Skip to main content
ACS Omega logoLink to ACS Omega
. 2025 Dec 26;11(1):349–360. doi: 10.1021/acsomega.5c02861

Myogenic Potential in Labeo rohita Dorsal Muscle Cell Line and Development of CRISPR-Cas9 Construct for Myostatin Gene

Gowhar Iqbal 1, Nevil Pinto 1, Arvind A Sonwane 1, Kiran D Rasal 1, Lukram Sushil Singh 1, Nidarshan Nagavara Chikkathimmashetty 1, Darshan Pawaskar 1, Mukunda Goswami 1,*
PMCID: PMC12809293  PMID: 41552614

Abstract

Labeo rohita, commonly known as rohu, is a freshwater fish from the Cyprinidae family. Myostatin (MSTN), a member of the Transforming Growth Factor-β (TGF-β) superfamily, is a negative regulator of skeletal muscle growth. CRISPR-Cas9 has progressively enhanced genome-editing efficacy by targeting various sites in the genome. The dorsal muscle cell line developed from L. rohita, named LRDM, was maintained in L-15 media containing 5% FBS and cultured for up to 35 passages. Cells were cryopreserved at different passages, achieving a 50–70% revival efficiency. PAX7 and MYOD protein expression were assessed in the LRDM to confirm the myogenic capacity at the 10th, 20th, and 30th passages. PAX7 expression was prominent in early passages, while MYOD expression became more noticeable in later passages. Guide RNAs were designed to target the L. rohita MSTN gene. One-step digestion and ligation were performed by ligating the annealed oligos to the T7cas9sgRNA2 vector. The isolated plasmid containing the target sequence was validated by using Sanger sequencing. The gRNA plasmid and pT3TS-nls-zCas9-nls (pT3 Cas9) vector were digested by using the BamHI and XbaI restriction enzymes. The expected size bands were observed at ∼2541 and ∼7332 bp. In vitro transcription of the gRNA and synthesis of pT3 Cas9 were carried out using MEGAshortscript T7 and mMESSAGE mMACHINE T3 kits, respectively. Establishing a myostatin-knockout fish muscle cell line could serve as a valuable model for studying the molecular mechanisms underlying muscle development, including cultivated fish meat production, which will be pivotal for the scientific and technological advancements needed to advance cellular aquaculture.


graphic file with name ao5c02861_0014.jpg


graphic file with name ao5c02861_0012.jpg

Introduction

Labeo rohita, commonly known as rohu, is a cyprinid species that is a highly preferred freshwater fish in Southeast Asian countries. Indian major carp (IMC) contributes approximately 24.94% to global aquaculture production, with rohu alone contributing 5.1% (2.48 million metric tons), placing it among the top 10 major aquaculture species worldwide. The fish has been sequenced and assembled with a genome size of 1.48 gigabases (Gb), covering over 98% of the estimated 1.5 Gb genome size. The growth rate of fish muscle is very beneficial for aquaculture as it shows both hypertrophy (increase in cell size) and hyperplasia (increase in cell number). Muscle mass contributes about 50 to 70% of the total body weight of fish, making it economically significant. Study of the mechanisms contributing to muscle growth, particularly through knockout of the myostatin gene, is crucial. In fish, differentiation and specification of skeletal muscle require various myogenic regulatory factors (MRFs), including Myf5, MyoD, Mrf4, MEF2A, and myogenin. During differentiation, the muscle satellite cells differentiate into myoblasts, which generate myotubes via cell-to-cell fusion of myocytes differentiated from myoblasts. MYOD (Myoblast determination protein) plays an important role in myoblast formation, which ultimately fuses and differentiates into mature muscle fibers and helps in muscle development. , Additionally, satellite cells can also be identified by a unique marker called PAX7 (Paired-box protein 7) in their dormant and activated stages.

Myostatin (or GDF-8), a member of the Transforming Growth Factor-β (TGF-β) superfamily, was first identified in mice, which negatively regulates skeletal muscle growth in several mammalian species. About 90% of the amino acids in the MSTN sequences of fish and mammals are identical. Myostatin inhibits myoblast specification and differentiation via downregulation of various genes like Pax3, Myf5, and MyoD expressions in myoblasts. Experimental studies in zebrafish and medaka have shown that inhibiting MSTN enhances the development of skeletal muscle fibers. In mammals, only one MSTN gene is present, but in bony fishes like Ictalurus punctatus, Danio rerio, Ctenopharyngodon idellus, and Megalobrama amblycephala, mstn-a and mstn-b were identified. It may be due to fish-specific genome duplication (FSGD or 3R) occurring at approximately 350 Mya. In large yellow croaker, the mstn-b gene was identified on chromosome 1. Myostatin-1 (mstn-b) retains its role in muscle development, while myostatin-2 (mstn-a) relates to immune function.

Fish are an ideal model for myogenesis studies due to the continuous muscle growth throughout their lifespan, a feature that differs from many other vertebrates. Fish cell lines have been developed from various tissues such as the ovary, fin, spleen, swim bladder, heart, liver, eye, muscle, brain, head, kidney, and skin. Different types of muscle cell lines have been developed from various marine and freshwater fishes, like the golden pompano muscle cell line, Acanthopagrus schlegelii, Clarius magur, Atlantic mackerel named Mac cells, L. rohita, Cyprinus carpio hematopterus, Cromileptes altivelis, Schizothorax richardsonii, Scophthalmus maximus, D. rerio, Wallago attu.

CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) technology has been widely used to generate gene knockout models and cell lines. , CRISPR has emerged as a potentially simple, efficient alternative to ZFNs and TALENs for inducing targeted genetic alterations. Cas9, when coexpressed with custom guide RNAs, has been effectively utilized in a wide range of cells and organisms. , Targeting or naturally mutating the MSTN gene leads to muscle gain, due to increased myofiber size and cell number, as reported in various species: sheep, dogs, humans, mice (Mus musculus), pigs (Sus scrofa), cattle (Bos taurus), zebrafish (D. rerio), common carp (Cyprinus carpio), blotched snakehead (Channa maculata), Nile tilapia (Li et al., 2021c; Wu et al., 2023a), yellow catfish (Pelteobagrus fulvidraco Richardson), red sea bream (Pagrus major), and tiger pufferfish (Takifugu rubripes). The current work aims to understand the expression of Myogenic Regulatory Factors, MYOD and PAX7, across three different passages in the L. rohita dorsal muscle cell line and to design a CRISPR-Cas9 construct for the myostatin gene.

Material and Methods

Ethical Statement

All experimental protocols in the study were approved by the Institutional Animal Ethics Committee (IAEC) and the Board of Studies (BoS) of the Fish Genetics and Biotechnology Division, ICAR-Central Institute of Fisheries Education, Mumbai, India. All methods were carried out under relevant guidelines and regulations approved by the committee with code no IAEC/BOS/FGB/CIFE/006.

Experimental Fish

Healthy specimens of L. rohita, collected from the Aquaculture division of ICAR-CIFE in live condition with a body weight ranging from 20 to 25 g, were maintained in the Central Wet lab of ICAR-CIFE in Mumbai, Maharashtra, India. They were allowed to acclimate in an aquarium for 4–7 days under controlled conditions, with temperatures between 26 ± 2 °C. L. rohita fingerlings were starved for 2 days before explant culture. The fish were treated with iodophor solution (0.5% w/v iodine) and sodium hypochlorite (500 ppm accessible chlorine) for 30 s to prevent cross-contamination.

Muscle Cell Culture of L. rohita and Maintenance

The fish surface was disinfected with 70% ethanol. Following disinfection, the fish was quickly euthanized by exposure to hypothermic shock in an ice-cooled bath for 40 seconds. To prevent cross-contamination, the fish were then cleaned with 70% ethanol. The use of antibiotics was limited to the explant preparation phase. The work was carried out in a laminar flow hood. Sterile techniques were used throughout all cell culture procedures to avoid contamination. The explant method was performed as described by Dhivyakumari et al., Yashwanth et al., and Li et al. Briefly, the skin was carefully removed, and muscle tissue from the dorsal region was aseptically taken and rinsed with 1 mL of phosphate buffer saline (PBS) solution (HiMedia, TC1101) containing 500 μg/mL streptomycin, 500 IU/mL penicillin, and 2.5 mg/mL Fungizone. The tissues were finely minced into small pieces by using autoclave scissors and forceps. Explants of 1 mm3 size were then prepared and washed four times with PBS containing antibiotics (100 μL/mL PBS). The chopped explants were subsequently placed into 25 cm2 cell culture flasks, and excess PBS was removed from the cell culture flasks. After that, 200 μL of FBS was added to promote the adherence of explants to the flask, and the flasks were then incubated at 28 °C in a BOD incubator to allow proper attachment of the explants to the surface of the flask.

After 15–18 h, L-15 (Leibovitz) medium supplemented with 15% FBS was used without disturbing the explant tissue. The spent medium was changed 4–6 days thereafter to provide the explants with proper nutrients and growth factors. An inverted microscope/cell imager was used to check the cells for any indications of radiation or contamination from the explants. Trypsinization was done using 0.25% trypsin phosphate versene glucose (TPVG) solution 1× (HiMedia, TCL143) once the cell confluence reached 85–90%. Cells were seeded in a 25 cm2 (T-25) flask with a split ratio of 1:1. Cells were subcultured up to 35 passages with a gradual reduction of FBS concentration to 5%.

Species Authentication

DNA was isolated from both muscle tissue and the LRDM cell line of L. rohita following the protocol outlined by Sambrook and Russell. DNA concentrations were determined using a nanodrop spectrophotometer (Thermo Scientific), with roughly 500.7 and 457.5 ng/μL readings for the respective samples. For species authentication of the developed muscle cells and muscle tissue, FishF1 (TCAACCAACCACAAAGACATTGGCAC) and FishR1 (TAGACTTCTGGGTGGCCAAAGAATCA) universal primers designed by Ward et al. were utilized to amplify mitochondrial Cytochrome C Oxidase Subunit I (COI) as per the earlier study by Zhi et al., Li et al., and Gong et al. The PCR reaction was set up in a 25 μL reaction volume consisting of 150 ng of template DNA, 2.5 μL of buffer (10×), 1 μL of each F1 and R1 primer, 0.5 μL of dNTPs (10 mM), 0.25 μL of Taq polymerase (5 units/μL), and 18.25 μL of nuclease-free water (NFW). The PCR amplification was carried out for 34 cycles, involving initial denaturation at 94 °C for 30 s, final denaturation at 95 °C for 5 min, annealing at 50 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 6 min (1 cycle). PCR products were visualized on a 0.8% agarose gel by staining with Ethidium bromide (EtBr) and documented using a gel documentation system (OmegaLum G, Aplegen).

After resolution, the PCR products were excised from the gel and purified using a Gel Extraction kit (Thermo Fisher Scientific), followed by the manufacturer’s protocol. The fragments were sequenced commercially (Eurofins, Bangalore) using the primers in both the forward and reverse directions. The aligned sequences were then subjected to BLAST using BLASTn to match the known sequence of L. rohita.

Plating Efficiency

Cell doubling time (CDT) is the time required for a cell population to double during the logarithmic growth phase. It is determined following the method outlined by Ham and Puck. In this study, LRDM cells at passage eighth was plated at densities of 100, 400, 600, and 1000 per well in a 6-well plate, using an L-15 growth medium supplemented with 10% FBS. The cells were incubated at 28 °C, and the medium was refreshed every 3 days over 20 days. Colonies were manually counted using a fluorescence-inverted microscope (Nikon, Japan). Before counting, cells were fixed with anhydrous methanol and stained with a Giemsa stain. The three independent experiments were performed in triplicate, and the plating efficiency was calculated by using the following formula.

celldoublingtime=incubationtime×ln⁡cellnumberattheendoftheincubationtimecellnumberatthebeginningoftheincubationtime
platingeffeciency=no.ofcoloniesno.ofcellsseeded×100

Cryopreservation and Revival

The cryopreservation protocol was based on the method described by Zhi et al., with minor modifications. Briefly, cells at the various passages were harvested and centrifuged at 1000 rpm for 5 min. After centrifugation, the medium was carefully removed without disturbing the pellet. The resulting cell pellet was suspended in 1 mL CryoXL (HiMedia, TCL093) containing 10% Dimethyl Sulfoxide (DMSO), 1× and kept in Mr. Frosty (Nalgene 5100–0001 PC/HDPE) container at −80 °C for 24 h. and then transferred to cryo box for short-term storage; for long-term storage, cells were transferred to liquid nitrogen (−196 °C). Cryopreserved cells were checked for revival efficiency at different time intervals. For revival, a cryovial was thawed quickly in a water bath at 32–35 °C. Then, the tube was centrifuged at 1000 rpm for 5 min at room temperature, resuspended in L-15 medium supplemented with 10% FBS, and seeded into a 25 cm2 tissue culture flask at 28 °C.

Confirmation of Myogenicity

PAX7 and MYOD protein expression was assessed in the L. rohita muscle cell line to confirm the myogenic capacity of the muscle cells at the 10th, 20th, and 30th passages using the immunocytochemistry technique. The protocol was followed as described by Han et al. and Saad et al., with minor modifications. Cells from three different passages were seeded in a 12-well plate and incubated overnight in a BOD incubator. The next day, 200 μL of paraformaldehyde was added to the complete medium containing L-15 and kept for 5 min. After 5 min, the entire solution was removed, and 500 μL of paraformaldehyde was added and kept for 30 min. DPBS was used to wash the cells thrice at 5 min intervals, and permeabilization was performed with 0.1% Triton X-100 (Sigma-Aldrich #T878) for 10 min.

DPBS was used to wash the cells three times, followed by blocking them with 1.5% BSA and washing them with PBS. MYOD Polyclonal Antibody (Invitrogen #PA5-144612) and PAX7 (Mouse monoclonal antibodies) (Next Biotechnologies #5081-M5) antibodies were diluted at 1:100 in 1.5% BSA first and later added to the cells, and incubated overnight at 4 °C. Following three washes with phosphate-buffered saline (PBS), cells were blocked with 1.5% bovine serum albumin (BSA) in PBS for 30 min to prevent nonspecific binding. The cells were then incubated with the secondary antibody, diluted 1:1000 in 1.5% BSA, for 1 h at room temperature. After incubation, the cells were washed three times with PBS to remove excess antibodies. For MYOD, Invitrogen Alexa Flour 568 goat antirabbit IgG (H+L) (Cat. No. A11011) was used, whereas for PAX7, Invitrogen Alexa Flour 488 goat antimouse IgG (H+L) (Cat. No. A11011) was used as a secondary antibody. After washing with PBS, the cells were counterstained with DAPI (4′,6-diamidino-2-phenylindole) in DPBS for 10 min at room temperature. Fluorescence was examined after 10–15 min using a fluorescent microscope (NIKON-Japan).

Identification of the Target Site

Guide RNAs were designed to target the L. rohita MSTN gene using the CRISPRscan online tool (https://www.crisprscan.org/) as per the protocol to search for protospacer target sequences in the form 5′(N)20-NGG-3. NGG as a PAM (Protospacer Adjacent Motif) sequence is crucial for Cas9 to cut the protospacer DNA. The output obtained includes several 20bp target options with variations in specificity values based on target hits; the best specificity was chosen to avoid off-target effects.

Designing and Cloning of gRNAs

The Forward and Reverse: AAACN18 oligomers were designed with no off-target effects detected using CRISPR RGEN Tools (CasOFFinder). The gRNA cloning protocol described by Jao et al. was followed. Oligo annealing was performed using 2 μL of 100 μM stock of each oligo in a reaction containing 14 μL of nuclease-free buffer (NFB) and 2 μL of STE buffer, for a total reaction volume of 20 μL. Incubation of the mixture was done at 95 °C for 5 min, ramping down to 50 °C at 0.1 °C/s, incubating at 50 °C for 10 min, and chilling to 4 °C at normal ramp speed (1 °C/sec). One-step digestion and ligation were done by ligating the 2 μL of annealed oligos to the 800–100 ng of T7cas9sgRNA2 (Addgene Plasmid #46759) vector along with the mixture of 2 μL of 10× NE Buffer 3, 2 μL of 10× T4 ligase Buffer, 1 μL of BsmBI, 0.6 μL of BglII, 0.6 μL of SalI, 1 μL of T4 DNA ligase, and 9.8 μL of NFW to make a total volume of 20 μL. Both digestion and ligation were done in a thermal cycler as a single-step process with the following program: 3 cycles of 20 min at 37 °C/15 min at 16 °C, followed by 10 min at 37 °C, 15 min at 55 °C, 15 min at 80 and 4 °C forever. The transformation was performed using a Qiagen kit (Cat. No. 23112). Plating was done on agar plates where ampicillin was added as a selection marker and kept overnight in an incubator at 37 °C. The next day, individual colonies were inoculated in 5 mL of broth and kept in an orbital shaker incubator overnight at 200 rpm at 37 °C. Later, plasmid isolation was done by using a Plasmid Isolation Kit (Qiagen Cat. No. 12145). Glycerol stock containing 300 μL of glycerol and 700 μL of overnight culture broth was maintained at −80 °C. The isolated plasmid-containing target was sent to Eurofins Private Limited for Sanger sequencing using M13F (−21) (TGTAAAACGACGGCCAGT) primer to confirm the clones with the correct insert.

In Vitro Transcription and Purification of gRNA

The gRNA plasmid containing the target was digested using the BamHI restriction enzyme. A 50 μL reaction was prepared by mixing 10 μL of plasmid gRNA along with 3 μL of BamHI, 3 μL of Buffer, and 32 μL of NFW. The mixture was properly spun and kept in a water bath overnight at a temperature of 37 °C. Enzyme inactivation was done at 37 °C for 20–25 min and loaded in a 0.8% agarose gel. Gel was visualized under a gel documentation system (OmegaLum G, Aplegen). Gel elution was performed using a Gel Extraction kit (Thermo Fisher Scientific), followed by the manufacturer’s protocol. MEGAshortscript T7 kit (Invitrogen Cat. No. AM1354) was used for in vitro gRNA transcription as per the protocol given by Lin et al., with the purified linearized DNA concentration varying from 150–500 ng/μL. Approximately 5 μL of purified linearized DNA was used as a template, along with 4 μL of T7 10× buffer, 4 μL of T7 ATP, 4 μL of T7 GTP, 4 μL of T7 CTP, 4 μL of T7 UTP, 4 μL of T7 enzyme, and 13 μL of NFW, bringing the final volume of the reaction to 40 μL. A short spin was done to mix the reagents, followed by incubation at 37 °C for 3 h in the thermal cycler. One μL of Turbo DNase was added and incubated at 37 °C for 15 min. For the purification of gRNA, the mirVana miRNA Isolation Kit (Invitrogen Cat. No. AM1560) was followed by the manufacturer’s protocol. The quantity of the product was checked using a Nanodrop microvolume spectrophotometer (Thermo Fisher Scientific), and the purity was estimated using the ratio of A 260/A 280 and stored at – 80 °C until further use.

In Vitro Transcription and Purification of pT3TS-nls-zCas9-nls

XbaI restriction enzyme was used to digest the pT3 Cas9 vector (pT3TS-nls-zCas9-nls) (Addgene Plasmid #46757) as per the protocol given by Campenhout et al. A 50 μL reaction was prepared by mixing 1 μL of plasmid gRNA with concentrations varying from 3000–3500 ng/μL along with 1 μL of XbaI enzyme, 5 μL of Buffer, and 41 μL of NFW. After spinning the mixture, it was kept in a water bath overnight at a temperature of 37 °C. Enzyme inactivation was done for 20 min at 65 °C and loaded in 1% agarose gel. Gel was visualized under a gel documentation system (OmegaLum G, Aplegen). The PCR product was purified using a purification kit (Thermo Fisher Scientific), followed by the manufacturer’s protocol. The mMESSAGE mMACHINE T3 kit (Invitrogen Cat. No. AM1348) was used for the synthesis of pT3TS-nls-zCas9-nls, as per the protocol given by Varshney et al., with the concentration of linearized Cas9 DNA varying from 250–500 ng/μL. To the reaction was added 10 μL of the linearized template, along with 10 μL of T7 2× NTP/Cap, 5 μL each of 10X reaction buffer and enzyme mix, and 5 μL of NFW, bringing the final volume to 50 μL. A short spin was performed to mix the reagents, followed by incubation at 37 °C for 2 h in the thermal cycler. After incubation, 1 μL of Turbo DNase was added and incubated at 37 °C for 15 min. For the purification of the Cas9 protein, the RNeasy Mini Kit (Qiagen Cat. No. 74104) was used, following the manufacturer’s instructions. The quantity of the product was checked using a Nanodrop microvolume spectrophotometer (Thermo Fisher Scientific), and the purity was estimated using the ratio of A 260/A 280 and stored at – 80 °C until further use.

Statistical Analyses

The data were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test with SPSS version 22.0 (IBM). Results are presented as mean ± standard deviation (SD). Statistical significance was considered at the 95% confidence level (p < 0.05).

Results

Muscle Cell Culture of L. rohita and Maintenance

The explants taken from L. rohita dorsal muscle tissue showed attachment within 16–20 h of explant preparation. Cells began to radiate from the explant after 4–5 days (Figure A). Subsequent subcultures of these cells were conducted at 3–5 day intervals (Figure B). The derived cell line was labeled LRDM (L. rohita dorsal muscle) and subcultured for up to 35 passages (Figure C). From the 10th passage onward, the cultures were maintained in fresh L-15 medium containing 5% FBS. However, the growth rate was notably slow.

1.

1

(A) Proliferation of LRDM cells from the dorsal region of muscle tissue of L. rohita (10×), (B) cells at 25th passage (10×), and (C) cells at 35th passage (10×).

Species Authentication

The total genomic DNA of the muscle tissue and LRDM cells was isolated using the Phenol-Chloroform method. For PCR amplification, a universal set of Primers (F1 & R1) was used to amplify the COI gene in muscle tissue and LRDM cells, with an expected amplicon size of 655 bp (Figure ). The forward and reverse sequences for both samples were obtained by using Sanger sequencing and aligned using multiple sequence alignment. The aligned sequences were run for BLAST using BLASTn, i.e., the BLAST nucleotide. The nucleotide sequence of both samples shows a sequence identity of 99.69% with the L. rohita. Gene sequences obtained from the muscle tissue and LRDM cells were submitted to the NCBI database with GenBank accession numbers PQ818122 and PQ818142.

2.

2

COI gene amplification of L. rohita (LRDM) cells by using universal primers, yielding expected PCR products of size 655 bp. Lane L, Gene Ruler Express 100bp DNA ladder (Thermo Scientific), (N) Negative Control, (A) LRDM cells, (B) Muscle tissue from L. rohita.

Cell Plating Efficiency

In the eighth passage of LRDM cells, their plating efficiency was determined. The cells were seeded at different concentrations: 100, 400, 600, and 1000 cells per flask. The plating efficiency was 30.25, 40.23, 52.56, and 70.77%, as shown in Figure . Statistical analysis revealed that the 1000-cell group had the significantly highest (p < 0.05) plating efficiency, among all other groups. However, no significant difference (p > 0.05) was observed between the 100 and 400-cell groups. Trypan blue staining indicated that 94.6% of the LRDM cells were viable.

3.

3

Graph showing the cells seeded at 8th passage vs plating efficiency. Data is presented as means ± SD of three replicates. Different superscript letters on different bars indicate a significant difference (p < 0.05) between different concentration treatments.

Cryopreservation and Recovery Rate

LRDM cells were cryopreserved on the 10th and 25th passages using a CryoXL freezing medium and stored at −80 °C. After two months, in cryopreserved cells, the attachment was observed after 24 h, and cell confluency reached ∼50% after 48 h (Figure A,B). The revival efficiency was checked, with significantly higher efficiency (p < 0.05) ∼70% at the 10th passage and lower in the 25th passage (∼55%) (Figures C,D and ). No difference was observed in the morphology of the cells recovered after cryopreservation (Figure C,D). Cells were stored in liquid nitrogen (−196 °C) for further use.

4.

4

(A) Attachment of cryopreserved cells after 24 h; (B) after 48 h; (C) revival efficiency at 10th passage; (D) 25th passage.

5.

5

Graph showing revival efficiency of cells at 10th passage and 25th passage. Data is presented as means ± SD of three replicates. Different superscript letters on different bars indicate a significant difference (p < 0.05) between the different passage numbers.

Confirmation of Myogenicity

Myogenic conformation was assessed using MYOD and PAX7 markers at 10th, 20th, and 30th passages. PAX7 was confirmed by green fluorescence in all three passages (Figure a: A–I). Similarly, MYOD expression was observed by the presence of red fluorescence, as shown in Figure a: A–I. The expression of PAX7 was significantly (p < 0.05) higher in the early passage (10th passage), but it progressively decreased in the later passages (20th and 30th passages) as presented in Figure b. In contrast, MYOD expression was significantly (p < 0.05) lower in the 10th passage, while significantly (p < 0.05) highest in the 20th passage, as presented in Figure b. The nucleus of the cells was identified using DAPI (4′,6-diamidino-2-phenylindole) staining, which was confirmed by the presence of blue fluorescence.

6.

6

Immunofluorescence staining for PAX7 at passage 10th (P10), 20th (P20), and 30th (P30). Scale bar: 100 μm. (A, D& G) Cells stained with PAX7 (green fluorescence); (B, E& H) cells stained with DAPI; (C, F& I) Merged (PAX7 & DAPI) as shown in (6a). The mean fluorescence intensity was quantified using ImageJ. Data is presented as means ± SD of three independent replicates. Different superscript letters on different bars indicate a significant difference (p < 0.05) among the three different passage numbers, as shown in (6b).

7.

7

Immunofluorescence staining for MYOD at passage 10th (P10), 20th (P20) and 30th (P30). Scale bar: 100 μm. (A, D and G) Cells stained with MYOD (Red fluorescence); (B, E and H) Cells stained with DAPI; (C, F and I) Merged (MYOD & DAPI) as shown in panel a. The mean fluorescence intensity was quantified using ImageJ. Data is presented as means ± SD of three replicates. Different superscript letters on different bars indicate a significant difference (p < 0.05) among the three different passage numbers, as shown in panel b.

Identification of Target Sites, Design and Cloning of Guide RNA (gRNA)

CRISPRscan online tools were used to design oligos targeting the MSTN gene in L. rohita, focusing on the PAM sequences within exon 1 of the MSTN gene. The sequences of the oligonucleotides designed in this study are 5′taGGTCATGATGGTCTCTGTGG3′ and 5′aaacCCACAGAGACCATCATGA3′. There is no observation of off-target effects in the designed oligos, as predicted by CasOFFinder software (Figure ). Plasmid isolation was done from both of the vectors, i.e., pT3TS-nls-zCas9-nls and the T7cas9sgRNA2 vector. One-step ligation and cloning were performed using the T7cas9sgRNA2 vector. The colonies were screened using an ampicillin antibiotic marker to confirm the presence of the insert. The positive colonies were inoculated into LB broth containing ampicillin. The plasmid was isolated and confirmed using a 0.8% gel, as shown in Figure , and then sequenced using Sanger sequencing to confirm the presence of the insert. More than 90% of the colonies contained the target sequence, as confirmed by Sanger sequencing (Figure A,B). The gRNA plasmid was preserved as glycerol stocks at −80 °C.

8.

8

Off-target effects prediction for the designed gRNA.

9.

9

Plasmid isolated from vectors and gRNA. Lane M: 1 Kb plus DNA ladder (Gene Ruler); (A) pT3TS-nls-zCas9-nls; (B) T7cas9sgRNA2; (C–F) gRNA.

10.

10

Results showing the presence of the target sequence in the T7cas9sgRNA2 vector: (A) forward target sequence, (B) reverse target sequence.

In Vitro Transcription and Purification of gRNA

The BamHI restriction enzyme was used for digestion to generate a linearized form of the plasmid, which was then loaded onto an agarose gel to confirm the successful linearization by visualizing the expected band of approximately 2541 bp (Figure A). Following linearization, in vitro transcription of the gRNA was performed using the MEGAshortscript T7 Transcription Kit. Later, it was purified by using the mirVana miRNA Isolation Kit. The quality was checked with a Nanodrop microvolume spectrophotometer. The quantity of mRNA was varied from 1000–1250 ng/μL across the samples.

11.

11

Digestion of vectors with Restriction enzymes; Lane M: 1 Kb plus DNA ladder (Gene Ruler); (A) Linearization of gRNA by BamHI (∼2541 bp); (B) linearization of pT3TS-nls-zCas9-nls (∼7332 bp).

In Vitro Transcription and Purification of pT3TS-nls-zCas9-nls

The XbaI restriction enzyme was used to digest the pT3TS-nls-zCas9-nls and run on an agarose gel to confirm the successful linearization by visualizing the expected band of approximately 7332 base pairs (Figure B). Following linearization, in vitro transcription of pT3TS-nls-zCas9-nls was performed using the mMESSAGE mMACHINE T3 kit. Later, it was purified using the RNeasy Mini Kit. The quality was checked by the Nanodrop microvolume spectrophotometer. The quantity of mRNA was varied from 1200–1500 ng/μL across the samples.

Discussion

In this work, the myogenic potential of the L. rohita dorsal muscle cell line was confirmed by expressing PAX7 and MYOD key markers in three different passages. Additionally, a CRISPR-Cas9 construct was developed to target the myostatin gene. First, the dorsal muscle cell line was developed from L. rohita using the explant method, which creates less cell damage and is faster than the trypsin method, as reported in the Acanthopagrus latus liver cell line, and Atlantic salmon gill cell ASG-10. Cells from the explant start radiating after 4–5 days, similar to the results observed in Cirrhinus mrigala, A. schlegelii, Fundulus heteroclitus, and Gambusia affinis. The primary muscle cells showed attachment and proliferation within 16–20 h, forming a confluent monolayer within 25–30 days. These cells were cultured and subcultured for up to 35 passages with a gradual reduction in FBS concentration without losing the viability and morphology of the cells. The effects of different serum concentrations on the growth rate of the developed cells were determined. Initially, the primary culture was maintained using an L-15 medium supplemented with 15% fetal bovine serum (FBS), which was identical to other fish cell lines reported previously in the Lates calcarifer kidney cell line and C. magur. After the 10th passage, FBS concentration was reduced to 5%, which can reduce the cell culture media cost, which is crucial for scaling up cell culture systems for commercial applications like lab-grown meat. − LRDM cells were seeded with different cell densities of 100, 400, 600, and 1000 cells/plate at passage eighth, resulting in a plating efficiency of 30.25, 40.23, 52.56, and 70.77%. The cells seeded at low density resulted in relatively lower efficiency, and cells seeded at a higher density showed higher colony-forming ability.

Authentication of cell lines is one of the most important criteria for the confirmation of the species of origin of the cell line. In cell culture systems, the main issue is cross-contamination of the cell lines. Properly identifying species of origin using molecular approaches makes the culture system more specific in identifying species. , The species identity of the muscle tissue and LRDM cells was confirmed through COI gene analysis and showed a 99.69% similarity to L. rohita sequences available in NCBI, which validated the authenticity of the established cell line. The LRDM cells were cryopreserved using a CryoXL freezing medium and stored at −80 °C, with a cryopreservation efficiency of ∼70% at the 10th passage and ∼55% at the 25th. This suggests that the cryopreserved cells have a high revival efficiency, which further supports the viability of this cell line for long-term storage without any significant loss of cell viability or morphology. Such properties have the potential for large-scale application in cultivated meat production, especially when cryopreserving cells with varying myogenic capacities at different passages. This is similar to results observed in Epinephelus coioides cell line with 73% revival efficiency, 68–78% in Cyprinus carpio hematopterus muscle cell line, 60% in C. magur muscle cell line, and 80% in golden pompano muscle cell line.

In fish (D. rerio), expression markers such as PAX7, MYOD, and Myog confirm the presence of satellite cells, myoblasts, and myotubes. Quiescent muscle satellite cells highly express PAX7, myocytes or myotubes express Myog, whereas myoblasts express MYOD and Myf5. , PAX7 is mainly expressed in quiescent and activated satellite cells in mammals. In this study, immunocytochemistry was performed to confirm the presence of MYOD and PAX7 in the 10th, 20th, and 30th passages. These cells were confirmed to possess myogenic potential with PAX7 and MYOD expression across three different passages. The PAX7 and MYOD expression changes across passages in developed cell lines likely reflect the cell’s transition from a stem/progenitor-like state to a more differentiated cell. The abundant expression of PAX7 in the early passage suggests a stem cell or progenitor cell state, while its decline in later passages indicates differentiation. The low expression of MYOD in the 10th passage and higher expression in the 20th passage indicate the differentiation process. Still, the reduction of MYOD at the 30th passage suggests that the cells may be reaching a terminally differentiated state or losing their ability to differentiate further. This ability to maintain myogenic activity over several passages is crucial for producing functional muscle tissue in lab-grown meat. This study indicates that LRDM cells retain their myogenic capacity over time. However, a change in expression could indicate differentiation or changes in the myogenic potential with extended culturing. The observed shift between the PAX7 and MYOD expression patterns has been seen in other cell lines and species. Similar results were obtained in Paralichthys olivaceus, where they found that MYOD expression was higher in undifferentiated cells and decreased as the cells underwent differentiation. Similarly, in the case of Sebastes schlegelii, MYOD expression remained stable across passages 5, 10, and 25. However, PAX7 expression was only observed in the fifth and 10th passages.

CRISPR-Cas9 technology offers a powerful and versatile tool for genome editing in fish, enabling precise modifications to target genes like myostatin for improved traits such as muscle growth. Our study successfully cloned the myostatin b gene into a T7Cas9sgRNA2 vector, and in vitro transcription of the gRNA and Cas9 components was performed, similar to previous methods followed by Liang et al., Shiraki and Kawakami. These advancements in gene editing will open new possibilities for enhancing fish growth, ultimately contributing to a more efficient and sustainable aquaculture. It will offer the potential for improved muscle cell development, enhancement of the growth rate in cells, and reduced cell doubling time with broader implications for cellular aquaculture. Similarly, CRISPR-Ca9 technology knocked out RelA and IκBα in human embryonic stem cells (hESCs). Pascucci used CRISPR-Cas9 technology to knock out the MAGEC2 gene in the A375 melanoma cell line. However, further validation is required to fully elucidate the effects of the knockout in the cell line, which will provide a deeper understanding of the developed knockout cell line. Knockout cell lines are crucial in studying cell regulatory mechanisms. ,

Conclusions

This study successfully established a dorsal muscle cell line from L. rohita and confirmed its myogenic potential by expressing key markers such as PAX7 and MYOD. The results indicate that LRDM cells retain their myogenic capacity over time, suggesting their ability to differentiate and undergo myogenesis. This characteristic is critical for future applications in muscle biology, gene editing, lab-grown meat, and developmental studies. The cell line demonstrated robust growth, high plating efficiency, and successful cryopreservation, making it a promising tool for both aquaculture research and lab-grown meat production. Furthermore, the CRISPR-Cas9 construct was developed to target the myostatin b gene in the L. rohita dorsal muscle cell line, which offers the potential for developing a myostatin-knockout muscle cell line with enhanced muscle growth. Future studies will focus on the functional analysis of the MSTN knockout in the LRDM cell line to elucidate its role in regulating muscle development and growth. Overall, this research contributes to the growing field of cellular aquaculture and genetic engineering in fish cell lines with implications for improving cell proliferation, muscle development, and sustainable food production.

Acknowledgments

The authors sincerely thank the Director, ICAR-Central Institute of Fisheries Education (CIFE), Mumbai, Maharashtra, India, for providing the facilities and support necessary for completing this research. The first author also acknowledges the fellowship support received from ICAR-CIFE during the study period and expresses sincere gratitude for the opportunity to conduct this research as part of his PhD work.

All data are available in the manuscript

G.I.: bench work, original draft writing, review and editing, manuscript correction, and validation. N.P.: assistance in cell culture, methodology, manuscript correction, and validation. A.A.S.: assistance in CRISPR-Cas9, cell culture, and methodology. K.D.R.: assistance in in vitro transcription, manuscript correction, and methodology. L.S.S.: assistance in plasmid isolation. N.N.C.: assistance in cloning. D.P.: assistance in cell culture. M.G.: overall supervision, draft writing, review, and editing. All authors read and approved the final manuscript.

No funding sources were available

The authors declare no competing financial interest.

References

  1. Modeel S., Joshi B. D., Yadav S., Bharti M., Negi R. K.. Mitochondrial DNA reveals shallow population genetic structure in economically important Cyprinid fish Labeo rohita (Hamilton, 1822) from South and Southeast Asia. Mol. Biol. Rep. 2023;50(6):4759–4767. doi: 10.1007/s11033-023-08386-5. [DOI] [PubMed] [Google Scholar]
  2. Das P., Sahoo L., Das S. P., Bit A., Joshi C. G., Kushwaha B.. et al. De novo assembly and genome-wide SNP discovery in Rohu Carp, Labeo rohita . Front. Genet. 2020;11:386. doi: 10.3389/fgene.2020.00386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Rowlerson A., Mascarello F., Radaelli G., Veggetti A.. Differentiation and muscle growth in the fish Sparus aurata (L): II. Hyperplastic and hypertrophic growth of lateral muscle from hatching to adult. J. Muscle Res. Cell Motil. 1995;16:223–236. doi: 10.1007/BF00121131. [DOI] [PubMed] [Google Scholar]
  4. Zammit P. S.. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017;72:19–32. doi: 10.1016/j.semcdb.2017.11.011. [DOI] [PubMed] [Google Scholar]
  5. Yin H., Price F., Rudnicki M. A.. Satellite cells and the muscle stem cell niche. Physiol. Rev. 2013;93(1):23–67. doi: 10.1152/physrev.00043.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Endo T.. Molecular mechanisms of skeletal muscle development, regeneration, and osteogenic conversion. Bone. 2015;80:2–13. doi: 10.1016/j.bone.2015.02.028. [DOI] [PubMed] [Google Scholar]
  7. Berkes C. A., Tapscott S. J.. MYOD and the transcriptional control of myogenesis. Semin. Cell Dev. Biol. 2005;16:585–595. doi: 10.1016/j.semcdb.2005.07.006. [DOI] [PubMed] [Google Scholar]
  8. Dumont N. A., Wang Y. X., Rudnicki M. A.. Intrinsic and extrinsic mechanisms regulating satellite cell function. Development. 2015;142(9):1572–1581. doi: 10.1242/dev.114223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Saunders M. A., Good J. M., Lawrence E. C., Ferrell R. E., Li W. H., Nachman M. W.. Human adaptive evolution at Myostatin (GDF8), a regulator of muscle growth. Am. J. Hum. Genet. 2006;79(6):1089–1097. doi: 10.1086/509707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Langley B., Thomas M., Bishop A., Sharma M., Gilmour S., Kambadur R.. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J. Biol. Chem. 2002;277(51):49831–49840. doi: 10.1074/jbc.M204291200. [DOI] [PubMed] [Google Scholar]
  11. Xu C., Wu G., Zohar Y., Du S. J.. Analysis of myostatin gene structure, expression and function in zebrafish. J. Exp. Biol. 2003;206(22):4067–4079. doi: 10.1242/jeb.00635. [DOI] [PubMed] [Google Scholar]
  12. Sawatari E., Seki R., Adachi T., Hashimoto H., Uji S., Wakamatsu Y.. et al. Overexpression of the dominant-negative form of myostatin results in doubling of muscle-fiber number in transgenic medaka (Oryzias latipes) Comp. Biochem. Physiol., Part A:Mol. Integr. Physiol. 2010;155(2):183–189. doi: 10.1016/j.cbpa.2009.10.030. [DOI] [PubMed] [Google Scholar]
  13. Zhang S., Li Y., Shao J., Liu H., Wang J., Wang M.. et al. Functional identification and characterization of IpMSTNa, a novel orthologous myostatin (MSTN) gene in channel catfish Ictalurus punctatus . Int. J. Biol. Macromol. 2020;152:1–10. doi: 10.1016/j.ijbiomac.2020.02.060. [DOI] [PubMed] [Google Scholar]
  14. Kerr, T. B. Discovery and characterization of a novel myostatin in zebrafish. Doctoral Dissertation, Washington State University. [Google Scholar]
  15. Xu Y., Tan Q., Kong F., Yu H., Zhu Y., Yao J., Abouel Azm F. R.. Fish growth in response to different feeding regimes and the related molecular mechanism on the changes in skeletal muscle growth in grass carp (Ctenopharyngodon idellus) Aquaculture. 2019;512:734295. doi: 10.1016/j.aquaculture.2019.734295. [DOI] [Google Scholar]
  16. Sun Y., Zheng G. D., Nissa M., Chen J., Zou S. M.. Disruption of mstna and mstnb gene through CRISPR/Cas9 leads to elevated muscle mass in blunt snout bream (Megalobrama amblycephala) Aquaculture. 2020;528:735597. doi: 10.1016/j.aquaculture.2020.735597. [DOI] [Google Scholar]
  17. Meyer A., Van de Peer Y.. From 2R to 3R: evidence for a fish-specific genome duplication (FSGD) BioEssays. 2005;27(9):937–945. doi: 10.1002/bies.20293. [DOI] [PubMed] [Google Scholar]
  18. Ao J., Mu Y., Xiang L. X., Fan D., Feng M., Zhang S.. et al. Genome sequencing of the perciform fish Larimichthys crocea provides insights into molecular and genetic mechanisms of stress adaptation. PLoS Genet. 2015;11(4):e1005118. doi: 10.1371/journal.pgen.1005118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Zhang X., Wang F., Dong Z., Dong X., Chi J., Chen H.. et al. A new strain of yellow catfish carrying genome edited myostatin alleles exhibits double muscling phenotype with hyperplasia. Aquaculture. 2020;523:735187. doi: 10.1016/j.aquaculture.2020.735187. [DOI] [Google Scholar]
  20. Pandey G.. Overview of fish cell lines and their uses. Int. J. Pharm. Res. Sci. 2013;2:580–590. [Google Scholar]
  21. Zhang L. K., Zhu K. C., Guo H. Y., Liu B. S., Liu B., Zhang N., Zhang D. C.. Establishment and characterization of a muscle cell line from golden pompano (Trachinotus ovatus) and its application in viral susceptibility. Aquaculture. 2024;580:740286. doi: 10.1016/j.aquaculture.2023.740286. [DOI] [Google Scholar]
  22. Han D. H., Gong S. P.. Establishment and Characterization of a skeletal muscle-derived myogenic cell line from black sea bream (Acanthopagrus schlegelii) J. Mar. Sci. Eng. 2024;12(2):249. doi: 10.3390/jmse12020249. [DOI] [Google Scholar]
  23. Dhivyakumari S., Chaudhari A., Brahmane M. P., Das D. K., Sathiyanarayanan A., Yashwanth B. S.. et al. Development and characterization of a new muscle cell culture system from Clarias magur (Hamilton, 1822) Fish Physiol. Biochem. 2023;49(6):1295–1302. doi: 10.1007/s10695-023-01257-7. [DOI] [PubMed] [Google Scholar]
  24. Saad M. K., Yuen J. S. Jr, Joyce C. M., Li X., Lim T., Wolfson T. L.. et al. Continuous fish muscle cell line with capacity for myogenic and adipogenic-like phenotypes. Sci. Rep. 2023;13(1):5098. doi: 10.1038/s41598-023-31822-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Yashwanth B. S., Pinto N., Sathiyanarayanan A., Chaudhari A., Rasal K. D., Goswami M.. Functional characterization of Labeo rohita muscle cell line for in vitro research. Mol. Biol. Rep. 2023;50(7):5635–5646. doi: 10.1007/s11033-023-08427-z. [DOI] [PubMed] [Google Scholar]
  26. Zhi S., Wang J., Wang Y., Yang L., Qin C., Yan X.. et al. Establishment and characterization of Yellow River carp (Cyprinus carpio haematopterus) muscle cell line and its application to fish virology and immunology. Fish Shellfish Immunol. 2023;139:108859. doi: 10.1016/j.fsi.2023.108859. [DOI] [PubMed] [Google Scholar]
  27. Wang L., Cao Z., Liu Y., Xiang Y., Sun Y., Zhou Y.. et al. Establishment and characterization of a new cell line from the muscle of humpback grouper (Cromileptes altivelis) Fish Physiol. Biochem. 2020;46:1897–1907. doi: 10.1007/s10695-020-00841-5. [DOI] [PubMed] [Google Scholar]
  28. Kumar M. S., Soni P., Singh N., Kumar R., Srivastava S., Mishra A. K.. et al. Establishment and characterization of eye muscle cell line from snow trout, Schizothorax richardsonii (Gray, 1832), a Vulnerable Coldwater Fish, for In Vitro Studies. Turkish J. Fish. Aquat. Sci. 2021;21(2):95–105. doi: 10.4194/1303-2712-v21_2_05. [DOI] [Google Scholar]
  29. Gao Y., Zhou H., Gao Z., Jiang H., Wang X., Mai K., He G.. Establishment and characterization of a fibroblast-like cell line from the muscle of turbot (Scophthalmus maximus L.) Fish Physiol. Biochem. 2019;45:1129–1139. doi: 10.1007/s10695-019-00628-3. [DOI] [PubMed] [Google Scholar]
  30. Kumar A., Singh N., Goswami M., Srivastava J. K., Mishra A. K., Lakra W. S.. Establishment and characterization of a new muscle cell line of zebrafish (Danio rerio) as an in vitro model for gene expression studies. Anim. Biotechnol. 2016;27(3):166–173. doi: 10.1080/10495398.2016.1147455. [DOI] [PubMed] [Google Scholar]
  31. Dubey A., Goswami M., Yadav K., Mishra A., Kumar A.. Establishment of a novel muscle cell line from Wallago attu for in vitro study of pesticide toxicity. Gene Cell Tissue. 2015;2(1):e25568. doi: 10.17795/gct-25568. [DOI] [Google Scholar]
  32. Li J., Tang C., Liang G., Tian H., Lai G., Wu Y.. et al. Clustered regularly interspaced short palindromic repeats and clustered regularly Interspaced Short Palindromic Repeats–Associated protein 9 system: factors affecting Precision Gene Editing Efficiency and optimization strategies. Hum. Gene Ther. 2023;34(23–24):1190–1203. doi: 10.1089/hum.2023.115. [DOI] [PubMed] [Google Scholar]
  33. Bauer D. E., Canver M. C., Orkin S. H.. Generation of genomic deletions in mammalian cell lines via CRISPR/Cas9. J. Visualized Exp. 2015;(95):52118. doi: 10.3791/52118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yang Z., Fu G., Lee M., Yeo S., Yue G. H.. Genes for editing to improve economic traits in aquaculture fish species. Aquacult. Fish. 2025;10:1–18. doi: 10.1016/j.aaf.2024.05.005. [DOI] [Google Scholar]
  35. Gaj T., Gersbach C. A., Barbas C. F.. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 2013;31(7):397–405. doi: 10.1016/j.tibtech.2013.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Peng R., Lin G., Li J.. Potential pitfalls of CRISPR/Cas9-mediated genome editing. FEBS J. 2016;283(7):1218–1231. doi: 10.1111/febs.13586. [DOI] [PubMed] [Google Scholar]
  37. Singh V., Braddick D., Dhar P. K.. Exploring the potential of genome editing CRISPR-Cas9 technology. Gene. 2017;599:1–8. doi: 10.1016/j.gene.2016.11.008. [DOI] [PubMed] [Google Scholar]
  38. Clop A., Marcq F., Takeda H., Pirottin D., Tordoir X., Bibé B.. et al. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 2006;38(7):813–818. doi: 10.1038/ng1810. [DOI] [PubMed] [Google Scholar]
  39. Mosher D. S., Quignon P., Bustamante C. D., Sutter N. B., Mellersh C. S., Parker H. G., Ostrander E. A.. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 2007;3(5):e79. doi: 10.1371/journal.pgen.0030079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schuelke M., Wagner K. R., Stolz L. E., Hübner C., Riebel T., Kömen W.. et al. Myostatin mutation associated with gross muscle hypertrophy in a child. N. Engl. J. Med. 2004;350(26):2682–2688. doi: 10.1056/NEJMoa040933. [DOI] [PubMed] [Google Scholar]
  41. Nassar R., Vernus B., Carnac G., Fouret G., Goustard B., Casas F., Tintignac L.. et al. Myostatin gene inactivation increases post-mortem calpain-dependent muscle proteolysis in mice. Meat Sci. 2022;185:108726. doi: 10.1016/j.meatsci.2021.108726. [DOI] [PubMed] [Google Scholar]
  42. Qian L. L., Xie J. Y., Ting G. A., Cai C. B., Jiang S. W., Bi H. F.. et al. Targeted myostatin loss-of-function mutation increases type II muscle fibers in Meishan pigs. J. Integr. Agric. 2022;21(1):188–198. doi: 10.1016/S2095-3119(21)63669-9. [DOI] [Google Scholar]
  43. Meyermans R., Janssens S., Coussé A., Gorssen W., Hubin X., Mayeres P.. et al. Myostatin mutation causing double muscling could affect increased psoroptic mange sensitivity in dual purpose Belgian Blue cattle. Animal. 2022;16(3):100460. doi: 10.1016/j.animal.2022.100460. [DOI] [PubMed] [Google Scholar]
  44. Gao Y., Dai Z., Shi C., Zhai G., Jin X., He J.. et al. Depletion of myostatin b promotes somatic growth and lipid metabolism in zebrafish. Front. Endocrinol. 2016;7:88. doi: 10.3389/fendo.2016.00088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Shahi N., Mallik S. K., Sarma D.. Muscle growth in targeted knockout common carp (Cyprinus carpio) mstn gene with low off-target effects. Aquaculture. 2022;547:737423. doi: 10.1016/j.aquaculture.2021.737423. [DOI] [Google Scholar]
  46. Ou M., Wang F., Li K., Wu Y., Huang S., Luo Q.. et al. Generation of myostatin gene-edited blotched snakehead (Channa maculata) using CRISPR/Cas9 system. Aquaculture. 2023;563:738988. doi: 10.1016/j.aquaculture.2022.738988. [DOI] [Google Scholar]
  47. Wu Y., Wu T., Yang L., Su Y., Zhao C., Li L.. et al. Generation of fast growth Nile tilapia (Oreochromis niloticus) by myostatin gene mutation. Aquaculture. 2023;562:738762. doi: 10.1016/j.aquaculture.2022.738762. [DOI] [Google Scholar]
  48. Kishimoto K., Washio Y., Murakami Y., Katayama T., Kuroyanagi M., Kato K.. et al. An effective microinjection method for genome editing of marine aquaculture fish: tiger pufferfish Takifugu rubripes and red sea bream Pagrus major . Fish. Sci. 2019;85:217–226. doi: 10.1007/s12562-018-1277-3. [DOI] [Google Scholar]
  49. Li N., Guo L., Guo H.. Establishment, characterization, and transfection potential of a new continuous fish cell line (CAM) derived from the muscle tissue of grass goldfish (Carassius auratus) In Vitro Cell. Dev. Biol.: Anim. 2021;57(9):912–931. doi: 10.1007/s11626-021-00622-1. [DOI] [PubMed] [Google Scholar]
  50. Sambrook J., Russell D. W.. Purification of nucleic acids by extraction with phenol: chloroform. Cold Spring Harbor Protoc. 2006;2006(1):pdb-rot4455. doi: 10.1101/pdb.prot4455. [DOI] [PubMed] [Google Scholar]
  51. Ward R. D., Zemlak T. S., Innes B. H., Last P. R., Hebert P. D.. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc., B. 2005;360(1462):1847–1857. doi: 10.1098/rstb.2005.1716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Gong J., Pan X., Lin L., Zhu Y., Yao J., Wang C., Yin W., Huang L., Liu Y., Chen F., Shen J.. Establishment and characterization of a spinal cord tissue cell line from mandarin fish, Siniperca chuatsi and its susceptibility to several viruses. J. Fish Dis. 2022;45(10):1419–1427. doi: 10.1111/jfd.13671. [DOI] [PubMed] [Google Scholar]
  53. Ham R. G., Puck T. T.. Preparation and assay of enzymes. Methods Enzymol. 1962;5:90–119. doi: 10.1016/S0076-6879(62)05191-5. [DOI] [Google Scholar]
  54. Moreno-Mateos M. A., Vejnar C. E., Beaudoin J. D., Fernandez J. P., Mis E. K., Khokha M. K., Giraldez A. J.. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat. Methods. 2015;12(10):982–988. doi: 10.1038/nmeth.3543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Jao L. E., Wente S. R., Chen W.. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl. Acad. Sci. U. S. A. 2013;110(34):13904–13909. doi: 10.1073/pnas.1308335110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Lin C. Y., Oulhen N., Wessel G., Su Y. H.. CRISPR/Cas9-mediated genome editing in sea urchins. Methods Cell Biol. 2019;151:305–321. doi: 10.1016/bs.mcb.2018.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Campenhout C. V., Cabochette P., Veillard A. C., Laczik M., Zelisko-Schmidt A., Sabatel C., Dhainaut M., Vanhollebeke B., Gueydan C., Kruys V.. Guidelines for optimized gene knockout using CRISPR/Cas9. Biotechniques. 2019;66(6):295–302. doi: 10.2144/btn-2018-0187. [DOI] [PubMed] [Google Scholar]
  58. Varshney G. K., Carrington B., Pei W., Bishop K., Chen Z., Fan C., Xu L., Jones M., LaFave M. C., Ledin J., Sood R., Burgess S. M.. A high-throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish. Nat. Protoc. 2016;11(12):2357–2375. doi: 10.1038/nprot.2016.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Li Y., Jia P., Yu F., Li W., Mao C., Yi M.. et al. Establishment and characterization of a liver cell line, ALL, derived from yellowfin sea bream, Acanthopagrus latus, and its application to fish virology. J. Fish Dis. 2022;45(1):141–151. doi: 10.1111/jfd.13543. [DOI] [PubMed] [Google Scholar]
  60. Gjessing M. C., Aamelfot M., Batts W. N., Benestad S. L., Dale O. B., Thoen E.. et al. Development and characterization of two cell lines from gills of Atlantic salmon. PLoS One. 2018;13(2):e0191792. doi: 10.1371/journal.pone.0191792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Nanda, P. K. ; Priyabrat Swain, P. S. ; Nayak, S. K. ; Mishra, S. S. ; Pallipuram Jayasankar, P. J. . et al. Use of polymeric scaffold for in vitro growth of fibroblast-like cells of Indian major carp, Cirrhinus mrigala Adv. Anim. Vet. Sci. 2 3 177 182 10.14737/journal.aavs/2014/2.3.177.182. [DOI] [Google Scholar]
  62. Ruiz-Palacios M., Almeida M., Martins M. A., Oliveira M., Esteban MÁ., Cuesta A.. Establishment of a brain cell line (FuB-1) from mummichog (Fundulus heteroclitus) and its application to fish virology, immunity and nanoplastics toxicology. Sci. Total Environ. 2020;708:134821. doi: 10.1016/j.scitotenv.2019.134821. [DOI] [PubMed] [Google Scholar]
  63. Vijayakumar P., Ravi M., Sudhakaran R., Mekata T., Rajaswaminathan T.. Development and characterization of a skin cell line (SGA) from the mosquitofish Gambusia affinis and its susceptibility to fish Betanodavirus. Aquaculture. 2020;520:734778. doi: 10.1016/j.aquaculture.2019.734778. [DOI] [Google Scholar]
  64. Sahul Hameed A., Parameswaran V., Shukla R., Singh I. B., Thirunavukkarasu A. R., Bhonde R. R.. Establishment and characterization of India’s first marine fish cell line (SISK) from the kidney of sea bass (Lates calcarifer) Aquaculture. 2006;257(1–4):92–103. doi: 10.1016/j.aquaculture.2006.01.011. [DOI] [Google Scholar]
  65. O’Neill E. N., Ansel J. C., Kwong G. A., Plastino M. E., Nelson J., Baar K., Block D. E.. Spent media analysis suggests cultivated meat media will require species and cell type optimization. npj Sci. Food. 2022;6(1):46. doi: 10.1038/s41538-022-00157-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Gomez Romero S., Boyle N.. Systems biology and metabolic modeling for cultivated meat: A promising approach for cell culture media optimization and cost reduction. Compr. Rev. Food Sci. Food Saf. 2023;22(4):3422–3443. doi: 10.1111/1541-4337.13193. [DOI] [PubMed] [Google Scholar]
  67. Park S., Hong Y., Park S., Kim W., Gwon Y., Sharma H., Jang K. J., Kim J.. Engineering Considerations on Large-Scale Cultured Meat Production. Tissue Eng., Part B. 2024;30(4):423–435. doi: 10.1089/ten.teb.2023.0184. [DOI] [PubMed] [Google Scholar]
  68. Peng L. M., Zheng Y., You F., Wu Z. H., Tan X., Jiao S., Zhang P. j.. Comparison of growth characteristics between skeletal muscle satellite cell lines from diploid and triploid olive flounder Paralichthys olivaceus . PeerJ. 2016;4:e1519. doi: 10.7717/peerj.1519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Cooper J. K., Sykes G., King S., Cottrill K., Ivanova N. V., Hanner R., Ikonomi P.. Species identification in cell culture: a two-pronged molecular approach. In Vitro Cell. Dev. Biol.: Anim. 2007;43(10):344–351. doi: 10.1007/s11626-007-9060-2. [DOI] [PubMed] [Google Scholar]
  70. Goswami M., Belathur Shambhugowda Y., Sathiyanarayanan A., Pinto N., Duscher A., Ovissipour R., Lakra W. S., Chandragiri Nagarajarao R.. Cellular aquaculture: prospects and challenges. Micromachines. 2022;13(6):828. doi: 10.3390/mi13060828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Bennie R. Z., Ogilvie O. J., Loo L. S. W., Zhou H., Ng S. K., Jin A., Trlin H. J. F., Wan A., Yu H., Domigan L. J., Dobson R. C. J.. A risk-based approach can guide safe cell line development and cell banking for scaled-up cultivated meat production. Nat. Food. 2025;6(1):25–30. doi: 10.1038/s43016-024-01085-9. [DOI] [PubMed] [Google Scholar]
  72. Chi S. C., Hu W. W., Lo B. J.. Establishment and characterization of a continuous cell line (GF-1) derived from grouper, Epinephelus coioides (Hamilton): a cell line susceptible to grouper nervous necrosis virus (GNNV) J. Fish Dis. 1999;22(3):173–182. doi: 10.1046/j.1365-2761.1999.00152.x. [DOI] [Google Scholar]
  73. Lin C. Y., Yung R. F., Lee H. C., Chen W. T., Chen Y. H., Tsai H. J.. Myogenic regulatory factors Myf5 and MYOD function distinctly during craniofacial myogenesis of zebrafish. Dev. Biol. 2006;299(2):594–608. doi: 10.1016/j.ydbio.2006.08.042. [DOI] [PubMed] [Google Scholar]
  74. Yagi M., Ji F., Charlton J., Cristea S., Messemer K., Horwitz N., Di Stefano B.. et al. Dissecting dual roles of MYOD during lineage conversion to mature myocytes and myogenic stem cells. Genes Dev. 2021;35(17–18):1209–1228. doi: 10.1101/gad.348678.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Schnapp E., Pistocchi A. S., Karampetsou E., Foglia E., Lamia C. L., Cotelli F., Cossu G.. Induced early expression of mrf4 but not myog rescues myogenesis in the MYOD/myf5 double-morphant zebrafish embryo. J. Cell Sci. 2009;122(4):481–488. doi: 10.1242/jcs.038356. [DOI] [PubMed] [Google Scholar]
  76. Krishnan S., Ulagesan S., Cadangin J., Lee J. H., Nam T. J., Choi Y. H.. Establishment and Characterization of Continuous Satellite Muscle Cells from Olive Flounder (Paralichthys olivaceus): Isolation, Culture Conditions, and Myogenic Protein Expression. Cells. 2023;12(18):2325. doi: 10.3390/cells12182325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Kong X., Wang X., Li M., Song W., Huang K., Zhang F.. et al. Establishment of myoblast cell line and identification of key genes regulating myoblast differentiation in a marine teleost, Sebastes schlegelii . Gene. 2021;802:145869. doi: 10.1016/j.gene.2021.145869. [DOI] [PubMed] [Google Scholar]
  78. Zhu M., Sumana S. L., Abdullateef M. M., Falayi O. C., Shui Y., Zhang C., Zhu J., Su S.. CRISPR/Cas9 technology for enhancing desirable traits of fish species in aquaculture. Int. J. Mol. Sci. 2024;25(17):9299. doi: 10.3390/ijms25179299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Liang X., Potter J., Kumar S., Zou Y., Quintanilla R., Sridharan M.. et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J. Biotechnol. 2015;208:44–53. doi: 10.1016/j.jbiotec.2015.04.024. [DOI] [PubMed] [Google Scholar]
  80. Shiraki T., Kawakami K.. A tRNA-based multiplex sgRNA expression system in zebrafish and its application to generation of transgenic albino fish. Sci. Rep. 2018;8(1):13366. doi: 10.1038/s41598-018-31476-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Wang P., Liu Z., Zhang X., Li J., Sun L., Ju Z., Li J.. et al. CRISPR/Cas9-mediated gene knockout reveals a guardian role of NF-κB/RelA in maintaining the homeostasis of human vascular cells. Protein Cell. 2018;9(11):945–965. doi: 10.1007/s13238-018-0560-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Pascucci F. A., Ladelfa M. F., Toledo M. F., Escalada M., Suberbordes M., Monte M.. MageC2 protein is upregulated by oncogenic activation of MAPK pathway and causes impairment of the p53 transactivation function. Biochim. Biophys. Acta, Mol. Cell Res. 2021;1868(3):118918. doi: 10.1016/j.bbamcr.2020.118918. [DOI] [PubMed] [Google Scholar]
  83. Weng, S. ; Zhang, W. ; Ma, Z. ; Shi, S. ; Zhao, M. ; Ji, X. . et al. Construction of myostatin gene knockout C2C12 cell line and expression of related microRNA.
  84. Kuznetsov V. V.. RNA interference. An approach to produce knockout organisms and cell lines. Biochemistry (Moscow) 2003;68(10):1063–1076. doi: 10.1023/A:1026346325933. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are available in the manuscript


Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES