Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2025 Dec 9;16:2020. doi: 10.1038/s41598-025-31746-z

Effect of HSPA 8 on the biological function of NPC cells and its mechanism

Sufan Guo 1, Shijie Liang 2, Yanqiang Hou 1,✉, Zheng Yang 2,✉
PMCID: PMC12808657  PMID: 41361578

Abstract

Nasopharyngeal carcinoma (NPC) occurs at the lateral and top wall of the nasopharyngeal cavity and is the most prevalent malignant tumour of the otorhinolaryngology. Heat shock protein family A number 8 (HSPA8, also known as HSC70) is a member of the Heat Shock Protein 70 (HSP70) family, which is closely linked to the cellular response to stress and the progression of cancer. In this paper, we mainly studied the expression of HSPA 8 in NPC, the influence on the biological function of NPC cells and the preliminary mechanism. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) was used to verify the expression of HSPA8 in NPC cells. NPC cell models with HSPA8 overexpression and knockdown were successfully constructed using lentiviral transfection. CCK-8 assay was used to assess the effect of HSPA8 on the growth and proliferation of NPA cells; the role of HSPA8 on the migration and invasion ability of cells was explored by cell scratch assay and Transwell migration and invasion assay; in addition, flow cytometry was used to analyse the effect of HSPA8 on the apoptosis and cell cycle of NPC cells. High-throughput transcriptome sequencing (RNA-seq) was utilised. Differential genes were screened and the functions and pathways involved in these differential genes were further resolved. To lay the foundation for subsequent in-depth exploration of the effects of HSPA8-mediated autophagy (chaperone-mediated autophagy, CMA) on NPC progression. The results showed that HSPA8 expression was elevated in NPC cells. In addition, silencing HSPA8 expression inhibited NPC proliferation, migration and invasion, enhanced apoptosis and significantly blocked NPC cells in G2/M phase. Overexpression of HSPA8 had the opposite effect. Analysis of the sequencing results suggests that HSPA8 may regulate NPC development by mediating CMA. In conclusion, HSPA8 may be a pro-oncogenic factor that plays a key role in NPC development and is a new therapeutic target or prognostic indicator for nasopharyngeal carcinoma.

Keywords: Nasopharyngeal carcinoma, HSPA8, CMA, Biological function

Subject terms: Cancer, Molecular biology, Medical research, Oncology, Pathogenesis

Introduction

Nasopharyngeal carcinoma (NPC) originates from squamous cell carcinoma of the nasopharyngeal epithelium, which is one of the highly prevalent malignancies and the most common type of ear, nose, and throat cancer1.The geographic distribution of NPC is heterogeneous, as approximately 80% of the patients come from China and Southeast Asia2.Unfortunately, due to its insidious location and ambiguous clinical manifestations, most of the patients are diagnosed at an advanced stage. The local recurrence and distant metastasis often occur after conventional treatment3. Therefore, it is particularly important to seek molecular markers of NPC with predictive value for prognosis.

HSPA8(Heat shock protein family A number 8) represents a constitutively expressed homologue of the HSP70(Heat shock protein family 70) family. HSPA8 functions as a molecular chaperone and is also a class of structurally expressed proteins that play an important role in cellular stress responses4. It has been found that HSPA8 is overexpressed in a wide variety of cancer cells, which is essential for the growth of cancerous cells5. In addition, the deletion of HSPA8 can inhibit solid tumour cell growth, inducing apoptosis and cell cycle arrest4. It plays a central role in many cellular processes and plays a decisive role in the regulation of chaperone-mediated autophagy (CMA)6. However, the role of HSPA8 expression in NPC remains poorly understood.

Therefore, the aim of this study was to investigate the biological behaviour of HSPA8 in NPC by silencing and overexpressing the levels of HSPA8 in NPC cells. Our study directly suggests that HSPA8, as a tumour-promoting gene, may play an important role in NPC cells development and progression. It gives us a deeper understanding of the role of HSPA8 in NPC and provides us with new prognostic biomarkers.

Materials and methods

Cell culture

Human nasopharyngeal carcinoma cell line (HK1,5–8 F) and human normal nasopharyngeal epithelial cell line (NP69) were obtained from the Otolaryngology Laboratory of Guangxi Medical University, Nanning, China. These cells were cultured in a mixture containing 89% RPMI-1640,10% fetal bovine serum (FBS), and 1% penicillin-streptomycin mixture in a humidified incubator at 37 °C and 5% CO2 .

Cell transfection

Lentivirus silenced the expression of HK1 and 5–8 F (LV-HSPA8-RNAi) and control vector (LV-CON313), while lentivirus overexpressed HK1 and 5–8 F (LV-HSPA8) and control vector (LV-CON522). All were purchased from GeneChem (Shanghai, China). According to the manufacturer’s instructions, we found that the optimal conditions for infection were an inoculated cell density of 4 × 104/ml and a lentivirus-infected cell MOI of 50. We inoculated the cells into a 6-well plate, and then added the amount of virus for infection according to the cell MOI and the viral titer. After 72 h of transfection, we observed under an inverted fluorescence microscope (Olympus, Japan), and more than 80% fluorescence efficiency of the cells could be used for subsequent experiments. Subsequently, the stably transfected cells were screened with puromycin for 14 days. Successful transfection of HK1 and 5–8 F was determined by qRT-PCR.

Quantitative Real-Time fluorescence PCR (qRT-PCR)

Total RNA of the cells was obtained according to the RNA extraction instructions of Trizol reagent (Takara). For cDNA synthesis, PrimeScript™ RT kit with gDNA removal (Takara) was used. The expression of mRNA was verified by applying a 7500 real-time fluorescent quantitative PCR system using SYBR Green PCR premix (Takara). The qRT-PCR reactions were performed with the following primer sequences: HSPA8-F: ACTCCAAGCTATGTCGCCTT; HSPA8-R: TGGCATCAAAAACTGTGTTGG; GAPDH-F: CAGGAGGCATTGCTGATGAT; and GAPDH-R: GAAGGCTGGGGGCTCATTT.

Fold change (relative expression) = 2-ΔΔCt.

Cell counting kit-8 (CCK-8) assay

The CCK-8 assay was carried out according to the instruction. Cells were diluted to 2 × 104/ml and inoculated in 96-well plates at 100 µl/well; 5 wells were set up in parallel for each group of cells, and then 10 µl/well of CCK-8 reagent was added, the optical density (OD) value was detected at 0 h, 24 h, 48 h and 72 h under the absorbance of 450 nm. The assay was repeated for 3 times.

Cell migration and invasion assays

For cell wound healing assay, prepared cell suspensions were inoculated into 6-well plates and incubated in an incubator at 37 °C, 5% CO2. After ensuring the cells have grown to a single layer with approximately 90% confluence, make a scratch with a pipette tip. Then replace the used medium with FBS-free 1640, the distance between the scratched areas was recorded by Olympus microscope at 0 h and recorded as D0. After 24 h, the distance between the scratched areas was acquired from the same location and recorded as D24. The experiment was repeated three times, and the rate of cell scratch migration = (D0 - D24)/ D0 × 100%.

Cell migration was tested by Transwell migration assay. Cells were prepared about 3 × 104 cells were harvested in 200 µl FBS-free medium and seeded into the upper chamber. Complete medium containing 10% FBS was added to the lower chamber. After 48 h of incubation, cells migrating to the lower chamber were fixed with 4% paraformaldehyde for 30 min then stained with 1% crystal violet for 30 min. The number of cells migrating to the lower chamber was photographed using an inverted fluorescence microscope.

The Transwell invasion assay was consistent with the migration assay, but differed in that the upper chamber of the transwell invasion assay was covered with matrix glue matrix. The ratio of complete medium without FBS and matrix glue was 16 : 1.

Analyses of cell apoptosis and cell cycle

Logarithmic growth phase cells (including cells in culture supernatant) were collected, cells were washed by centrifugation with pre-cooled PBS, and supernatant was discarded after centrifugation. Cells were resuspended using 1×Binding Buffer to reach a concentration of 2 × 106 cells/mL. 5 µL of Annexin V-APC and 10 µL of 7-AAD ((AP105, MultiSciences) were added to each tube. After gentle vortexing and mixing, incubate for 5 min at room temperature away from light and then run the assay. The results were analysed using FlowJo software.

Cells were treated with 0.25% no EDTA trypsin to digest for cell cycle analysis. Further, they were stained with 1 ml DNA Staining solution and 10 µL permeabilisation solution for 30 min (CCS012, MultiSciences). Results were analyzed by flow cytometry (BD Biosciences, USA) and visualized by Modfit software (version 5.0).

Transcriptome sequencing

High-throughput transcriptome sequencing technology was used to sequence and analyse HSPA8 knockdown 5–8 F cells and their control cells (sequencing experiments were performed by Bioengineering (Shanghai) Co. Ltd.). To explore the changes in the mRNA expression levels of each gene in the 5–8 F-shHSPA8 cells compared to the 5–8 F-shCtrl group at the transcriptomic level and further performing a bioinformatics analysis based on the sequencing data.

Statistical analysis

Statistical Product and Service Solutions (SPSS, Chicago, USA) was employed for data analysis, with a significance level set at p < 0.05. Mean ± standard deviation were used to represent the measured data. The Student’s t-test was applied to determine the statistical disparities between the two groups under comparison.

Results

HSPA8 is highly expressed in NPC cells

The relative expression of HSPA8 in normal nasopharyngeal epithelial cell line NP69 and NPC cell lines HK1 and 5–8 F was detected by qRT-PCR(Fig. 1A). According to qRT-RCR, the mRNA levels of HSPA8 in 5–8 F, HK1 and NP69 were 1.875 ± 0.387, 1.551 ± 0.189, and 1, respectively. The results showed that the mRNA levels of 5–8 F(p = 0.017) and HK1(p = 0.007) cells were statistically significantly higher than those of NP69 cells.

Fig. 1.

Fig. 1

Open in a new tab

(A) Relative mRNA expression of HSPA8 in NP69, 5–8 F and HK1. (B) Stable overexpression of HSPA8 in 5–8 F and HK1 cells was verified by qRT-PCR (C) Stable knockdown of HSPA8 in 5–8 F was verified by qRT-PCR. The best interference effect was sh2 fragment. (D) Stable knockdown of HSPA8 in HK1 was verified by qRT-PCR.The best interference effect was sh3 fragment. *p < 0.05, **p < 0.01 and ***p < 0.001.

The successful cell transfection of HSPA8

We examined the expression of HSPA8 in transfected HK1 and 5–8 F cells using qRT-PCR. 5–8 F and HK1 cells transfected with the overexpressed fragment of HSPA8 were used as experimental groups and labelled OE (Overexpression), while cells transfected only with the null fragment were treated as the control group and labelled as NC (Negative Control)(Fig. 1B). The Knockdown group (qRT-PCR results showed that the sh3 fragment had the best interference effect on the knock-out efficiency of the two cells, and sh3 was selected for subsequent experiments) was labelled shHSPA8, and cells transfected only with the null fragment were regarded as controls and labelled shChrl(Fig. 1C and D). All these results indicate that we have successfully established stable transfection of HK1 and 5–8 F cells.

HSPA8 promotes NPC cell proliferation, migration and invasion

The cell wound healing assay was applied to determine the migratory role of HSPA8 in NPC cells(Fig. 2A). We found that when HSPA8 was silenced, the cell wound healing rate was significantly reduced compared to the control (p < 0.05). On the other hand, overexpression of HSPA8 showed a significant increase in wound healing rate compared to control (p < 0.05).

Fig. 2.

Fig. 2

Open in a new tab

(A) Comparison of relative scratch healing rates of cells in each group of 5–8 F and HK1 after knockdown and overexpressing HSPA8. (B) Comparison of the number of transmembrane cells in each group of 5–8 F and HK1 after knockdown and overexpressing HSPA8 by Transwell migration assays. *p < 0.05, **p < 0.01 and ***p < 0.001.

In addition, the Transwell migration assay showed a significant reduction in cell migration when silencing HSPA8 (p < 0.01), while overexpression of HSPA8 resulted in a significantly higher migration rate of NPC cells than controls (p < 0.001)(Fig. 2B).

We investigated the effect of HSPA8 on cell proliferation in vitro using CCK8(Fig. 3A). The results showed that knockdown of HSPA8 in stably transfected HK1 and 5–8 F cells significantly inhibited the proliferation of NPC cells in vitro(p < 0.05) and overexpression of HSPA8 promoted cell proliferation compared with controls(p < 0.05).

Fig. 3.

Fig. 3

Open in a new tab

(A) Comparison of CCK-8 OD450 in each group at each time point. (B) Comparison of the number of transmembrane cells in each group of 5–8 F and HK1 after knockdown and overexpressing HSPA8 by Transwell invasion assays. *p < 0.05, **p < 0.01 and ***p < 0.001.

Transwell invasion assays showed a significant reduction (p < 0.05) of cells in the lower chamber after silencing HSPA8 compared to controls. In addition to this, overexpression of HSPA8 was then able to promote the invasive ability of NPC cells(p < 0.05)(Fig. 3B).

HSPA8 affects NPC apoptosis and cell cycle

Apoptosis and cell cycle was assessed using Flow cytometry. Apoptosis showed that when silencing HSPA8, the apoptosis rate of 5–8 F and HK1 cells was significantly higher than that of controls (p < 0.05). In addition, the apoptosis rate of NPC cells was significantly reduced when overexpressing HSPA8 (p < 0.05)(Fig. 4A). Cell cycle experiments demonstrated that silencing HSPA8 expression in HK1-HSPA8-RNAi resulted in a significant arrest of cells in G2/M phase(Fig. 4B).

Fig. 4.

Fig. 4

Open in a new tab

(A) Effect of HSPA8 on apoptosis in each group of 5–8 F and HK1 after knockdown and overexpressing. (B) Effect of knockdown and overexpressing HSPA8 on NPC cell cycle. *p < 0.05, **p < 0.01 and ***p < 0.001.

Silencing HSPA8 alters the transcriptome profile of NPC cells

To further analyse the mechanism of HSPA8 action in NPC, 5–8 F cells silencing HSPA8 were used for transcriptome sequencing and the blank vector was transfected as a control. Compared with the control group, a total of 1393 DEGs were identified, of which 1028 DEGs were up-regulated and 365 were down-regulated (Fig. 5A). The clustering heatmap showed (Fig. 5B) that the expression patterns of DEGs were significantly different between the two groups. Interestingly, KEGG enrichment bubble plots showed that DEGs induced by HSPA8 silencing were enriched in CMA-related pathways, such as the p53 signalling pathway and the VEGF signalling pathway (Fig. 5C-D)7–9. A total of 478 CMA targets were retrieved from the GSEA (https://www.gsea-msigdb.org/gsea/index.jsp) database, and DEGs and CMA common targets 39 were obtained by Venny2.1 (Fig. 6). It is suggested that HSPA8 may play a role in NPC by mediating CMA, which lays the foundation for the group to further explore the specific mechanism in depth. In conclusion, HSPA8 silencing altered the transcriptome profile of 5–8 F cells.

Fig. 5.

Fig. 5

Open in a new tab

(A) volcano map. (B) Cluster heatmap. (C) enrichment analysis of DEPs. (D)KEGG enrichment analysis of DEPs.

Fig. 6.

Fig. 6

Open in a new tab

Venny graph.

Discussion

A large number of studies have shown that HSPA8 is abundantly expressed in cancers and promotes the proliferation of tumour cells. The high expression of HSPA8 gene is closely related to the degree of malignancy and poor prognosis of various tumors10. Wang Y et al. found that HSPA8 was up-regulated in 134 clinical hepatocellular carcinoma(HCC) tissues samples, which was positively correlated with the poor prognosis, and the IHC staining showed that HSPA8 was localized in both nuclei and cytoplasm of HCC cells. Hepatitis B virus (HBV) infection is one of the major drivers of HCC, and HSPA8 has been identified as a potential therapeutic target for HCC as a key host factor regulating HBV replication and ferroptosis in HCC11. Ying B et al. concluded that the expression level of HSPA8 in breast cancer and triple-negative breast cancer samples was significantly higher than that in normal breast tissues, and that the expression level of HSPA8 in the samples was significantly correlated with clinical indicators, such as TNM stage4. It was significantly associated with early recurrence in patients with breast cancer and suggested a poor prognosis12]– [13. HSPA8 promotes BCR/ABL-induced chronic granulocyte leukaemia cell survival14. High expression of HSPA8 plays an important role in the development of cancers such as acute myeloid leukaemia, lung cancer, endometrial cancer, bladder cancer and clear cell renal cell carcinoma, and is a candidate biomarker for early diagnosis and treatment15–18. Xiao M et al. demonstrated that carboxyl-terminal HSPA8-interacting proteins play a role in head and neck cancer19. However, its biological function in NPC is still unclear. We used qPCR to detect the relative mRNA expression of HSPA8 in NPC cells 5–8 F, HK1 and normal control cells NP69, and found that its relative expression in NPC cells was significantly higher than that in normal control cells, which suggests that HSPA8 may play an important role in NPC occurrence and development.

To investigate the specific effects of HSPA8 expression upregulation on the biological functions of NPC cells, we successfully constructed HSPA8 overexpressing and silencing NPC cells, and through a series of in vitro cellular function experiments, including CCK-8 assay, wound healing assay, Transwell migration and invasion assay, we investigated the effects of up-regulation or down-regulation of HSPA8 gene expression on nasopharyngeal carcinoma cell biological behaviour. The experimental results showed that when HSPA8 gene expression was silenced, the proliferation, invasion and migration abilities of NPC cells were significantly inhibited. In contrast, when HSPA8 gene was overexpressed, the proliferation, invasion and migration abilities of these cells were significantly enhanced. The experimental results suggest that the elevated expression level of HSPA8 is critical for promoting the growth, migration and invasion ability of NPC cells. To deeply analyse the role of HSPA8 in NPC, we performed apoptosis and cell cycle analysis using flow cytometry. The results showed that silencing of the HSPA8 gene increased the percentage of apoptosis in NPC cells, while overexpression of HSPA8 led to a decrease in the percentage of apoptosis. In addition, silencing of HSPA8 causes cells to arrest in G2/M phase, suggesting that HSPA8 also plays an important role in cell cycle regulation. As a protective mechanism, cell cycle arrest functions to trigger the response of cell cycle arrest through the regulation of cell cycle monitoring points when the DNA is damaged20. The cell cycle checkpoints of G2/M and G1/S are essential for maintaining DNA integrity and regulating cellular transmission through the cell cycle. It is well known that loss of these checkpoints is involved in the process of transformation to cancer cells and disease progression21. The G2/M phase arrest of the cell cycle has been found to play an important role in the pathogenesis of a variety of cancers22. During G2/M phase arrest, a number of related signalling pathways are activated, leading to inhibition of cell proliferation23. Tian et al. showed that silencing of HSPA8 in HD11 cells expression could increase the number of cells in G1 phase and decrease the number of cells in S phase24, and their conclusion is consistent with the findings of this paper. Some anticancer drugs act by promoting G2/M phase arrest in malignant human pharyngeal squamous carcinoma cell lines25.

We found by sequencing analysis that HSPA8 silencing-induced DEGs were enriched in CMA-related pathways, such as the p53 and VEGF26 signalling pathway.Wu JH et al. showed that the CMA down-regulates p53 expression by degrading the HMGB1 protein to inhibit irradiation-triggered apoptosis in hepatocellular carcinoma27. Therefore, it is very innovative to explore the regulation of CMA mediated by the molecular chaperone HSPA8 in NPC.

It is well known that nasopharyngeal carcinoma (NPC) is a malignant tumor highly associated with Epstein-Barr virus (EBV), with approximately 90% of NPC patients showing EBV infection. Although there is limited literature directly studying the interaction between HSPA8 and EBV, based on the functional properties of HSPA8 and the infection mechanism of EBV, it can be inferred that HSPA8 may play multiple roles in the EBV life cycle. Studies have demonstrated that HSP70 is induced in B cells during the early stage of EBV infection. TRIM26 interacts with heat shock proteins and promotes their polyubiquitination, thereby restricting EBV infection in nasopharyngeal epithelial cells28,29. The interaction between EBV and HSPA8 plays a crucial role in the development of NPC. They may influence the biological behaviors of NPC cells, such as proliferation, apoptosis, invasion, metastasis, and immune evasion, through physical interactions and functional regulation. A thorough exploration of the interaction mechanism between EBV and HSPA8 not only helps to elucidate the pathogenesis of NPC but also provides new insights and targets for the diagnosis, prognosis assessment, and treatment of NPC. In subsequent studies, we will focus on their interaction mechanism, conduct clinical research, and develop targeted therapeutic drugs, with the aim of achieving better therapeutic outcomes and improving the quality of life for NPC patients.

Conclusions

The findings suggest that HSPA8 may act as an oncogene in NPC, significantly contributing to cancer development. This finding deepens our understanding of the role of HSPA8 in cancer biology. Nonetheless, there are several limitations to this study, including the small sample size and functional studies performed only at the cellular level. Future studies need to expand the sample size and incorporate in vitro experiments to further validate these findings. In addition, studies on the mechanism of HSPA8-mediated autophagy (CMA) through molecular chaperones are still in the preliminary stage. We will include further investigation of the mechanism of HSPA8-mediated CMA in nasopharyngeal carcinoma in animal models and clinical samples.

Author contributions

ZY designed and conceived the study. SG completed the experiments, collected the data, drafted and completed the manuscript. QY revised the manuscript. SL provided advice and technical assistance. All authors have contributed to and approved the final manuscript.

Funding

The project of improving the basic ability of scientific research of young and middle-aged teachers in Guangxi universities. (No: 2022KY0083); Guangxi Natural Science Foundation(2024GXNSFAA010114) and National Natural Science Foundation of China(82360538).

Data availability

The transcriptomic data were deposited into the NCBI SRA under accession PRJNA1370446 and are available at the following URL: https://www.ncbi.nlm.nih.gov/search/all/?term=PRJNA1370446. All other data are available in the article and its Supplementary files or from the corresponding author upon request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The data are all sourced from public databases, and ethics have been obtained by the data openers.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Yanqiang Hou, Email: houyq960@shsmu.edu.cn.

Zheng Yang, Email: jackyyoung@foxmail.com.

References

  • 1.Chen, P., Liu, B., Xia, X., Huang, P. & Zhao, J. Current progress in immunotherapy of nasopharyngeal carcinoma. Am. J. Cancer Res.13 (4), 1140–1147 (2023). [PMC free article] [PubMed] [Google Scholar]
  • 2.Li, W. et al. Immunotherapeutic approaches in EBV-associated nasopharyngeal carcinoma. Front. Immunol.13, 1079515. 10.3389/fimmu.2022.1079515 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Luo, W. Nasopharyngeal carcinoma ecology theory: cancer as multidimensional Spatiotemporal unity of ecology and evolution pathological ecosystem. Theranostics13 (5), 1607–1631. 10.7150/thno.82690 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ying, B., Xu, W., Nie, Y. & Li, Y. HSPA8 is a new biomarker of triple negative breast cancer related to prognosis and immune infiltration. Dis. Markers. 2022, 8446857. 10.1155/2022/8446857 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Li, J. & Ge, Z. High HSPA8 expression predicts adverse outcomes of acute myeloid leukemia. BMC Cancer. 21 (1), 475. 10.1186/s12885-021-08193-w (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhao, X. et al. USP19 (ubiquitin specific peptidase 19) promotes TBK1 (TANK-binding kinase 1) degradation via chaperone-mediated autophagy. Autophagy18 (4), 891–908. 10.1080/15548627.2021.1963155 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kanehisa, M., Furumichi, M., Sato, Y., Matsuura, Y. & Ishiguro-Watanabe, M. KEGG: biological systems database as a model of the real world. Nucleic Acids Res.53 (D1), D672–D677. 10.1093/nar/gkae909 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kanehisa, M. Toward Understanding the origin and evolution of cellular organisms. Protein Sci.28 (11), 1947–1951. 10.1002/pro.3715 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kanehisa, M. & Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res.28 (1), 27–30. 10.1093/nar/28.1.27 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang, S. et al. Heat shock protein family A member 8 serving as a co-activator of transcriptional factor ETV4 up-regulates PHLDA2 to promote the growth of liver cancer. Acta Pharmacol. Sin. 44 (12), 2525–2536. 10.1038/s41401-023-01133-3 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wang, Y. et al. HBx-Induced HSPA8 stimulates HBV replication and suppresses ferroptosis to support liver cancer progression. Cancer Res.83 (7), 1048–1061. 10.1158/0008-5472 (2023). [DOI] [PubMed] [Google Scholar]
  • 12.Min, Y. et al. Identifying and validating of an Autophagy-Related gene signature for the prediction of early relapse in breast cancer. Front. Endocrinol. (Lausanne). 13, 824362. 10.3389/fendo.2022.824362 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chen, J. et al. KEGG-expressed genes and pathways in triple negative breast cancer: protocol for a systematic review and data mining. Med. (Baltim).99 (18), e19986. 10.1097/MD.0000000000019986 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.José-Enériz, E. S. et al. BCR-ABL1-induced expression of HSPA8 promotes cell survival in chronic myeloid leukaemia. Br. J. Haematol.142 (4), 571–582. 10.1111/j.1365-2141.2008.07221.x (2008). [DOI] [PubMed] [Google Scholar]
  • 15.Rusin, M. et al. Intronic polymorphism (1541-1542delGT) of the constitutive heat shock protein 70 gene has functional significance and shows evidence of association with lung cancer risk. Mol. Carcinog.39 (3), 155–163. 10.1002/mc.20009 (2004). [DOI] [PubMed] [Google Scholar]
  • 16.Shan, N., Zhou, W., Zhang, S. & Zhang, Y. Identification of HSPA8 as a candidate biomarker for endometrial carcinoma by using iTRAQ-based proteomic analysis. Onco Targets Ther.9, 2169–2179. 10.2147/OTT.S97983 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu, Y. et al. Heat shock protein family A member 8 is a prognostic marker for bladder cancer: evidences based on experiments and machine learning. J. Cell. Mol. Med.27 (24), 3995–4008. 10.1111/jcmm.17977 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang, Y. et al. Clinical implications of HSC70 expression in clear cell renal cell carcinoma. Int. J. Med. Sci.18 (1), 239–244. 10.7150/ijms.43100 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xiao, M., Yan, M., Zhang, J., Xu, Q. & Chen, W. Carboxy-terminus Hsc70 interacting protein exerts a tumor Inhibition function in head and neck cancer. Oncol. Rep.38 (3), 1629–1636. 10.3892/or.2017.5827 (2017). Epub 2017 Jul 17. [DOI] [PubMed] [Google Scholar]
  • 20.Suski, J. M., Braun, M., Strmiska, V. & Sicinski, P. Targeting cell-cycle machinery in cancer. Cancer Cell. ;39(6):759–778. (2021). 10.1016/j.ccell.2021.03.010IF: 50.3 Q1. Epub 2021 Apr 22. [DOI] [PMC free article] [PubMed]
  • 21.Norbury, C. & Nurse, P. Animal cell cycles and their control. Annu. Rev. Biochem.61, 441–470. 10.1146/annurev.bi.61.070192.002301 (1992). [DOI] [PubMed] [Google Scholar]
  • 22.Bhosale, P. B. et al. Apigetrin promotes TNFα-Induced Apoptosis, Necroptosis, G2/M phase cell cycle Arrest, and ROS generation through Inhibition of NF-κB pathway in Hep3B liver cancer cells. Cells11 (17), 2734. 10.3390/cells11172734 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bhosale, P. B. et al. Iridin induces G2/M phase cell cycle arrest and extrinsic apoptotic cell death through PI3K/AKT signaling pathway in AGS gastric cancer cells. Molecules26 (9), 2802. 10.3390/molecules26092802 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tian, H. et al. Effect of HSPA8 gene on the proliferation, apoptosis and immune function of HD11 cells. Dev. Comp. Immunol.142, 104666. 10.1016/j.dci.2023.104666 (2023). Epub 2023 Feb 9. [DOI] [PubMed] [Google Scholar]
  • 25.Nuth, M., Benakanakere, M. R. & Ricciardi, R. P. Discovery of a potent cytotoxic agent that promotes G2/M phase cell cycle arrest and apoptosis in a malignant human pharyngeal squamous carcinoma cell line. Int. J. Oncol.60 (4), 41. 10.3892/ijo.2022.5331 (2022). Epub 2022 Feb 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Stanton, M. J. et al. Autophagy control by the VEGF-C/NRP-2 axis in cancer and its implication for treatment resistance[J]. Cancer Res.73 (1), 160–171 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wu, J. H. et al. CMA down-regulates p53 expression through degradation of HMGB1 protein to inhibit irradiation-triggered apoptosis in hepatocellular carcinoma[J]. World J. Gastroenterol.23 (13), 2308–2317 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang, M. et al. TRIM26 restricts Epstein-Barr virus infection in nasopharyngeal epithelial cells through K48-linked ubiquitination of HSP-90β[J]. FASEB J.38 (1), e23345. 10.1096/fj.202300929RR (2024). [DOI] [PubMed] [Google Scholar]
  • 29.Shatzer, A. et al. Ganetespib, an HSP90 inhibitor, kills Epstein-Barr virus (EBV)-infected B and T cells and reduces the percentage of EBV-infected cells in the blood. Leuk. Lymphoma. 58 (4), 923–931. 10.1080/10428194.2016.1213823 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The transcriptomic data were deposited into the NCBI SRA under accession PRJNA1370446 and are available at the following URL: https://www.ncbi.nlm.nih.gov/search/all/?term=PRJNA1370446. All other data are available in the article and its Supplementary files or from the corresponding author upon request.

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES