX; (F(DFn,DFd) interaction F(4,69) = 2.2, P = 0.0803; row factor F(2,69) = 5.1, P = 0.0083; column factor F(2,69) = 9.7, P = 0.0002). (C) Minute ventilation (milliliters/min/g) (normoxia P = 0.0421,+/+ (1.206) and R604X/R604X (0.6081); P = 0.0054, +/R604X (1.551) and R604X/R604X; HC P = 0.0019, +/+ (1.787) and R604X/R604X (0.9239); P < 0.0001, +/R604X (2.259) and R604X/R604X; HC + HX P < 0.0001, +/+ (2.134) and R604X/R604X (0.9447); P < 0.0001, +/R604X (2.554) and R604X/R604X) (F(DFn,DFd) interaction F (4,69) = 1.0, P = 0.3928; row factor F(2,69) = 11.4, P < 0.0001; column factor F(2,69) = 37, P < 0.0001). (D) Mean inspiratory flow (milliliters/s/g) (HC P = 0.0005, +/+ (0.0841) and R604X/R604X (0.0478); P = 0.0011, +/R604X (0.0888) and R604X/R604X; HC + HX P = 0.0072, +/+ (0.0825) and R604X/R604X (0.0539); P = 0.0067, +/R604X (0.0886) and R604X/R604X; +/+ P = 0.0262 normoxia and HC, P = 0.0398 normoxia and HC + HX,) (F(DFn,DFd) interaction F (4,69) = 1.0, P = 0.3892; row factor F(2,69) = 5.5, P = 0.0063; column factor F(2,69) = 18, P < 0.0001). (E) Peak inspiratory flow (milliliters/s) (normoxia P = 0.0033, +/+ (0.3581) and R604X/R604X (0.1780); P = 0.0121, +/R604X (0.3667) and R604X/R604X; HC P < 0.0001, +/+ (0.4813) and R604X/R604X (0.1807); P < 0.0001, +/R604X (0.5017) and R604X/R604X; HC + HX P < 0.0001, +/+ (0.5104) and R604X/R604X (0.2005); P < 0.0001, +/R604X (0.5008) and R604X/R604X; +/+ P = 0.0244 normoxia and HC + HX) (F(DFn,DFd) interaction F(4,69) = 1.2, P = 0.3321; row factor F(2,69) = 4.8, P = 0.0108; column factor F(2,69) = 47, P < 0.0001). (F) Peak expiratory flow (milliliters/s) (HC P = 0.0037, +/+ (0.3032) and R604X/R604X (0.1708); P = 0.0157, +/R604X (0.3066) and R604X/R604X; HC + HX P = 0.0001, +/+ (0.3447) and R604X/R604X (0.1716); P = 0.0093, +/R604X (0.3164) and R604X/R604X; +/+ P = 0.0287 normoxia and HC + HX) (F(DFn,DFd) interaction F(4,69) = 0.70, P = 0.5956; row factor F(2,69) = 3.8, P = 0.0275; column factor F(2,69) = 19.6, P < 0.0001). (G) Inspiratory time (seconds) (F(DFn,DFd) interaction F(4,69) = 0.31, P = 0.8677; row factor F(2,69) = 0.37, P = 0.6947; column factor F(2,69) = 3.9, P = 0.0245). (H) Expiratory time (seconds) (normoxia P = 0.0010, +/+ (0.3490) and R604X/R604X (0.9864); P = 0.0022, +/R604X (0.2635) and R604X/R604X; P = 0.0071, normoxia and HC, P = 0.0128, normoxia and HC + HX), (F(DFn,DFd) interaction F(4,69) = 1.2, P = 0.3024; row factor F(2,69) = 2.2, P = 0.1248; column factor F(2,69) = 10.5, P = 0.0001). Statistical analyses: two-way ANOVA with Tukey’s multiple comparisons. Total mice = 26. Values are expressed as mean. HC = hypercapnia, HC + HX = hypercapnia + hypoxia. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Due to the significant respiratory changes, lung pathology was examined (Fig. 4). Thickening of the alveolar wall (cell layer thickness), enhanced injury (tissue injury), presence of a hyaline membrane (acellular deposits in alveolar region) and atelectasis (complete or partial collapse of air spaces) was scored. For each of these pathological examinations, significant differences were observed between wild type and Ighmbp2^R604X/R604X mice (Fig. 4A–D). These results are consistent with the changes observed in inspiratory and expiratory flow, especially during respiratory challenge conditions and suggests lung pathology is an important factor contributing to respiratory complications (Figs. 3, 4).

Fig. 4.

Ighmbp2^R604X/R604X mice showed changes in lung pathology and evidence of milk aspiration. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). Five mice for each genotype and three images per mouse were analyzed. (A) Thickening of the alveolar wall was scored 0–18 points. Each image/mouse was scored 0–6 with 0 = no thickening of alveolar wall (1 cell layer thick), 1–2 = mild thickening, 3–4 = moderate thickening of alveolar wall, 5 = extensive thickening of alveolar wall, 6 = complete thickening. Representative image of thickening of alveolar wall. Mean wild type = 3.2, Ighmbp2^+/R604X = 3.7, Ighmbp2^R604X/R604X = 8.8. +/+ and R604X/R604X, P = 0.0007; +/R604X and R604X/R604X, P = 0.0010, DF = 13 (F(DFn,DFd) F(2,13) = 15.7, P = 0.0003). (B) The presence of hyaline membrane (acellular deposits in the alveolar region) was scored 0–6 points. Each image/mouse was scored 0–2 with 0 = no acellular debris, 1 = partial build up of acellular debris, 2 = significant build up of acellular debris. Representative image of hyaline membrane. Mean wild type = 0.0, Ighmbp2^+/R604X = 0.5, Ighmbp2^R604X/R604X = 1.8. +/+ and R604X/R604X, P = 0.0091; +/R604X and R604X/R604X, P = 0.0460, DF = 13 (F(DFn,DFd) F(2,13) = 6.8, P = 0.0095). (C) Observed enhanced injury was scored 0–18 points. Each image/mouse was scored 0–6 with 0 = no damage, 1 = minimum damage, 2 = mild damage, 3 = moderate damage, 4 = pronounced damage, 5 = extensive damage, 6 = completely damaged. Representative image of enhanced injury in lung. Mean wild type = 2.0, Ighmbp2^+/R604X = 3.3, Ighmbp2^R604X/R604X = 11.2. +/+ and R604X/R604X, P < 0.0001; +/R604X and R604X/R604X, P < 0.0001, DF = 13 (F(DFn,DFd) F(2,13) = 38.8, P < 0.0001). (D) Atelectasis (complete or partial collapse of distal air spaces) was scored 0–12. Each image/mouse was scored 0–4 with 0 = no collapse, 1 = slight collapse, 2 = 50 % collapse, 3 = nearly full 75 % collapse, 4 = full collapse of distal air spaces. Representative image of atelectasis within the lung. Mean wild type = 1.2, Ighmbp2^+/R604X = 1.7, Ighmbp2^R604X/R604X = 5.2. +/+ and R604X/R604X, P = 0.0004, +/R604X and R604X/R604X, P = 0.0009, DF = 13 (F(DFn,DFd) F (2,13) = 16.8, P = 0.0003). (E) Representative images of lungs from wild type, Ighmbp2^+/R604X, and Ighmbp2^R604X/R604X mice lungs immunostained with antibodies against milk proteins (red-see white arrows). The presence of milk within an alveoli was scored based on the presence of anti-milk antibody staining. Five mice were scored per genotype with wild type (708 alveoli scored, 118+ alveoli/mouse), Ighmbp2^+/R604X (683 alveoli scored, 102+ alveoli/mouse), and Ighmbp2^R604X/R604X (593 alveoli scored, 91 + alveoli/mouse). Wild type (mean = 1.7 %), Ighmbp2^+/R604X (mean = 2.9 %), and Ighmbp2^R604X/R604X (12.1 %) (*P = 0.0134, **P = 0.0064) (F(DFn,DFd) F(2,12) = 8.8, P = 0.0045). Statistical analyses: one-way ANOVA with Tukey’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.5. Ighmbp2^R604X/R604X mice showed evidence of milk aspiration

Ighmbp2^R604X/R604X mice showed significant respiratory dysfunction in addition to disease pathology in the lung and reduction in the milk spot; therefore, we examined whether Ighmbp2^R604X/R604X mice could be aspirating milk into the lungs (Fig. 4E). Discoordination between respiration and swallowing, respiratory muscle weakness, tongue positioning and airway size can all lead to air flow impedance and aspiration. Lungs from wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice were examined by immunohistochemistry to detect the presence of milk protein; the presence of milk protein within the lungs is indicative of aspiration. There was significant evidence of milk protein in the lungs of Ighmbp2^R604X/R604X mice but not in age-matched control mice (mean +/+ = 1.73 %, +/R604X = 2.86 %, R604X/R604X = 12.12 %, *P = 0.0134, **P = 0.0064). These studies provide the first evidence that aspiration could be impacting respiration and survival in Ighmbp2^R604X/R604X mice.

3.6. Phrenic nerve axons showed reduced size and myelination differences in Ighmbp2^R604X/R604X mice

The significant respiratory changes in Ighmbp2^R604X/R604X mice prompted an examination of the phrenic nerve that innervates the diaphragm (Fig. 5). Phrenic nerve axon area, perimeter, diameter, G-ratio, myelin thickness, number of myelinated fibers/mouse cross-section and distribution were analyzed for wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice. We reported axon fiber perimeter, diameter and area when examining axon fibers as some abnormal morphologies were detected in axon fibers in our SMARD1 diseased mice that altered one parameter and not another. There was a significant reduction between wild type and Ighmbp2^R604X/R604X mice in all axon measurements except number of myelinated fibers/mouse cross-section. That the phrenic axon G-ratio and myelin thickness are both reduced suggests that the reduction in phrenic axon diameter is greater than the reduction in myelin thickness. While there was reduced myelin thickness in Ighmbp2^R604X/R604X mice, the difference in the number of myelinated axons between wild type and Ighmbp2^R604X/R604X mice was not significant (Fig. 5E, F). There were also significant differences between Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice in phrenic nerve axon perimeter, diameter and myelin thickness (Fig. 5). When the distribution of phrenic nerve axon area was analyzed, Ighmbp2^R604X/R604X showed a clear trend towards more, smaller phrenic nerve axons when compared to wild type and Ighmbp2^+/R604X mice (Fig. 5G). While there were no significant respiratory differences between wild type and Ighmbp2^+/R604X mice observed, phrenic nerve axon area, perimeter, diameter, G-ratio and myelin thickness were different between these two cohorts (Fig. 5B–E). That Ighmbp2^R604X/R604X mice showed more, smaller phrenic nerve axons with reduced myelin thickness supports the plethysmography findings in these mice.

Fig. 5.

Phrenic nerve axons in Ighmbp2^R604X/R604X mice were smaller with reduced myelin thickness. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Phrenic nerve axon area (+/+ = 1.68 μm², +/R604X = 1.51 μm², R604X/R604X = 1.46 μm², ***P = 0.0004, *P = 0.0165, (DF = 1759) (F(DFn, DFd) F(2,1759) = 7.6, P = 0.0005). (B) Phrenic nerve axon perimeter (+/+ = 6.03 μm, +/R604X = 5.65 μm, R604X/R604X = 5.22 μm, ****P < 0.0001, ***P = 0.0004,** P = 0.0052 (DF = 1759) (F(DFn,DFd) F(2,1759) = 26.7, P < 0.0001). (C) Phrenic nerve axon diameter (+/+ = 1.42 μm, +/R604X = 1.35 μm, R604X/R604X = 1.29 μm, ****P < 0.0001, **P = 0.0090, *P = 0.0234, DF = 1759) (F(DFn,DFd) F(2,1759) = 17.0, P < 0.0001). (D) Phrenic nerve axon G-ratio (+/+ = 0.49, +/R604X = 0.46, R604X/R604X = 0.47, ***P = 0.0002, ****P < 0.0001, DF = 1759) (F(DFn,DFd) F(2,1759) = 16.1, P < 0.0001). (E) Phrenic nerve axon myelin thickness (+/+ = 1.51 μm, +/R604X = 1.56 μm, R604X/R604X = 1.42 μm, ****P < 0.0001, *P = 0.0193, DF = 1759) (F(DFn,DFd) F(2,1759) = 29.6, P < 0.0001). (F) Number of myelinated fibers/mouse section (+/+ = 153, +/R604X = 155, R604X/R604X = 132) (F(DFn,DFd) F(2,15) = 1.9, P = 0.1847). (G) Axon area frequency distribution. (H-J) Representative images of axons of the phrenic nerve of (H) wild type (WT), (I) Ighmbp2^+/R604X and (J) Ighmbp2^R604X/R604X mice. Ninety-two to one hundred eleven axons were examined per mouse with five mice per genotype and 18 total mice. Statistical analyses: one-way ANOVA with Tukey’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.7. Neuromuscular junction innervation of the diaphragm in Ighmbp2^R604X/R604X mice

The significant respiratory changes and pathology of the phrenic nerve in Ighmbp2^R604X/R604X mice prompted an examination of the neuromuscular junction (NMJ) innervation status of the diaphragm (Fig. 6). Small but significant differences were observed in NMJ innervation of the diaphragm (mean fully innervated endplates +/+ = 99.5 %, +/R604X = 98.9 %, R604X/R604X = 97.4 %, P = 0.0055). The impact of these small changes in NMJ innervation status likely are not the sole contributor to the respiratory dysfunction observed in Ighmbp2^R604X/R604X mice.

Fig. 6.

The diaphragm showed slight changes in NMJ innervation in Ighmbp2^R604X/R604X mice. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Diaphragm neuromuscular junction (NMJ) innervation status. The percent of fully innervated endplates (+/+ = 99.5, +/R604X = 98.9, R604X/R604X = 97.4, P = 0.0055, DF = 36) (F(DFn,DFd) interaction F(4,36) = 5.9, P = 0.0010; row factor F(2,36) = 47,023, P < 0.0001; column factor F(2,36) = 18.5e-19, P > 0.9999). (B–D) Representative images of diaphragm NMJ in wild type (B), Ighmbp2^+/R604X (C) and Ighmbp2^R604X/R604X mice (D). Green represents neurofilament heavy (NF-H) and synaptic vesicle 2 (SV2) immunostaining while red represents bungarotoxin 594 immunofluorescence (αBTX). Statistical analyses: two-way ANOVA with Tukey’s multiple comparisons. Five mice from each genotype (15 mice total) were analyzed with one hundred nineteen to two hundred thirty-three NMJ analyzed/mouse. Values are expressed as mean. FI = fully innervated, PI = partially innervated, FD = fully denervated. NMJ = neuromuscular junction, DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.8. Diaphragm muscle fiber type composition was not altered but muscle fibers were smaller in Ighmbp2^R604X/R604X mice

Changes in muscle fiber type composition and the size of muscle fibers could alter the function or the efficiency of the diaphragm. To determine whether any changes in the diaphragm muscle were present, muscle fiber area and muscle fiber type composition were examined in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice (Fig. 7, Supplementary Fig. 1). Skeletal muscle is comprised of distinct myofibers with classifications based on expression of different myosin heavy chains (MyHC). MyHC-emb encoded by Myh3 is expressed embryonic day 9.5 to 13.5 in mice and is not normally expressed in adult muscles except transiently during skeletal muscle regeneration. Fibers expressing MyHC type 1 are classified as slow twitch fibers, present an oxidative metabolic type and express Myh7. MyHC type 2 fibers are classified as fast twitch and are comprised of MyHC 2 A, MyHC 2×, and MyHC 2B myofibers that express Myh2, Myh1, and Myh4, respectively. MyHC 2 A is oxidative in metabolism while 2× and 2B are glycolytic (Schiaffino and Moretti, 2015; Schiaffino and Reggiani, 2011; Westerblad et al., 2010). When diaphragm muscle fiber area was quantified, Ighmbp2^R604X/R604X mice muscle fibers were significantly smaller and the distribution demonstrated that Ighmbp2^R604X/R604X mice had more, small diaphragm muscle fibers than either wild type or Ighmbp2^+/R604X mice (Fig. 7A, J). Diaphragm embryonic muscle fibers had smaller area in Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice when compared to wild type mice and while there were more embryonic muscle fibers in Ighmbp2^R604X/R604X mice it was not significant (Fig. 7B, K). Regardless of slow or fast twitch fibers or metabolism, Ighmbp2^R604X/R604X mice had significantly reduced diaphragm muscle fiber area; however, there were no large differences between wild type and Ighmbp2^R604X/R604X mice in the composition of the diaphragm muscle (Fig. 7B–I, K, Supplementary Fig. 1). While maturation of the diaphragm muscle fibers is still occurring in these early postnatal mice, there remains a higher percentage of embryonic muscle fibers in Ighmbp2^R604X/R604X mice when compared to wild type mice (WT = 35 %, R604X/R604X = 66 %) (Fig. 7K). Additionally, in Ighmbp2^R604X/R604X mice the largest percentage of diaphragm muscle fiber type was MyHC-emb muscle fibers (emb = 65.5 %, Type 1 = 6.3 %, Type 2A = 15.3 %, Type 2B = 11.6 %, nonlabelled = 31.4 %) and MyHC-emb fibers also saw the most dramatic reduction in size (49 %) (Fig. 7B, K). These results show that Ighmbp2^R604X/R604X mice have smaller diaphragm muscle fibers of all MyHC types and suggest diaphragm function could be impacted by these changes, consistent with the plethysmography data. That there is a larger portion of MyHC-emb fibers in the Ighmbp2^R604X/R604X diaphragm that are significantly smaller in size than wild type mice suggests Ighmbp2^R604X/R604X present with delayed muscle fiber maturation and growth in that there was no evidence of significant absence of NMJ innervation or complete absence of maturation indicating an arrest.

Fig. 7.

Diaphragm muscle fiber type composition was not altered but muscle fibers were smaller in Ighmbp2^R604X/R604X mice. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Diaphragm muscle fiber area (+/+ = 365 μm², +/R604X = 358 μm², R604X/R604X = 262 μm²; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 8044) (F(DFn,DFd) F(2,8044) = 335.8, P < 0.0001). (B) Diaphragm embryonic muscle fiber area (+/+ = 449 μm², +/R604X = 363 μm², R604X/R604X = 228 μm²; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/+ and +/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 4771) (F(DFn,DFd) F(2,4771) = 566.3, P < 0.0001). (C) Diaphragm Type 1 muscle fiber area (+/+ = 396 μm², +/R604X = 391 μm², R604X/R604X = 242 μm²; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 417) (F(DFn,DFd) F(2,417) = 93.4, P < 0.0001). (D) Diaphragm Type 2 A muscle fiber area (+/+ = 374 μm², +/R604X = 347 μm², R604X/R604X = 231 μm²; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X; P = 0.0393, +/+ and +/R604X, DF = 1148) (F(DFn,DFd) F(2,1148) = 112.4, P < 0.0001). (E) Diaphragm Type 2B muscle fiber area (+/+ = 437 μm², +/R604X = 465 μm², R604X/R604X = 329 μm²; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 1232) (F (DFn,DFd) F(2,1232) = 49.7, P < 0.0001) (F) Diaphragm non-labelled (representing embryonic and Type X) muscle fiber area (+/+ = 431 μm², +/R604X = 445 μm², R604X/R604X = 290 μm², P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 2229) (F(DFn,DFd) F(2,2229) = 201.9, P < 0.0001) (G) Diaphragm Type 1 + 2 A hybrid muscle fiber area (+/+ = 352 μm², +/R604X = 309 μm², R604X/R604X = 201 μm², P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 213) (F(DFn,DFd) F(2,213) = 33.7, P < 0.0001). (H) Diaphragm Type 1 + 2B hybrid muscle fiber area (+/+ = 317 μm², +/R604X = 337 μm², R604X/R604X = 280 μm²), P = 0.0381, (F(DFn,DFd) F(2,207) = 3.7, P = 0.0269). (I) Diaphragm Type 1 + 2 A + 2B muscle fiber area (+/+ = 238 μm², +/R604X = 242 μm², R604X/R604X = 215 μm²; P = 0.0060, +/+ and R604X/R604X; P = 0.0003, +/R604X and R604X/R604X, DF = 1402) (F(DFn,DFd) F(2,1402) = 9, P = 0.0001). (J) Frequency distribution of diaphragm muscle fiber area in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice. (K) Percentage of all cells expressing a given muscle fiber type in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice, P = 0.0491. Five mice from each genotype (15 mice total) were analyzed with 2434–3177 total muscle fibers analyzed per genotype. Statistical analyses: one-way ANOVA with Dunnett’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.9. The sciatic nerve in Ighmbp2^R604X/R604X mice showed deficits in size and myelination

Since the phrenic nerve showed significant changes in axon size and myelination we also examined the same measurements in the sciatic nerve, that innervates hindlimb muscles, to determine if there was similar pathology (Fig. 8). Consistent with the phrenic nerve, there was significant reduction in sciatic nerve axon area, perimeter, diameter, G-ratio and myelin thickness between Ighmbp2^R604X/R604X and wild type and Ighmbp2^+/R604X mice (Fig. 8). That the sciatic axon G-ratio and myelin thickness are both reduced suggests that the reduction in axon diameter is proportionally greater than the reduction in myelin thickness. Ighmbp2^+/R604X mice demonstrated differences in sciatic nerve axon perimeter, diameter and G-ratio when compared to wild type mice, consistent with the data observed in the phrenic axons (Fig. 8). There was also a reduction in the number of myelinated axons scored per mouse cross-section in Ighmbp2^R604X/R604X mice. This suggests a developmental delay in myelination or a disruption of Schwann cell function (Fig. 8F). When the distribution of sciatic nerve axon area was examined, Ighmbp2^R604X/R604X mice had more, small axon fibers when compared to Ighmbp2^+/R604X or wild type mice (1.0 or less, +/+ = 39 %, +/R604X = 47 %, R604X/R604X = 67 %) (Fig. 8G–J). These differences likely contribute towards impaired hindlimb muscle function.

Fig. 8.

The sciatic nerve in Ighmbp2^R604X/R604X mice showed changes in size and myelination. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Sciatic nerve axon area (+/+ = 1.65 μm², +/R604X = 1.53 μm², R604X/R604X = 1.05 μm²; ****P < 0.0001, (DF = 1524) (F(DFn,DFd) F(2,1524) = 63.2, P < 0.0001). (B) Sciatic nerve axon perimeter (+/+ = 5.98 μm, +/R604X = 5.50 μm, R604X/R604X = 4.66 μm; ****P < 0.0001, ***P = 0.0004, DF = 1524) (F(DFn, DFd) F(2,1524) = 56.1, P < 0.0001). (C) Sciatic nerve axon diameter (+/+ = 1.41 μm, +/R604X = 1.34 μm, R604X/R604X = 1.08 μm; ****P < 0.0001, *P = 0.0176, (DF = 1524) (F(DFn,DFd) F(2,1524) = 100.3, P < 0.0001). (D) Sciatic nerve axon G-ratio (+/+ = 0.500, +/R604X = 0.480, R604X/R604X = 0.460; ****P < 0.0001, ***P = 0.0002, ***P = 0.0008 (DF = 1525) (F(DFn,DFd) F(2,1525) = 29.1, P < 0.0001). (E) Sciatic nerve axon myelin thickness (+/+ = 1.50 μm, +/R604X = 1.54 μm, R604X/R604X = 1.31 μm; ****P < 0.0001, (DF = 1524) (F(DFn,DFd) F(2,1524) = 45.2, P < 0.0001). (F) Number of myelinated fibers/mouse section (+/+ = 204, +/R604X = 199, R604X/R604X = 124; ***P = 0.0004, ***P = 0.0007, (DF = 12) (F(DFn,DFd) F(2,12) = 18.4, P = 0.0002). (G) Axon area frequency distribution. Representative images of axons of the sciatic nerve of (H) wild type (WT), (I) Ighmbp2^+/R604X and (J) Ighmbp2^R604X/R604X mice. Five mice from each genotype (15 total mice) were analyzed with ninety-three to one hundred six axons analyzed per mouse. Statistical analyses: one-way ANOVA with Tukey’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.10. Neuromuscular junction innervation of the forelimb and hindlimb muscles was altered in Ighmbp2^R604X/R604X mice

The average lifespan of Ighmbp2^R604X/R604X mice was six days. To determine whether there was significant forelimb and hindlimb pathology by P6, we examined NMJ innervation and muscle composition in forelimb (tricep) or hindlimb (gastrocnemius (gastroc), tibialis anterior (TA) muscles (Figs. 9–12, Supplementary Figs. 1–2). Significant differences were observed in the NMJ innervation of the TA muscle of Ighmbp2^R604X/R604X mice when compared to wild type mice (mean fully innervated endplates +/+ = 99.4 %, +/R604X = 99.3 %, R604X/R604X = 40.8 %, P < 0.0001) (mean fully denervated endplates +/+ = 0.3 %, +/R604X = 0.4 %, R604X/R604X = 36.0 %, P < 0.0001) (Fig. 9A, D). Significantly increased fully denervated endplates of the hindlimb gastrocnemius muscle was also observed in Ighmbp2^R604X/R604X mice (mean fully innervated endplates +/+ = 98.0 %, +/R604X = 98.6 %, R604X/R604X = 49.7 %, P < 0.0001) (mean fully denervated endplates +/+ = 1.2 %, +/R604X = 0.6 %, R604X/R604X = 31.2 %, P < 0.0001) (Fig. 9B, D). While the forelimb tricep muscle in Ighmbp2^R604X/R604X mice showed significantly increased percentage of fully denervated endplates when compared to wild type mice it was less than either hindlimb muscle (mean fully innervated endplates +/+ = 90.5 %, +/R604X = 96.3 %, R604X/R604X = 69.2 %, **P = 0.0019, ***P = 0.0001) (Fig. 9C–D). These results suggest that forelimb and hindlimb motor function would be impacted by the significant reduction in fully innervated endplates and is consistent with the sciatic nerve pathology.

Fig. 9.

Hindlimb muscles TA and gastrocnemius and to an extent the forelimb tricep showed NMJ denervation in Ighmbp2^R604X/R604X mice. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) NMJ innervation status of hindlimb muscle tibialis anterior (TA). The percent of fully innervated endplates (+/+ = 99.4, +/R604X = 99.3, R604X/R604X = 40.8, P < 0.0001). The percent of partially innervated endplates (+/+ = 0.3, +/R604X = 0.3, R604X/R604X = 23.2, P = 0.0004–0.0005). The percent of fully denervated endplates (+/+ = 0.3, +/R604X = 0.3, R604X/R604X = 36.0, P < 0.0001, DF = 36) (F(DFn, DFd) interaction F(4,36) = 59.3, P < 0.0001; row factor F(2,36) = 332.7, P < 0.0001; column factor F(2,36) = 7.8e-20, P > 0.9999). (B) NMJ innervation status of hindlimb muscle gastrocnemius. The percent of fully innervated endplates (+/+ = 98.0, +/R604X = 98.6, R604X/R604X = 49.7, P < 0.0001). The percent of partially innervated endplates (+/+ = 0.8, +/R604X = 0.9, R604X/R604X = 19.1, P = 0.0012–0.0013). The percent of fully denervated endplates (+/+ = 1.2, +/R604X = 0.5, R604X/R604X = 31.2, P < 0.0001, DF = 36) (F(DFn,DFd) interaction F(4,36) = 54.1, P < 0.0001; row factor F(2,36) = 480.8, P < 0.0001; column factor F(2,36) = 1.8e-19, P > 0.9999). (C) NMJ innervation status of forelimb muscle tricep. The percent of fully innervated endplates (+/+ = 90.5, +/R604X = 96.3, R604X/R604X = 69.2, P = 0.0019, and P = 0.0001, respectively). The percent of partially innervated endplates (+/+ = 7.9, +/R604X = 2.8, R604X/R604X = 15.5). The percent of fully denervated endplates (+/+ = 1.6, +/R604X = 0.9, R604X/R604X = 15.3, P = 0.0425, DF = 36) (F(DFn,DFd) interaction F(4,36) = 9.4, P < 0.0001; row factor F(2,36) = 370.6, P < 0.0001; column factor F(2,36) = 9.7e-20, P > 0.9999). (D) Representative images of neuromuscular junctions (NMJ) of the TA, gastrocnemius and tricep. Green represents neurofilament heavy (NF-H) and synaptic vesicle 2 (SV2) immunostaining while red represents bungarotoxin 594 immunofluorescence (αBTX). Statistical analyses: two-way ANOVA with Tukey’s multiple comparisons. Five mice from each genotype were analyzed (15 total mice) with ninety-three to three hundred sixty-nine NMJ counted per mouse. Values are expressed as mean. FI = fully innervated, PI = partially innervated, FD = fully denervated, NMJ = neuromuscular junction, WT = wild type, MT = R604X/R604X, TA = tibialis anterior, DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 12.

Tricep muscle fiber size and composition were altered in Ighmbp2^R604X/R604X mice. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Tricep muscle fiber area (+/+ = 465 μm², +/R604X = 373 μm², R604X/R604X = 267 μm²; P < 0.0001, DF = 17,254) (F(DFn,DFd) F(2,17,254) = 870, P < 0.0001). (B) Tricep embryonic muscle fiber area (+/+ = 301 μm², +/R604X = 235 μm², R604X/R604X = 184 μm²; P < 0.0001, DF = 5073) (F(DFn,DFd) F (2,5073) = 108.1, P < 0.0001). (C) Tricep Type 1 muscle fiber area (+/+ = 324 μm², +/R604X = 250 μm², R604X/R604X = 280 μm²; P = 0.0018, +/+ and R604X/R604X; P = 0.0023, +/+ and +/R604X, DF = 616) (F(DFn,DFd) F(2,616) = 8.2, P = 0.0003). (D) Tricep Type 2 A muscle fiber area (+/+ = 177 μm², +/R604X = 168 μm², R604X/R604X = 164 μm²) (F(DFn,DFd) F(2,648) = 2.3, P = 0.1024). (E) Tricep Type 2B muscle fiber area (+/+ = 614 μm², +/R604X = 436 μm², R604X/R604X = 588 μm²; P < 0.0001, +/+ and +/R604X; P < 0.0001, +/R604X and R604X/R604X, DF = 6068) (F(DFn,DFd) F(2,6068) = 240.3, P < 0.0001). (F) Tricep non-labelled (representing embryonic and Type X) muscle fiber area (+/+ = 359 μm², +/R604X = 296 μm², R604X/R604X = 268 μm²; P < 0.0001, DF = 9146) (F (DFn,DFd) F(2,9196) = 167.2, P < 0.0001). (G) Percentage of all cells expressing a given muscle fiber type in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice (embryonic +/+ = 6, +/R604X = 12, R604X/R604X = 35; P < 0.0001, +/+ and R604X/R604X; P = 0.0004, +/R604X and R604X/R604X; DF = 11) (Type 2B +/+ = 49, +/R604X = 62, R604X/R604X = 2; P < 0.0001, P = 0.0117, +/+ and +/R604X) (non-labelled +/+ = 37, +/R604X = 28, R604X/R604X = 86; P < 0.0001, DF = 88). Four to five mice from each genotype were analyzed (14 mice total). Statistical analyses: one-way ANOVA with Dunnett’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.11. Ighmbp2^R604X/R604X forelimb and hindlimb muscles showed reduced size and muscle fiber composition

To determine the extent that forelimb and hindlimb muscles showed disease pathology in Ighmbp2^R604X/R604X mice, the tricep, tibialis anterior (TA) and gastrocnemius muscles were examined (Figs. 10–12, Supplementary Figs. 1–2). We chose to examine these three muscles not only because two are hindlimb (gastrocnemius, TA) and one is forelimb (tricep) but also because of the differences in muscle function and muscle fiber type composition identified in the adult mouse. The TA has a high percentage of fast-twitch 2B/2× muscle fibers and a low percentage of Type 1 muscle fibers. The tricep is a mixed fast twitch fiber muscle with a low percentage of Type 1 fibers. The gastrocnemius is a mixed muscle with fast twitch and slow twitch muscle fibers. There was a significant percentage of fully denervated endplates observed in Ighmbp2^R604X/R604X mice with the hindlimb muscles altered more than the tricep muscle (Fig. 9). In Ighmbp2^R604X/R604X mice, there was significant reduction in TA muscle fiber area when compared to wild type and Ighmbp2^+/R604X mice (Fig. 10A). When TA muscle fiber types were examined in Ighmbp2^R604X/R604X mice, there were significant reductions in area of all muscle fiber types except embryonic muscle fibers that were larger in size (Fig. 10B–F). Interestingly, in Ighmbp2^+/R604X mice TA embryonic, Type 2B and non-labelled muscle fibers were also statistically different in size from wild type mice (Fig. 10B, E–F). When the overall TA muscle fiber type composition was analyzed, Ighmbp2^R604X/R604X mice demonstrated increased percentage of TA embryonic muscle fibers when compared to wild type and Ighmbp2^+/R604X mice (mean +/+ = 32.2 %, +/R604X = 34.7 %, R604X/R604X = 65.6 %, P = 0.0002 and P = 0.0005). Additionally, there were significant changes in TA muscle Type 2B composition in Ighmbp2^R604X/R604X mice (mean +/+ = 45.4 %, +/R604X = 27.2 %, R604X/R604X = 7.8 %, P < 0.0001) showing a reduction of the faster and larger muscle fiber types (Fig. 10G). These shifts suggest a delay in maturation to large, fast twitch glycolytic muscle fibers, or a preferential loss of fast-twitch Type 2B fibers in the TA (mean WT emb = 32.2 %, Type 1 = 9.3 %, Type 2 A = 3.8 %, Type 2B = 45.4 %, non-labelled = 35.8 %; R604X/R604X emb = 65.6 %, Type 1 = 9.7 %, Type 2 A = 10.1 %, Type 2B = 7.8 %, non-labelled = 69.3 %). The increased non-labelled composition in Ighmbp2^R604X/R604X mice (representing embryonic and Type 2× fibers) likely reflects increased embryonic muscle fibers (mean +/+ = 35.8 %, +/R604X = 54.7 %, R604X/R604X = 69.3 %, P < 0.0001).

Fig. 10.

TA muscle fiber size and types were altered in Ighmbp2^R604X/R604X mice. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) TA total muscle fiber area (+/+ = 393 μm², +/R604X = 404 μm², R604X/R604X = 332 μm², P < 0.0001, DF = 20,509) (F(DFn,DFd) F(2,2050) = 165.9, P < 0.0001). (B) TA embryonic muscle fiber area (+/+ = 253 μm², +/R604X = 286 μm², R604X/R604X = 306 μm²; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/+ and +/R604X; P = 0.0001, +/R604X and R604X/R604X, DF = 10,998) (F(DFn,DFd) F(2,10,998) = 54.1, P < 0.0001). (C) TA Type 1 muscle fiber area (+/+ = 373 μm², +/R604X = 400 μm², R604X/R604X = 311 μm²; P < 0.0001, P < 0.0001, DF = 1596) (F(DFn,DFd) F(2,1596) = 37.8, P < 0.0001). (D) TA Type 2 A muscle fiber area (+/+ = 296 μm², +/R604X = 298 μm², R604X/R604X = 183 μm²; P < 0.0001, DF = 1333) (F(DFn,DFd) F(2,1333) = 212, P < 0.0001). (E) TA Type 2B muscle fiber area (+/+ = 570 μm², +/R604X = 753 μm², R604X/R604X = 534 μm²; P < 0.0001, +/+ and +/R604X; P < 0.0001, +/R604X and R604X/R604X, P = 0.0252, +/+ and R604X/R604X, DF = 3307) (F(DFn,DFd) F(2,3307) = 159.1, P < 0.0001). (F) TA non-labelled (representing embryonic and Type X) muscle fiber area (+/+ = 402 μm², +/R604X = 469 μm², R604X/R604X = 341 μm²; P < 0.0001, +/+ and +/R604X; P < 0.0001, +/R604X and R604X/R604X; P < 0.0001, +/+ and R604X/R604X, DF = 10,295) (F(DFn,DFd) F(2,10,295) = 293.1, P < 0.0001). (G) Percentage of all cells expressing a given muscle fiber type in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice (embryonic +/+ = 32, +/R604X = 35, R604X/R604X = 66; P = 0.0002, +/+ and R604X/R604X; P = 0.0005, +/R604X and R604X/R604X, DF = 12) (Type 2B +/+ = 45, +/R604X = 27, R604X/R604X = 8, P < 0.0001.) (non-labelled +/+ = 36, +/R604X = 55, R604X/R604X = 69, P < 0.0001). Five mice from each genotype were analyzed (15 mice total). Statistical analyses: one-way ANOVA with Dunnett’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

When the gastrocnemius muscle was examined in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice, there were significant reductions in muscle fiber area across all fiber types except Type 1 where there were no differences between the genotypes (Fig. 11, Supplementary Fig. 2). Similar to the TA, there were differences between wild type and Ighmbp2^+/R604X mice in muscle fiber type area except in Type 1 fibers. Interestingly, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice showed similar area in embryonic, Type 1 and Type 2 A muscle fibers (Fig. 11A–D). When the overall gastrocnemius muscle fiber type composition was analyzed, unlike the TA, Ighmbp2^R604X/R604X mice showed no significant differences from wild type mice in embryonic muscle fiber type (mean +/+ = 62.5 %, +/R604X = 47.1 %, R604X/R604X = 58.9 %) (Fig. 11G). While not statistically significant, there was a ~ 50 % decrease in the mean percentage of Type 2 A and Type 2B muscle fibers in Ighmbp2^R604X/R604X mice when compared to wild type mice (mean WT emb = 62.5 %, Type 1 = 3.1 %, Type 2 A = 16.3 %, Type 2B = 30.6 %, non-labelled = 23.7 %; R604X/R604X emb = 58.9 %, Type 1 = 7.7 %, Type 2 A = 8.4 %, Type 2B = 15.2 %, non-labelled = 49.4 %) (Fig. 11G).

Fig. 11.

Ighmbp2^R604X/R604X mice showed reduced gastrocnemius muscle fiber size in all fibers but type I. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Gastrocnemius muscle fiber area (+/+ = 388 μm², +/R604X = 273 μm², R604X/R604X = 274 μm²; P < 0.0001, DF14667) (F(DFn, DFd) F(2,14,667) = 577.2, P < 0.0001). (B) Gastrocnemius embryonic muscle fiber area (+/+ = 324 μm², +/R604X = 241 μm², R604X/R604X = 236 μm²; P < 0.0001, DF = 8161) (F(DFn,DFd) F(2,8161) = 374.6, P < 0.0001). (C) Gastrocnemius Type 1 muscle fiber area (+/+ = 323 μm², +/R604X = 302 μm², R604X/R604X = 305 μm²) (F(DFn,DFd) F(2,640) = 0.9, P = 0.3929). (D) Gastrocnemius Type 2 A muscle fiber area (+/+ = 342 μm², +/R604X = 211 μm², R604X/R604X = 227 μm²; P = 0.0001, DF = 1767) (F(DFn,DFd) F(2,1767) = 121.4, P < 0.0001). (E) Gastrocnemius Type 2B muscle fiber area (+/+ = 501 μm², +/R604X = 348 μm², R604X/R604X = 299 μm²; P < 0.0001, DF = 3602) (F(DFn,DFd) F(2,3602) = 298, P < 0.0001). (F) Gastrocnemius non-labelled (representing embryonic and Type X) muscle fiber area (+/+ = 363 μm², +/R604X = 277 μm², R604X/R604X = 292 μm²; P < 0.0001, P = 0.0155, +/R604X and R604X/R604X; DF = 5201) (F (DFn,DFd) F(2,5201) = 84.2, P < 0.0001). (G) Percentage of all cells expressing a given muscle fiber type in wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice (embryonic +/+ = 63, +/R604X = 47, R604X/R604X = 59) (non-labelled +/+ = 24, +/R604X = 30, R604X/R604X = 49; P = 0.0004 +/+ and R604X/R604X; P = 0.0133 +/R604X and R604X/R604X). Five mice from each genotype were analyzed (15 mice total). Statistical analyses: one-way ANOVA with Dunnett’s multiple comparisons. Values are expressed as mean. DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

When tricep muscle fiber types were examined, there was a significant reduction in Ighmbp2^R604X/R604X muscle fiber area found in all muscle fiber types except in Type 2A and 2B when compared to wild type mice (Fig. 12, Supplementary Fig. 2). As well, there were clear differences in muscle fiber type area between wild type and Ighmbp2^+/R604X mice (Fig. 12B–F). Interestingly, consistent with the TA, there were differences in muscle fiber type composition between wild type and Ighmbp2^R604X/R604X mice in embryonic, Type 2B and non-labelled fibers with a significant reduction in Type 2B fibers and a significant increase in embryonic and non-labelled fibers (mean R604X/R604X emb = 34.6 %, Type 1 = 6.7 %, Type 2 A = 5.0 %, Type 2B = 1.6 %, non-labelled = 85.6 %; WT emb = 6.4 %, Type 1 = 3.1 %, Type 2 A = 4.4 %, Type 2B = 49.3 %, non-labelled = 36.5 %) (Fig. 12G). Together, these results show that there are similarities and differences between these muscles as it pertains to muscle fiber size and composition that are a result of the Ighmbp2-R604X mutation.

3.12. Electrophysiology of Ighmbp2^R604X/R604X mice was consistent with pathology of sciatic nerve, NMJ denervation and hindlimb muscles

To determine whether functional deficits were present, electrophysiological parameters were quantitatively measured with relative stimulation of the sciatic nerve and response of the gastrocnemius muscle (Fig. 13). The five electrophysiological parameters of motor unit physiology including distal latency, negative area, peak to peak compound muscle action potential amplitude (P–P CMAP), motor unit number estimation (MUNE) and repetitive nerve stimulation (RNS) were quantitatively measured from the gastrocnemius following sciatic nerve stimulation (Fig. 13). Distal latency measures the time from stimulation to the onset of summated muscle depolarization (CMAP) and reflects action potential propagation as well as neurotransmission. CMAP negative peak area and amplitude (assessed peak-to-peak) are measurements of summated muscle fiber excitation attributable to functional integrity of motor axon, NMJ transmission, and muscle excitation. MUNE is a calculated estimate of the number of motor units that innervate a muscle or group of muscles. RNS is an index of the ability of a train of nerve stimulations to reliably excite muscle fibers and thus provides insight about NMJ transmission. There were significant differences across all parameters when comparing wild type versus Ighmbp2^R604X/R604X mice (Fig. 13A–I). There were no statistical differences between wild type and Ighmbp2^+/R604X mice (Fig. 13). The prolonged distal latency in Ighmbp2^R604X/R604X mice was consistent with the significant pathology observed in the sciatic nerve including reduced area, myelin thickness and number of myelinated axon fibers. The reduced negative area values and CMAP amplitudes aligned with the findings on sciatic nerve pathological assessment and are consistent the pattern expected in patients with disorders associated with of motor axonal loss and denervation of muscle. On the RNS studies, trains of stimulations resulted in greater CMAP decrement in Ighmbp2^R604X/R604X mice (~13 % amplitude reduction between WT and R604X/R604X) consistent with increased failure of NMJ transmission.

Fig. 13.

Prolonged distal latency and reduced CMAP in Ighmbp2^R604X/R604X mice were consistent with pathology of sciatic nerve, NMJ denervation and hindlimb muscles. Wild type (black), Ighmbp2^+/R604X (orange), and Ighmbp2^R604X/R604X (blue). (A) Distal latency (+/+ = 2.355 milliseconds, +/R604X = 2.098 milliseconds, R604X/R604X = 3.150 milliseconds; P = 0.0006, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X) (F(DFn,DFd) F(2,26) = 15.87, P < 0.0001). (B) Negative area (+/+ = 5.836, +/R604X = 6.500, R604X/R604X = 3.125; P = 0.0025, +/+ and R604X/R604X; P = 0.0006, +/R604X and R604X/R604X) (F(DFn,DFd) F(2,27) = 11.09, P = 0.0003). (C) P–P CMAP amplitude (+/+ = 6.818 mV, +/R604X = 7.488 mV, R604X/R604X = 2.971 mV; P < 0.0001, +/+ and R604X/R604X; P < 0.0001, +/R604X and R604X/R604X) (F(DFn,DFd) F(2,27) = 21.78, P < 0.0001). (D) MUNE (+/+ = 42.89, +/R604X = 38.17, R604X/R604X = 18.13; P = 0.0019, +/+ and R604X/R604X, P = 0.0218, +/R604X and R604X/R604X) (F(DFn,DFd) F(2,20) = 8.737, P = 0.0019). (E) RNS (+/+ = 8.053, +/R604X = 4.540, R604X/R604X = 25.32; P = 0.0021, +/+ and R604X/R604X, P = 0.0015, +/R604X and R604X/R604X) (F(DFn,DFd) F(2,17) = 11.02, P = 0.0009). (F) compound muscle action potential responses diagram. (G) action potential trace for wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice. (H) RNS stimuli trace for wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice. (I) Superimposed CMAP and incremental responses during MUNE assessment for wild type, Ighmbp2^+/R604X and Ighmbp2^R604X/R604X mice. Statistical analyses: one-way ANOVA with Tukey’s multiple comparisons. Five to eleven mice from each genotype were analyzed (20–27 mice total). Values are expressed as mean. ms = milliseconds, mV = millivolts, P-P = peak to peak, CMAP = compound muscle action potential, O-P = onset to negative peak, MUNE = motor unit number estimation, RNS = repetitive nerve stimulation, DF = degrees of freedom. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.13. ssAAV9-IGHMBP2 gene therapy has minimal impact on survival or fitness before death ensues

The rapid decline in survival and fitness of Ighmbp2^R604X/R604X mice suggested that we would not achieve robust expression of the ssAAV9-IGHMBP2 vector to observe significant therapeutic changes; nonetheless, we measured survival, weight and presence of a milk spot in wild type, Ighmbp2+/R604X, Ighmbp2R604X/R604X, Ighmbp2R604X/R604X + ssAAV9-IGHMBP2 and Ighmbp2^R604X/R604X + ssAAV9-IGHMBP2 + scAAV9-Abt1 mice. Mean survival was increased three days in Ighmbp2^R604X/R604X + ssAAV9-IGHMBP2 mice and one day in Ighmbp2^R604X/R604X + ssAAV9-IGHMBP2 + scAAV9-Abt1 mice over Ighmbp2^R604X/R604X uninjected controls (Supplementary Fig. 3A). Weight did not see significant changes between uninjected and injected Ighmbp2^R604X/R604X mice; however, Ighmbp2^R604X/R604X + ssAAV9-IGHMBP2 mice maintained weight for several days longer prior to weight loss (Supplementary Fig. 3B). When the milk spot was scored there was not a significant difference between uninjected and injected Ighmbp2^R604X/R604X mice; however, consistent with weight, the presence of a milk spot was maintained longer in Ighmbp2^R604X/R604X + ssAAV9-IGHMBP2 mice than uninjected controls (Supplementary Fig. 3C). In none of these experiments was expression of scAAV9-Abt1 able to overcome disease within such a short window of time (Supplementary Fig. 3A–C). When the presence of the ssAAV9-IGHMBP2 vector was analyzed by PCR in the lumbar region of the spinal cord, ssAAV9-IGHMBP2 vector was detected only in spinal cord tissue injected with the vector (Supplementary Fig. 3D). Expression of the ssAAV9-IGHMBP2 vector was measured by qPCR showing that expression of the ssAAV9-IGHMBP2 vector was present (Supplementary Fig. 3E). Importantly, these experiments shed insight into how different Ighmbp2 mutations impact disease severity and the ability of gene therapy to modify disease.

4. Discussion

Disease onset and clinical symptoms vary significantly for patients with the compound heterozygous IGHMBP2-R605X mutation from early onset SMARD1 to a milder CMT2S (Cottenie et al., 2014; Grohmann et al., 2003; Guenther et al., 2007). To understand how the IGHMBP2-R605X mutation independently impacts disease, we generated the orthologous mutation in mice (Ighmbp2-R604X) and found that Ighmbp2^R604X/R604X mice present with the most severe symptoms associated with SMARD1: shortened lifespan, failure to thrive, respiratory distress, reduced suckling and motor function deficits. Interestingly, at birth Ighmbp2^R604X/R604X mice were able to suckle, based on the presence of a milk spot; however, the milk spot quickly diminished suggesting that the ability to suckle became impaired, consistent with SMARD1 disease in humans. Aspiration is a clinical symptom of SMARD1 patients that exacerbates poor respiration and leads to respiratory infections, increased critical care and death. The Ighmbp2^R604X/R604X mice are the first to demonstrate this functional deficit. Further studies will focus on examining the SMARD1 disease symptoms of suckling and swallowing difficulties to understand how any changes could impact respiration, nutrition and survival. We found that P0 administration of the previously developed and highly effective ssAAV9-IGHMBP2 gene therapy vector prolonged survival a few days. This could be due to the severity of the disease, and/or the expression kinetics of a single-stranded AAV vector relative to a double-stranded/self-complementary vector. This preclinical model, as well as the Ighmbp2^D564N/D564N model, shed light on the challenges that may be faced as it concerns gene therapy in SMARD1 patients as the cellular context due to specific mutations may be more challenging to overcome than with reduced levels of wild type protein as seen in the C57BL/6 J-Ighmbp2^nmd/nmd and FVB-Ighmbp2^nmd/nmd models. Adding to the complexity of the disease, SMARD1/CMT2S are defined by many different mutations throughout IGHMBP2 and SMARD1/CMT2S patients often present with compound heterozygous mutations where two mutant proteins are present within a cell. There is an ongoing clinical trial using ssAAV9-IGHMBP2 (NCT05152823); however, no published results have been produced at this time.

SMARD1 is a disease associated with severe respiratory distress. P2 Ighmbp2^R604X/R604X mice demonstrated significant respiratory changes quantitated from eight parameters using plethysmography. Ighmbp2^D564N/D564N mice also demonstrated significant respiratory changes with decreased frequency and increased tidal volume and an inability to respond to conditions of hypoxia + hypercapnia suggesting deficits in chemoreception (Smith et al., 2022). Ighmbp2^R604X/R604X had decreased frequency and trended towards decreased tidal volume with no response to hypercapnia nor hypoxia + hypercapnia conditions suggesting impairment of chemoreception as well. The lack of a chemoreception response likely leads to an imbalance of blood gases and increased blood pH, adding to the severity of the disease. Abnormal plethysmography and lung pathology supported impairment of air flow in Ighmbp2^R604X/R604X mice, further contributing to respiratory distress. Consistent with our studies, IGHMBP2^L362del and IGHMBP2^L495del mouse models displayed irregular breath rates as measured by a PiezoSleep system (Holbrook et al., 2024). Changes in the phrenic axons and diaphragm muscle fibers likely contribute significantly to the respiratory changes observed in Ighmbp2^R604X/R604X mice. Smaller axon fibers with reduced myelin likely reduce the speed of transmission and the efficiency. Consistent with Ighmbp2^D564N/D564N, Ighmbp2^D564N/H922Y, Ighmbp2^nmd2J/nmd2J and IGHMBP2^L362del mice, there was not substantial NMJ denervation of the diaphragm muscle in Ighmbp2^R604X/R604X mice suggesting NMJ denervation is not a predictor of respiratory distress in SMARD1 mice (Holbrook et al., 2024; Ricardez Hernandez et al., 2025; Smith et al., 2022). While there were no significant changes in the muscle fiber type composition of the diaphragm, all muscle fiber types were significantly smaller, likely contributing towards diaphragm muscle weakness and impaired respiration. These studies are consistent with the thinner diaphragms reported in Ighmbp2^nmd2J/nmd2J and IGHMBP2^L362del mice (Holbrook et al., 2024). These studies suggest that there are multiple pathological changes in Ighmbp2^R604X/R604X mice that contribute to the respiratory distress and ultimate survival of these SMARD1 mice. Furthermore, our results are consistent with the clinical symptoms associated with severe SMARD1 patients and demonstrate the utility of these mouse models for understanding the underlying cellular changes associated with IGHMBP2 mutations.

During this early postnatal period in the wild type mouse, the NMJ is undergoing maturation and remodeling from polyneuronal innervation to mono innervation and there is rapid growth and maturation of muscle fibers with significant increases in muscle fiber size (hypertrophy) and muscle fiber type specification. Ighmbp2^R604X/R604X mice showed significant electrophysiological changes in all parameters analyzed suggesting early gross motor function deficits. Ighmbp2^R604X/R604X mice electrophysiology was consistent with the reduced sciatic axon myelin thickness and smaller axon fibers impairing transmission time and intensity. Unlike the diaphragm, Ighmbp2^R604X/R604X forelimb and the hindlimb muscles were severely impacted with reduced NMJ innervation, abnormal pathology and differences in muscle fiber composition when compared to age-matched wild type mice suggesting that either developmental delays in myofiber maturation and/or failure of myofiber innervation may be occurring. These results are consistent with those observed in the IGHMBP2^L362del and IGHMBP2^L495del mice that reported significant axonal degeneration of hindlimb axons, smaller muscle fiber size and NMJ denervation of hindlimb muscles (Holbrook et al., 2024). Similar results were also observed in Ighmbp2^D564N/D564N mice (Smith et al., 2022). In the SMNΔ7 mouse model, which has a life span of ~14 days and represents severe SMA, the TA, gastrocnemius, and diaphragm showed minimal NMJ denervation at P1, P5, P9 or P13; however, there was impaired muscle fiber growth after P5 with increased MyHC neonatal (Myh8) and reduced Type 2B (Myh10) isoforms (Kong et al., 2009). Initially, CMAP and MUNE responses were similar between SMNΔ7 and control mice; however, these responses became significantly reduced in SMNΔ7 mice in correlation with the onset of overt motor phenotypes (Arnold et al., 2014). Together, the reduced muscle fiber size and changes in muscle fiber composition in Ighmbp2^R604X/R604X mice are consistent with the electrophysiology data and suggest ongoing deficits in the overall function of these muscles.

The Ighmbp2^R604X/R604X mouse model presents with the most severe SMARD1 clinical symptoms, displaying lung pathology, the loss of the ability to suckle, and aspiration. It will be important to examine additional severe SMARD1 mouse models to determine whether similar phenotypes are present. These studies suggest that Ighmbp2^R604X/R604X mice likely succumb to death due to severe respiratory distress, and reduced suckle (nutrition), clinical symptoms associated with SMARD1 patients.

Supplementary Material

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.nbd.2025.107199.

Data availability

Data will be made available on request.