Abstract
In avian species, the chorioallantoic membrane (CAM) is a vital, highly vascularized extraembryonic structure that supports embryonic respiration, calcium transport, and innate immune defense. In this study, we applied LC/MS/MS-based proteomics to CAM tissue harvested at embryonic days (ED) 6, 8, 10, and 12 to characterize its protein profile during the expression of different CAM functionalities during embryonic development and gain insight into possible sex-based distinctions. A total of 2688 proteins were identified, with 2347, 2265, 2351, and 1267 proteins detected at ED 6, 8, 10, and 12, respectively. Notably, 1191 common proteins were identified across all stages, while 124, 47, 86, and 2 proteins were uniquely expressed at ED 6, 8, 10, and 12, respectively. Functional annotation revealed correlations with abundant CAM protein constituents (as per their emPAI); for example: calcium mobilization – v-type proton ATPase subunit E1 (ATP6V1E1) and G1 (ATP6V1G1); intracellular transport–calcium-binding protein 39 (CAB39); vascular system and gaseous exchange – annexin A2 (ANXA2); lymphatics–actin, gamma 1 (ACTG1); blood elements–hemoglobin subunit alpha-1 (HBA1); immune defense–cathelicidin-1 (CATH1), cathelicidin-2 (CATH2); and protection against luminal toxic contents–thioredoxin (TXN). Notably, a sex-specific analysis identified 614, 320, 314, and 212 proteins that were uniquely expressed in female embryos, and 212, 273, 144, and 56 proteins only in male embryos at ED 6, 8, 10, and 12, respectively. The identification of sex-linked proteins during early CAM development may provide insight into their functional roles and highlight the CAM’s potential as a target for the development of in-ovo sex identification technology.


1. Introduction
1.1. CAM Structure and Functions
Avian species are important research models for studying disease, angiogenesis, and tumorigenicity. , The chorioallantoic membrane (CAM) is a highly vascularized and multifunctional extraembryonic membrane that plays a vital and integral role in embryonic growth and development. , The CAM’s multiple functionalities and rapid development, as well as accessibility, offer a highly advantageous platform. The CAM plays a pivotal role in regulating gas exchange (blood vessels), mediating calcium mobilization and intracellular transport, contains a fully functional lymphatic system, and defends against pathogenic and toxic agents (antibacterial). , Table illustrates the critical developmental phases of CAM as the embryo progresses. Embryonic growth associated with the CAM is seen in the establishment of the germ layer, which is the onset of CAM formation, following the partial fusion of three tissue layers between ED 5–6: the outer chorion, a central mesodermal layer which is rich in blood vessels, and an inner allantois membrane, followed by critical vascular expansion (Figure and Table ), with further development to attach to the inner eggshell membrane (ESM). The progressive expansion and coordinated development of the chicken embryo and its CAM represent a series of intrinsic and extrinsic developmental events essential for embryogenesis. By ED 11–12, the CAM fully encloses the embryo, signifying the onset of the completion phase, during which structural and functional maturation of the extraembryonic membranes is achieved. ,,, At this stage, the vascular system undergoes extensive remodeling and expansion, culminating in the formation of a highly organized vascular plexus. This dense network of capillaries facilitates efficient respiratory gas exchange and simultaneously establishes a primary barrier of innate immune defense against microbial pathogens. Thus, the completion phase represents a critical developmental transition, ensuring the embryo’s survival and preparation for subsequent growth, leading to the emergence phase. At emergence, the CAM has reached peak vascular expansion and then degenerates as it is no longer needed, while the embryo has matured enough to hatch , (Table ).
1. Timing of Chick Embryo CAM Development Phases and Associated Critical Events.

1.

Fertilized White Leghorn egg shown under a high intensity Candler at A(ED6), B(ED8), C(ED10), and D(ED12) with a developing vascular system as the days pass, with a background yellow hue slowly turning red, reflecting the increased presence of blood vessels. Photographs were courtesy of Sofhian Ali. Copyright 2025.
1.2. CAM, Embryo Sex Prediction and Proteomics
The CAM’s accessibility and extensive capillary network make it a valuable model for molecular investigations and in vivo research. LC/MS/MS-based proteomics can aid in identifying developmental biomarkers, which may also reflect the sex of the embryo. In birds, a homozygous ZZ genotype results in a male, while the female (hen) has a heterozygous ZW genotype. A small number of sex-linked proteins, such as the SWIM-type zinc finger domain-containing protein (SWIM), are encoded solely by the W chromosome. Therefore, an analysis that confirms the presence or absence of W-chromosome-encoded proteins could predict embryo sex. In previous studies, CAM proteins have been identified, and functional bioinformatics analysis of the mature CAM’s role at ED12 and ED19 in the developing embryo has been conducted. The primary goal of the current study was to identify the protein constituents of the CAM at early time points (ED6, 8, 10 and 12) in both female and male embryos using a LC/MS/MS-based proteomics approach and investigate their association with development of key functional CAM pathways, including calcium mobilization, intracellular transport, defense against pathogen and luminal toxins, and lymphatics and vascular system development. Embryo sex was unambiguously determined using quantitative polymerase chain reaction (qPCR) of brain tissue to detect the W-specific SWIM gene, thereby further refining our analysis of proteomic results on a sex-specific basis. These sex-specific molecular insights into chick embryo developmental biology may pave the way for novel therapeutic strategies and diagnostic tools, offering a versatile platform for in-ovo sex prediction.
2. Experimental Section
2.1. Egg Incubation and Candling
Fertilized white leghorn eggs were obtained from the Canadian Food Inspection Agency (CFIA, Nepean, Ontario) and incubated in a Petersime Model 1 incubator (Petersime Incubator Co., Gettysburg, Ohio) with the broad end facing up. Eggs were candled (Titan Incubators, Malmesbury, England) on ED 0 to detect and eliminate any cracked or unfertilized eggs. No ethical approval was required for the in-ovo assessments, as all experimental groups and controls were terminated at ED16 by euthanization of embryos. All equipment was cleaned using 70% ethanol. Eggs were incubated until ED6, 8, 10, and 12, at which point the CAM and brain tissues were harvested and stored in Eppendorf tubes at −20 °C before molecular and proteomics studies. A total of 88 eggs were assessed during this study, of which 13 embryos yielded tissues that were subjected to proteomics analysis.
2.2. Sampling, Washing, and Sonication of CAM
Whole CAM samples were collected from embryos on ED 6, 8, 10, and 12, using scissors and forceps, and stored at −20 °C. CAM samples were washed by vortexing (Corning LSE, Massachusetts, USA) with 1× buffered saline (PBS) (CAM to PBS ratio was 1:5), varying by volume of sample, and then centrifuged using an AccuSpin Micro 17R (Fisher Scientific) (5000 rpm, 5 min, 4 °C). The supernatant containing residual egg yolk and egg white was removed. This step was repeated twice. The washed CAM samples were sonicated in 1× PBS at a 1:1 ratio using a Sonicator (Qsonica, Connecticut, USA) (40% amplitude, 1 min, with 3 s on and 2 s off intervals). Sonicated CAM samples were then stored at −20 °C until further analysis.
2.3. Sampling, Washing, and Purification of Brain Tissue
For purification and isolation of Genomic DNA, the Wizard Genomic DNA Purification Kit (Promega) was used, following the manufacturer’s protocol designed for the isolation of gDNA from Tissue Culture Cells and Animal Tissue. Briefly, whole brain tissue was collected from the same embryo used to collect whole CAM. Brain tissue (20 mg) was washed with the kit nuclei lysis solution (1:5 ratio of brain to nuclei lysis) by vortexing and then centrifugation (5000 rpm, 5 min, 4 °C). The tissue was homogenized using a Qsonica Sonicator in the nuclei lysis solution. gDNA was extracted following the kit user manual and stored at 4 °C overnight. Quality assessment and quantification of the purified DNA samples were performed using a NanoDrop 2000 Spectrophotometer, where the DNA concentration and absorbance ratios (A 260/A 280 and A 260/A 230) were determined.
2.4. Protein Concentration of CAM Samples
The protein concentration of CAM samples was measured using the Bicinchoninic acid (BCA) assay (Thermo Scientific Pierce BCA Protein Assay) with bovine serum albumin as the standard. Samples and standards (25 μL) were prepared in a 96-well plate, mixed with 200 μL of BCA working reagent, and then incubated at 37 °C for 30 min. Absorbances at 562 and 600 nm were measured using an Eon Microplate Spectrophotometer (BioTek) in dual wavelength mode.
2.5. Molecular Sexing Using Polymerase Chain Reaction (qPCR)
Quantitative Polymerase chain reaction (qPCR) was used to identify the sex of embryos, from which CAM tissue was also collected for subsequent proteomics. qPCR was performed in a 96-well PCR plate using a CFX96 Real-Time PCR instrument (BioRad 1000 Alfred Nobel Drive, Hercules, CA 94547, United States) in a 20 μL reaction volume containing iQ SYBR green supermix (10 μL), cDNA template (75 ng, variable), 0.3 μM forward and reverse primers (2.4 μL), and DNase/RNase-Free distilled water. cDNA (25 ng/μL, variable) was amplified by using specific primers for SWIM (a W-encoded, female-specific gene) and 12S (a housekeeping gene). Primers were specific for the W-encoded gene SWIM (SWIM-F: GAGATCACGAACTCAACCAG, SWIM-R: CCAGACCTAATACGGTTTTACAG) and the 12S ribosomal subunit (12S–F: CTATAATCGATAATCCACGATTCA, 12S-R: CTTGACCTGTCTTATTAGCGAGG). Primer stocks were 100 μM, while working dilutions of 5 μM were prepared for PCR reactions. For PCR, an initial denaturation step was performed at 95 °C for 3 min, followed by 35 cycles comprising DNA denaturation at 95 °C for 10 s, annealing at 57.3 °C for 20 s, and extension at 72 °C for 30 s. The melting curve analysis involved an increment of 0.5 °C every second/step from 55 to 95 °C. ΔCt values were used to calculate the relative gene expression. Target gene expression was compared with that of the housekeeping gene 12S using relative gene expression. Sex assignment was performed using the SWIM/12S ratio. The predictive criteria were as follows: a ratio (ΔC q SWIM/ΔC q S12) ≥ 2.0 indicated a male (absence of the W chromosome), while a ratio ≤1.5 indicated a female.
2.6. LC/MS/MS-Based Proteomics Analysis
Suspended CAM samples were submitted to the Proteomics Platform of the Eastern Quebec Genomics Centre (Laval, QC, Canada) for LC/MS/MS analysis. Peptide separation was performed using reversed-phase (RP) nanoscale capillary liquid chromatography (nanoLC), coupled to an Agilent 1200 nanopump and an AB Sciex 5600 mass spectrometer (Framingham, Massachusetts, USA), equipped with a nanoelectrospray ionization source. Data acquisition (ES-MS/MS) was conducted using Analyst software (Version 1.6, AB Sciex, Framingham, Massachusetts, USA). MS/MS peak lists were generated using Protein Pilot (Version 4.5, AB Sciex, Framingham, Massachusetts, USA) and interrogated against the REF_GGallus_cUP000000539_20220913_20220913.fasta; contaminants_thegpm_20200924 database (unknown version, 27599 entries) using Mascot (Version 2.4.0, Matrix Science, London, UK) and X! Tandem (CYCLONE version, 2010.12.01.1). Search parameters specified carbamidomethylation of cysteine as a fixed modification and included deamidation (NQ), N-terminal glutamine to pyroglutamate conversion (Gln → pyro-Glu), and oxidation (Met and Pro) as variable modifications.
2.7. Protein Identification
Proteomic data sets were analyzed and validated using Scaffold (version 5.3.3, Proteome Software Inc., Portland, OR, USA) against the NCBI Chicken database (http://www.ncbi.nlm.nih.gov/protein). Sequence validation employed BLASTP searches of nonredundant protein sequences using FASTA inputs, with confirmation based on query coverage, E-value, and Percent identity metrics. Redundant and contaminant proteins were excluded from the final inventory. Peptide identifications were accepted at ≥95% probability, and protein identifications were filtered at a 1% false discovery rate (FDR) at both peptide and protein levels, requiring at least one unique peptide, with an emphasis on unique peptide count. To serve as a false-positive control, 41 decoys were used to validate the analysis.
2.8. Bioinformatics Analysis
Gene ontology (GO) terms for proteins identified in the CAM (days 6, 8, 10, and 12; male and female embryos) were determined using DAVID functional annotation, and Bioinformatics Microarray Analysis (https://davidbioinformatics.nih.gov/summary.jsp) for the clustering tables, with P-value significance as the basis for clustering (P < 0.05). Cluster numbers with corresponding functional GO terms are identified for tables to compare common male–female functions, as well as unique female and unique male functional annotations at each time point: ED 6, 8, 10, and 12. Each GO term corresponded to an EASE score (a modified Fisher Exact P value and high enrichment value), using GOTERM_BP. An enrichment score of less than (EASE < 1.0) was discarded from the functional annotation analysis. DAVID Bioinformatics Resources was also used for pathway mapping of the entire protein list via Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses (https://bioinformatics.sdstate.edu/go/), with a threshold of P < 0.05. Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway dot graphs were generated from the website. Enrichment analyses with a threshold of FDR < 0.05 for the P values and 25 pathways shown. Venn diagrams were generated using PowerPoint, and protein analysis was conducted in Excel. All figures were generated using Microsoft Office (PowerPoint and Excel), the open-source software GIMP (version 2.10), and Adobe Photoshop CS (version 8.0).
3. Results
The structural expansion of the CAM during development is depicted in Figure , which shows images of fertilized White Leghorn eggs photographed under a high-intensity candler at time points ED 6, 8, 10, and 12. A developing vascular system is observed as the yellow hue turns red with an increased level of blood vessel growth. A comprehensive analysis of CAM proteomics data identified its protein constituents at the following early developmental time points: ED 6, 8, 10, and 12. Further analysis identified unique and common proteins in female and male embryos at these time points. A total of 13 CAM tissue samples were extracted and processed for analysis at the Université Laval proteomics platform, comprising 3 of ED6 samples (2 females, 1 male), 4 of ED8 samples (2 females, 2 males), 4 of ED10 samples (2 females, 2 males), and 2 of ED12 samples (1 female and 1 male), with sex determined using qPCR to verify the presence or absence of the W-encoded SWIM gene (experimental section). The temporal distribution of identified common and unique CAM proteins during early chick embryo development is shown in Figures and . A total of 2688 proteins were identified in the final inventory dataset (Table S1). Raw and level 1 datasets were deposited in the cloud-based communal Mendeley repository (https://data.mendeley.com/datasets/967dc5z8tv/1). Figure , panel A, shows a compound Venn diagram displaying the distribution of identified unique and common proteins at ED 6, 8, 10, and 12. Unique proteins identified in the compound Venn diagram at ED6, 8, 10, and 12 were 124, 47, 86 and 2, respectively, with 191 proteins being common to all time points (Figure A). Further analysis of proteins uniquely identified at each time point using KEGG pathway analysis revealed 9, 0, 1, and 1 pathways at ED6 (Figure B), ED8, ED10 (Figure C), and ED12 (Figure D), respectively. In addition, the KEGG pathway analysis of proteins common to all time points revealed 25 various functional pathways (Figure E). This enrichment analysis highlights significant pathways based on common and specific biological processes across different time points, thereby showcasing pathways that are both common and specific. Further analysis revealed the number of unique and common proteins between male and female embryos at various time points (ED 6, 8, 10, and 12; Figure ). The total number of proteins identified in the CAM tissue samples was 2347, 2265, 2351, and 1267 for ED6, 8, 10, and 12, respectively. At ED6, 2347 proteins were identified, with 2135 in females and 1733 in males; 614 were female-specific, 212 male-specific, and 1521 shared. At ED8, 2265 proteins were found (1992 female, 1945 male), with 320 female-specific, 273 male-specific, and 1672 common. At ED10, 2351 proteins were identified (2207 female, 2040 male), including 311 female-specific, 144 male-specific, and 1896 shared. At ED12, 1267 proteins were detected (1211 female, 1055 male), with 212 female-specific, 56 male-specific, and 999 common (Figure ). KEGG enrichment analysis was also performed for proteins identified at different time points (ED 6, 8, 10, and 12) for both male- and female-specific CAM samples to identify significant functional pathways. Figure illustrates the enriched pathways for the four developmental time points: ED 6, 8, 10, and 12. The first panel displays significant pathways for female-specific proteins, the second panel shows male-specific pathways, and the third panel illustrates the commonalities of significantly enriched pathways shared by both male and female samples. For ED6, all panels displayed 25 significantly enriched pathways, with some panels having a high number of proteins (>50) identified for certain biological processes. KEGG analysis of proteins identified in ED8 showed 25 significantly enriched pathways for all panels. KEGG pathway analysis of proteins identified at ED10 revealed 25 significant pathways specific to females and common to both sexes, whereas only 3 were identified for male-specific proteins. KEGG pathway analysis of proteins identified at ED12 revealed 25 pathways specific to females, 25 common to both females and males, and 18 specific to males. The most enriched pathways include cellular component organization, which is highly enriched at ED 6, 8, and 10. In addition, a protein-containing complex was highly enriched in the small molecule metabolic process, especially at ED6, while the organonitrogen metabolic process is observed at ED8 and ED12. The signaling pathway is particularly prominent at ED10 in male samples, where it is one of only three pathways identified. Functional insights were obtained using DAVID bioinformatics tools, which identified functional annotations for specific proteins at different time points. Functional annotation analysis was also conducted for sex-specific and common proteins using Gene Ontology (GO) term enrichment analysis. Table summarizes the protein families identified in the proteomics data across various time points. The main protein families identified in ED 6, 8, 10, and 12 include collagens, translation initiation factors, serpins, heat shock proteins, and heterogeneous nuclear ribonucleoprotein, along with heat shock, motor, and cellular death proteins. Table S2 presents the number of functional clusters identified by DAVID, based on common and unique proteins in female and male CAM tissue samples. The total number of predicted functionalities for proteins identified at ED 6, 8, 10, and 12 was 20, 18, 21, and 17, respectively. All DAVID analyses of functionalities were subjected to a cutoff criterion of the enrichment score (EASE < 1.0), ensuring that only pathways and biological processes with statistically meaningful enrichment were included in functional interpretation. The carbohydrate metabolic process (GO:0,005,975) exhibited the highest number of proteins across different time points: ED 6 (32), ED 8 (30), ED 10 (33), and ED 12 (23), reflecting the importance of synthesizing and converting carbohydrates to provide energy and build structural components during embryonic development. The tricarboxylic acid cycle (GO:0,006,099) functionality was also highly enriched across developmental time points, with multiple proteins identified at ED 6 (24), ED 8 (23), ED 10 (25), and ED 12 (23). Other highly enriched functionalities include the translation initiation factor activity (GO:0,003,743), which is highly enriched in ED 6 (26) and ED 10 (30) proteins, as well as barbed-end actin filament capping (GO:0,051,016) identified in ED8 (12) proteins. The unfolded protein binding (GO:0,051,082) and ATP hydrolysis activity (GO:0,016,887) are enriched in ED12, with 30 and 25 proteins identified as related to these functional roles, respectively. Enriched functionalities identified in female samples at ED6 include autophagy (GO:0,006,914, 7 proteins) and hyaluronic acid binding (GO:0,005,540, 5 proteins), while at ED8, phosphatidylcholine transporter activity (GO:0,008,525, 3 proteins) was identified. In addition, autophagy (GO:0,006,914, 5 proteins) was identified in female samples at ED10. Figure presents a functional mapping diagram of the various CAM samples and their associated proteins, highlighting the significant roles of these proteins at various time points for each sex. Figure presents a heatmap of 177 proteins identified as the most important functional constituents of CAM development among the total CAM proteome (2688 proteins). These proteins have roles in structural integrity, signaling, and metabolic processes and are hierarchically categorized based on their abundance (emPAI values). On the other hand, Table S3 lists the top 100 most abundant protein constituents in the entire proteomics data set, as per their emPAI values. Among these, 48 proteins are also identified in the heatmap (Figure ). The heat map revealed clear trends in protein abundance across ED 6–12. Among the highest expressed proteins were structural and metabolic proteins such as hemoglobin subunits alpha 1 (HBA1), alpha D (HBAD), beta A (HBBA), epsilon (HBE), beta R (HBBR), zeta (HBZ), and epsilon 1 (HBE1), which consistently showed emPAI values in the upper ranges (5–10 to >500), reflecting their dominant roles in oxygen transport and nutrient supply during development. In contrast, the lowest abundance proteins were specialized regulatory or signaling proteins such as ferrochelatase (FECH), fibrinogen beta chain (FGB), fibrinogen gamma chain (FGG), G protein subunit alpha Q (GNAQ), heme oxygenase 1 (HMOX1), heme oxygenase 2 (HMOX2), cytochrome P450 family 2 subfamily C member 18 (CYP2C18), calbindin 1 (CALB1), integrin alpha 9 (ITGA9), galectin 2 (LGALS2), mitochondrial calcium uptake 2 (MICU2), myoferlin (MYOF), phospholipase C gamma 1 (PLCG1), protein O-fucosyltransferase 1 (POFUT1), protein O-fucosyltransferase 2 (POFUT2), protein phosphatase 3 catalytic subunit alpha (PPP3CA), proteasome 26S subunit ATPase 1 (PSMC1), proteasome assembly chaperone 1 (PSMG1), serpin family B member 5 (SERPINB5), stromal interaction molecule 1 (STIM1), sulfotransferase family 1E member 1 (SULT1E1), tubulin beta 6 class V (TUBB6), and vitelline membrane outer layer 1 homologue (VMO1), which appeared in the lowest emPAI category (0–0.25 to 0.5–1). Figure presents the functional categorization of 52 chicken proteins associated with angiogenesis. Protein groups are classified in major functional categories; ECM components, including collagens (COL1A1, COL1A2, COL4A1, COL4A2, and COL6A13), laminins (LAMA5, LAMB2, and LAMC1), nidogens (NID1, NID2), and fibronectin (FN1), were detected, highlighting a robust basement membrane structure supporting endothelial cell attachment and vessel stabilization. Proteins associated with cytoskeletal dynamics and cell–matrix interactions, such as ITGA1, ITGA9, ITGAV, ITGB1, ITGB3, VCL, ACTG1, and TLN1, were also identified, suggesting endothelial migration and sprouting. Antioxidant and metabolic regulators (SOD2, PRDX3,4 and 6, GPX1, HMOX1 and 2) are consistent with high metabolic demand and oxygen-regulated vessel growth. Collectively, the protein profile demonstrates a microenvironment optimized for rapid vascular expansion, consistent with CAM development between ED6–12. This perspective illuminates how structural, metabolic, and regulatory factors coordinate the progression of angiogenesis. Each protein group is associated with key angiogenic stages: endothelial activation, ECM degradation, sprouting, migration, and tube (lumen) formation. Overall, core structural, transport, and metabolic proteins dominate CAM proteomic profiles, while enzymes, modulators, and signaling proteins are less abundant during development.
2.
Compound Venn chart panel A displaying the distribution of identified common and unique CAM proteins for ED 6, ED8, ED10, and ED12 and proteins identified in all four time points. Kegg pathway analysis, shown as a dot plot of clusters based on time points ED6 (B), ED10 (C), ED12 (D), and the combined clusters of ED6, 8, 10, and 12 (E), identifies clusters with P-values <0.05. The size of the circles reflects the number of proteins in each pathway, and the color gradient indicates the significance of the proteins within each pathway.
3.

Venn chart displaying the distribution of numbers of identified common and unique CAM proteins between female and male samples during development. Panel A: ED 6, Panel B: ED8, Panel C: ED10, and Panel D: ED12.
4.
KEGG pathway analysis. Panel ED6, ED8, ED10, and ED12 as a dot plot. Each Kegg displays female, male, unique, and common identified clustering functions with P-values <0.05. The size of the circles reflects the number of proteins in each pathway, and the color gradient indicates the significance of the highest P value (red) and the lowest P value (blue) for ED6, the highest P value (green) and the lowest P value (orange) for ED8, the highest P value (yellow) and the lowest P value (blue) for ED10 and the highest P value (red) and the lowest P value (green) for ED12.
2. Summary of Protein Family Clusters Identified at All Timepoints of CAM Development (ED6, 8, 10, and 12).
| no. | protein family name | family members identified in CAM |
|---|---|---|
| 1 | collagens | COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL4A2, COL4A5, COL5A1, COL5A2, COL6A1, COL6A2, COL6A3, COL11A1, COL12A1, COL14A1 |
| 2 | translation initiation factor | DENR, EIF1AX, EIF2S1, EIF2S2, EIF2S3, EIF2A, EIF3A, EIF3B, EIF3E, EIF3F, EIF3H, EIF3I, EIF3J, EIF3K, EIF3L, EIF3M, EIF3G, EIF4G1, EIF4G2, EIF4G3, EIF4A2, EIF4E, EIF5, EIF5A2, EIF5B, EIF6 |
| 3 | DEAD-box helicase | DDX1, DDX17, DDX19, DDX3X, DDX42, DDX46, DDX5, DDX6 |
| 4 | heat shock protein | DNAJA2, DNAJB1, DNAJB11, DNAJC1, DNAJC10, DNAJC3, DNAJC7, DNAJC8, DNAJC9, HSPA5, HSBP1, HSP90AB1, HSP90B1, HSPA14, HSPA2, HSPA4, HSPA4L, HSPA8, HSPA9, HSPB1, HSPD1, HSPE1, HSPH1 |
| 5 | motor proteins | DNAAF10, DYNC1H1, DYNC1I2, DYNC1LI1, DYNC1LI2, DYL1, DYNLRB1, DYNLT1, KIF13B, KIF15, KIF16B, KIF26B, KIF5B, KIF7 |
| 6 | integrins | ILK, ITGA1, ITGA4, ITGA9, ITGAV, ITGB1, ITGB3 |
| 7 | cadherins | CDH1, CDH2, CDH3, CDH5, CDH6, CDH11, CDH13, CDH17 |
| 8 | heterogenous nuclear ribonucleoprotein | HNRNPAB, HNRNPA0, HNRNPA1, HNRNPA2B1, HNRNPA3, HNRNPD, HNRNPDL, HNRNPH1, HNRNPH3, HNRNPKL, HNRNPLL, LOC101749377, HNRNPM, HNRNPR, HNRNPU, HNRNPUL1 |
| 9 | laminin protein | LAMA2, LAMA4, LAMA5, LAMB4, LAMC1, LAMB2 |
| i | Insulin growth factor | IGF1R, IGF2BP1, IGF2BP3, IGF2R, IGFBP2, IGFBP7 |
| 11 | zinc finger protein | ZC3HC1, ZC3H11A, ZC3H15, ZC3H18, ZNF207, ZNF326, ZRANB2, LOC427010, ZPR1 |
| 12 | transport channels Na+/K+-ATPase and H+ | ATP6 V1A, ATP6 V1B2, ATP6 V1C1, ATP6 V1E1, ATP6 V1G1, ATP6 V1H, ATP1A1, ATP1B1 |
| 13 | histones | H-10, H1–01, H1–10, H1–1R, H2AC39, H2A2BL, H2AZ1, H2BC32, H3–3A, H4C37, H4C38 |
| 14 | carbonic anhydrase | CA2, CA8, CA9, CA13 |
| 15 | annexin | ANXA1, ANXA2, ANXA4, ANXA5, ANXA6, ANXA7, ANXA8L1, ANXA11 |
| 16 | serpin | SPIA4, SPIA1, SPIA5, SERPINA10, SERPINB1, SERPINB5, SERPINC1, SERPIND1, SERPINF1, SERPINF2, SERPING1, SERPINH1, SERPINI1, SERPINB6 |
| 17 | peroxiredoxin | PRDX1, PRDX3, PRDX4, PRDX6 |
| 18 | charged multivesicular body protein | CHMP2A, CHMP4B, CHMP5, CHMP6, CHMP7 |
| 19 | cellular death proteins | CASP1, CASP3, CASP6, CASP7, CASP8, CASP9, CTSA, CTSB, CTSC, CTSD, CTSH, CTSK, CTSS, CTSV, CTSZ |
| 20 | tubulin | TUBA1A, LOC100857858, TUBB1, TUBB2B, TUBB4B, TUBB6, TUBB, TUB5A |
5.
Mapping of CAM functionalities to proteomics results. A CAM proteomic map highlighting the CAM functionality: Ca2+ transport (Intracellular Ca2+ transport and Ca2+ mobilization from the eggshell), the vascular system (blood elements, blood vessels, and lymphatics), and protection against pathogen invasion and luminal toxic contents, highlighted with their associated proteins. ED6 (yellow), ED8 (red), ED10 (green), and ED12 (blue) rings represent the different time points at which these proteins were identified in male (black line) and female (white line) samples; proteins common to both sexes are represented by a dotted line. Proteins were selected using the following emPAI value thresholds: Blood vessels (emPAI > 0.5), Lymphatics (emPAI > 0.1), defense against luminal toxic contents (emPAI > 0.5), and protection against pathogen invasion (emPAI > 0.2).
6.

Heatmap of key CAM protein constituents playing critical roles in CAM development and embryonic growth. These proteins are grouped based on their abundance (emPAI values) across the developmental stages ED6, ED8, ED10, and ED12. The color thresholds indicate emPAI abundance, from red (The highest protein abundance recorded was an emPAI value of 1018.60) to green (low abundance). Proteins not detected (ND) are assigned gray.
7.

Functional categorization of 52 CAM proteins associated with angiogenesis. (A). The upper panel groups proteins into major functional categories, including ECM components, integrins, annexins, redox regulators, signaling-associated glycoproteins, and transporters, as well as metabolic, cytoskeletal, and lipid-signaling proteins. These groups illustrate how structural, metabolic, and regulatory factors coordinate/reflect the progression of CAM angiogenesis. (B) The lower panel outlines the key angiogenic stages: endothelial activation, ECM degradation, sprouting, migration, and tube (lumen) formation.
4. Discussion
The chick embryo CAM is a popular vascularized model used in various biomedical studies due to its rapid growth and accessibility. The CAM is extensively used in angiogenesis, tumor graft, drug delivery, and toxicity studies. The CAM is the avian homologue of the mammalian placenta , as both extraembryonic tissues carry out a wide array of similar functions essential for embryo viability, growth, and development. The highly vascularized CAM tissue begins to develop after the fusion of the allantois with the chorion between days 5 and 6, surrounding the embryo by ED11–12. , This study provides an extensive proteomic characterization of the chick embryo CAM across early developmental time points. The selected four time points (ED 6, 8, 10, 12) encompass the early formation and maturation of the CAM, while previous CAM proteomic studies with white Leghorn embryos have focused on the fully functional CAM at ED 12 and 19, , or in a specialized breed of Tibetan chickens at ED 6, 10, 14, and 18. The time course of expression of the CAM proteome from male and female embryos may have specific differences, in addition to many common proteins, that reflect sex-specific functionalities or differences in their developmental rates, since male embryos develop faster. To gain further insight into the underlying complexity of CAM contribution to embryonic growth and development, sex-specific protein expression was therefore investigated concerning the main functions of the CAM: gaseous exchange (blood vessels), blood elements and calcium mobilization, lymphatics, and pathogenic and toxic content defense (antibacterial). , To better understand the functional and physiological complexity of CAM, we sought to establish a proteomic foundation for the essential functions associated with development and to identify potential sex-linked differences. The CAM fulfills several primary functions that integrate ancillary roles within a broader framework. The roles of the CAM’s molecular constituents underpinning embryonic development were elucidated, with a focus on the vascular system, calcium transport, and defense against pathogens and toxic agents.
4.1. Proteomic Features of the CAM Vascular System during Development
4.1.1. Angiogenesis
The chick embryo vascular system is essential for development, and it is a crucial constituent of the CAM. The vascular system supports the embryonic life of a chick embryo. In the early stages of embryonic life, starting from ED (3–5), the embryo undergoes morphogenesis, during which most of the organs and functions begin to form and establish baseline activities for further growth. Thus, vascular system formation is initiated, the heartbeat commences, and limb development progresses, culminating in the emergence of wings and legs. The formation of the CAM begins as early as ED 4, and by ED 5–6, the CAM has started to conduct gaseous exchange, and vascular network expansion begins as it is established but not yet mature , (Table ). In our proteomics study, numerous proteins associated with gas exchange and the development of the small capillary network of thin vessels were identified, as shown in Figures and . Proteins in the annexin superfamily (A1, A2, A5, A7, A8-like 1) (Table 3) are among the proteins identified. A similar proteomic study identified the same annexin family members in CAM tissue samples at ED12 and ED19. Annexins are particularly important in cell signaling, membrane repair, and structural development, as well as in Ca2+ transport. Studies have shown that annexins are involved in angiogenic activity, either by reducing or increasing angiogenesis. , In the current study, annexin A2 is a highly abundant protein (Figure ), compared with the other proteins listed for the blood vessel category in Figure , with ED6 and ED12 showing higher levels than ED8 and ED10. Similarly, other proteins, such as but not limited to nidogen (1 and 2), are important for ECM development, decorin, malate dehydrogenase 2, aconitase 2, peroxiredoxin (3, 4, and 6), and glutathione peroxidase 1, are related proteins involved in CAM vascularization, which have roles in metabolic reactions, signaling, and as transporters. Other identified proteins including, protein cytochrome C, somatic (CYCS), laminin subunit (beta-2, alpha-5, gamma-1), catenin (alpha-1 and beta-1), and ubiquinol-cytochrome c reductase core protein 1 (UQCRC1), the collagen protein family (collagen subunits 1a1, 1a2, 3a1, 4a1, 4a2, 5a2, 6a1, 6a2, 6a3, 11a1 and 12a1) were seen associated with GO:0,005,201 extracellular matrix structural constituent functional DAVID cluster, fibulin (1 and 2), and integrin subunit (alpha-V, beta-1, alpha-9, alpha-1, beta-3). The detected protein network reflects the CAM’s highly angiogenic nature during these developmental stages. Figure underlines the relationship between angiogenic proteins and vascular formation. Structural ECM proteins (collagens, laminins, and nidogens) reflect the mature yet dynamic basement membrane that provides a scaffold for endothelial sprouting. Their interaction with integrins (ITGA1, 9, V, ITGB1, and 3) supports coordinated cell adhesion, migration, and capillary branching. Figure also highlights redox regulators (PRDX 3, 4, and 6, HMOX1,2, SOD2), which play a protective role against endothelial damage during the oxidative stress associated with rapid vascular growth and the increasing metabolic demands of the embryo. Catenin beta-1 (Figure ) is a canonical signaling pathway associated with tissue regeneration related to cytoskeletal roles. , Fibulins play important roles in tissue remodelling, basement membrane formation, and the structural integrity of elastic fibers. Integrins, a family of heterodimeric transmembrane proteins, mediate cell adhesion to the extracellular matrix. Integrin subunits can heterodimerize in at least 20 different combinations. The integrin protein (alpha V-beta 3) combination of those subunits may have a role in the angiogenetic activity of CAM. Modulation of the CAM composition of collagen type IV, fibronectin, laminin, and glycosaminoglycan-associated proteins is associated with angiogenesis. ,, This protein landscape explains why CAM is widely used as an in vivo angiogenesis model, as highlighted by the results of this proteomics study.
4.1.2. Hematopoiesis and Plasma Protein Biosynthesis
Our proteomics study identified key blood proteins of the CAM. These include hemoglobin subunit beta-A (HBBA), beta-R (HBBR), alpha-1 (HBA1), delta (HBAD), epsilon-like (HBE/HBE1), and zeta-globin (HBZ). These proteins are the most abundant, as shown in our heatmap (Figure ), where most blood proteins exhibit an emPAI > 500. These proteins were the most abundant at ED8 and ED12. Iron homeostasis is supported by the expression of transferrin receptor (TFRC), transferrin (TF), and ferritin heavy chain 1 (FTH1), which is especially notable at days 6 and 8. ALB (albumin), the most abundant protein in the blood plasma, alpha-2-macroglobulin (A2M), and protein Z-dependent protease inhibitor (SERPINA10) are expressed across the time points, most prominently at day 6 and 8, supporting protease inhibition and nutrient transport functions in the developing vascular system within the blood. Coagulation factors, such as F2 (thrombin), have been shown to promote angiogenesis in the developing CAM. , In contrast, von Willebrand factor (VWF) is a procoagulant that mediates platelet aggregation. Although FGA, FGB, and FGG were detected in the proteomic profile, their comparatively low emPAI values suggest limited relative abundance within the sample proteome.
4.1.3. Lymphatic System
Lymphatics is another important component of the vascular system. The CAM has a similar lymphatic system to that of a mammalian lymphatic system, and our study provides insights into lymphangiogenic activity occurring from day 6 to day 12 of embryonic development. Lymphatics are first noticeable in chick embryos at ED 4–5, whereas lymphangiogenesis begins at ED 5–9. , Some of the proteins identified in our study and are involved in lymphatics development include desmoplakin (DSP), mitogen-activated protein kinase 3 (MAPK3), PDZ and LIM domain protein 3 (PDLIM3), proteasome assembly chaperone 1 (PSMG1), mannose receptor C Type 2 (MRC2), junction plakoglobin (JUP), neuropilin-1 (NRP1), myoferlin (MYOF), collectin subfamily member 12 (COLEC12), vascular endothelial, cadherin (CDH5), actin, gamma 1 (ACTG1), myosin heavy chain 9 (MYH9), myosin light chain 12A (MYL12A), filamin A (FLNA), vinculin (VCL), vimentin (VIM), talin-1 (TLN1), integrin-linked kinase (ILK), vascular cell adhesion molecule 1 (VCAM1), fibronectin 1 (FN1), secreted protein acidic, and rich in cysteine (SPARC) and periostin (POSTN). The heatmap reveals a coordinated molecular signature comprising endothelial-specific adhesion molecules (VCAM1, CDH5/VE-cadherin) mediating leukocyte adhesion and junctional integrity, desmosomal components (JUP/plakoglobin, DSP/desmoplakin) establishing intercellular adhesion complexes for vascular and lymphatic stabilization, cytoskeletal regulators (ACTG1, VCL, VIM, TLN1) facilitating motility and morphological remodeling, extracellular matrix effectors (FN1, SPARC) driving ECM restructuring for endothelial migration and vessel morphogenesis, , collagen receptor MRC2 promoting ECM degradation during lymphatic sprouting, and signaling receptors (NRP1, COLEC12) implicated in VEGF-mediated endothelial specification, vessel organization, and innate immune-like activity, , collectively delineating a dynamic yet tightly orchestrated transition from an actively migratory to a vessel-maintenance phenotype that underpins regulated lymphangiogenic and vasculogenic patterning during embryonic CAM development.
4.2. Ca2+ Transport
The CAM plays a pivotal role in mobilizing calcium from the eggshell (ES) and delivering it to the developing embryo for skeletal development. Calcium mobilization and transport are coordinated through carbonic anhydrases, ion transporters, and calcium-binding proteins. CAM proteomic analysis across ED 6–12 identified numerous proteins involved in calcium-related functions.
Certain identified proteins in our study related to calcium mobilization include carbonic anhydrase II (CA2), XIII (CA13) and IX (CA9), v-type proton ATPase subunit E1 (ATP6V1E1) and G1 (ATP6V1G1), plasma membrane calcium-transporting ATPase 4 (ATP2B4) and sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (ATP2A2), calbindin 1 (CALB1) and calreticulin (CALR), annexin A1 (ANXA1), A2 (ANXA2), A5 (ANXA5) and A6 (ANXA6), collagen type I alpha 1 chain (COL1A1), alpha 2 chain (COL1A2), type IV alpha 1 chain (COL4A1), type IV alpha 2 chain (COL4A2), fibrillin-1 (FBN1), lumican (LUM), decorin (DCN), matrix metalloproteinase-2 (MMP2), cathepsin K (CTSK), periostin (POSTN), tenascin C (TNC) and vitelline membrane outer layer protein 1 homologue (VMO1). The carbonic anhydrase isozymes are markers of the villus cavity cells of the ectodermal and endodermal epithelium; their expression is involved in CAM-mediated processes, such as calcium transport. CAM carbonic anhydrase activity is correlated with calcium transport-related functions. Carbonic anhydrases catalyze the hydration of CO2, generating protons that acidify the ES to promote calcium solubilization. ,,,,, In our study, we identified low levels of CA2, CA13, and CA9 in the CAM proteome at ED 6, 8, and 10 (Figure ), with emPAI values ranging from 0.25 to 1, and at ED12, not detectable for CA9. The presence of these proteins correlates with the presence of ATP-driven ion pumps, including the ATP6V1E1 and ATP6V1G1 proteins, which are constituents of the vacuolar H+-ATPase (V-ATPase) complex. This complex further facilitates proton transport into the (ESM/ES) interface. , Expression of extracellular matrix (ECM) components, such as COL1A1, COL1A2, COL4A1, COL4A2, FBN1, and DCN, as well as LUM, contributes to the extracellular matrix structure of the CAM. Periostin (POSTN) and tenascin C (TNC), both involved in osteogenic ECM dynamics. Calcium mobilization from the eggshell is a crucial process facilitated by CAM, which enables the solubilization of calcium ions necessary for embryonic growth and skeletal development.
Intracellular calcium transport in CAM cells is tightly regulated by several distinct networks that play a crucial role in delivering calcium via transport mechanisms during embryonic development. Proteomic analysis across ED 6–12 reveals key proteins for maintenance of calcium homeostasis, including protein S100-A11 (S100A11), sodium/potassium-transporting ATPase subunit beta-1 (ATP1B1), calcium-binding protein 39 (CAB39), calcineurin B homologous protein 1 (CHP1), sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (ATP2A2), stromal interaction molecule 1 (STIM1 not detectable at ED12), calmodulin-1 (CALM1), protein S100-A10 (S100A10), and calcium/calmodulin-dependent protein kinase type II delta chain (CAMK2D). These proteins are listed in the heatmap (Figure ), with moderate emPAI values. S100 family members and calmodulin-1 (CALM1), and calcium-binding protein 39 (CAB39) are calcium-binding proteins.
4.3. Innate Immune Defense
4.3.1. Defense against Luminal Toxic Contents
The ES acts as the first line of defense against pathogens, and the CAM plays a role as the second line of defense. The innermost layer of the CAM is the allantois, derived from a sac-like structure that emerges from the ventral wall of the endodermal hindgut. It is a reservoir for metabolic waste. Our proteomic analysis, spanning ED6 to ED12, identifies CAM constituents that may play a significant role in protecting the embryo from luminal toxins. Our proteomics has identified several proteins related to barrier function, including heat shock proteins, protein 90 alpha family class B member 1 (HSP90AB1), and heat shock protein 5 (HSPA5). Sulfotransferase proteins were also identified (SULT1B1, SULT1C3, and SULT1E1), as well as other proteins such as disulfide-isomerase (PDIA4 and PDIA6), cathepsin (CTSB and CTSK), and proteasome subunit alpha type-1 (PSMA1), beta type-1 (PSMB1), and 26S proteasome regulatory subunit (PSMC1). Glycosylation enzymes are also identified, including alpha-L-fucosidase 2 (FUCA2), signaling protein cell division control protein 42 homologue (CDC42), and glycosylation enzymes protein O-fructosyltransferase 1 and 2 (POFUT1 and POFUT2). Antioxidant enzymes, including superoxide dismutase (SOD1 and SOD2), catalase (CAT), glutathione transferase family members kappa 1 (GSTK1), and glutathione s-transferase alpha (GSTA2, GSTA3 and GSTA4) serve as important antioxidant defense systems for protection during embryonic development. Redox regulators also play an important role in antioxidant activity, including peroxiredoxin (PRDX1, PRDX4, and PRDX6), thioredoxin (TXN), thioredoxin domain-containing protein 5 (TXNDC5), and glutathione peroxidase 1 (GPX1). Detoxification proteins, include cytochrome P450 2C18 (CYP2C18), aldehyde dehydrogenase family member 1A1 (ALDH1A1), and aldehyde dehydrogenase family member 5A1 (ALDH5A1). Finally, protein 90 alpha family class B member 1 (HSP90AB1) and glycosylation enzymes FUCA2 (fucosidases), POFUT1 and POFUT2 (fucosyltransferases) are the main enzymes involved in the incorporation and cleavage of l-fucose residues. Superoxide dismutases (SOD1/SOD2) are ubiquitous enzymes found in all aerobic organisms. The SOD proteins help control reactive oxygen species, limiting toxicity and conferring protection against oxidative stress. CAT catalyzes the dismutation of hydrogen peroxide to form the neutral products water and oxygen. Glutathione s-transferase alpha (GSTA2 and GSTA4) both play a role in detoxification, and GSTA2 is highly important against oxidative stress in the chick embryo. , Our gaseous environment inherently generates reactive oxygen species in biological tissues. To protect embryonic development, a robust redox defense system is crucial for maintaining barrier integrity. The thioredoxin-peroxiredoxin (TXN–PRDX) system balances the activity of hydrogen peroxide generated through mitochondrial cellular respiration. The TXN protein is most abundant for this functionality across ED 6–12, with emPAI values ranging from 5 to 25. ALDH1A1 and ALDH5A1 belong to a family of aldehyde dehydrogenases that share similar functions with thioredoxin-peroxiredoxin, which are related to the control of oxidative stress and cell damage, and represent additional detoxifying proteins in organisms that help control reactive oxygen species. Heat shock proteins were also identified in the CAM proteome, which play a crucial role in regulating protein folding and stress response. DAVID-based functional annotation revealed functionality related to the embryo associated with heat shock protein roles, including GO:0,031,072 heat shock protein binding and GO:0,044,183 protein folding chaperone, at all time points (Table S2a–e). The cluster cell redox homeostasis (GO:0,045,454) was also identified (9 proteins), with most proteins belonging to the peroxiredoxin family (Table S2). In addition, the functional cluster thioredoxin peroxidase (GO:0,008,379) contains 3 peroxiredoxin proteins.
4.3.2. Protection against Pathogenic Invasion
The egg surface is contaminated by microbes during natural incubation which can expose the embryo to pathogenic agents that penetrate the eggshell; therefore, the egg possesses innate defense mechanisms such as the physical and chemical barriers of the eggshell. , Moreover, internal to the eggshell and associated membranes, the CAM surrounds the developing embryo and contains antimicrobial proteins that reinforce those of the eggshell and egg white. Our CAM proteomics study revealed several proteins related to defense against pathogens, including BPI fold-containing family B member 2 (BPIFB2), serine protease inhibitors (serine peptidase inhibitor kazal type 5 (SPINK5) and serine peptidase inhibitor kazal type 7 (SPINK7)), and cysteine protease inhibitors (cystatin-B (CSTB) and cystatin-C (CST3), as well as cathelicidin-1 (CATH1) and cathelicidin-2 (CATH2)) proteins. The Serpin family is well represented with several related proteins such as serpin family B member 1 (SERPINB1), member 5 (SERPINB5), member 6 (SERPINB6), and serpin family H member 1 (SERPINH1), serpin family F member 1 (SERPINF1) and member 2 (SERPINF2). Other host defense proteins were also observed such as lysozyme C (LYZ), peptidoglycan recognition protein 2 (PGLYRP2), complement C3 (C3), and complement factor H (CFH). The group of calgranulins & Lectins includes protein S100A12 (S100A12) and galectin-2 (LGALS2), galectin-1A (LGALS1A) and galectin-1B (LGALS1B). Other important defense molecules are alpha-2-macroglobulin (A2M), high mobility group protein B1 (HMGB1), and beta-2-microglobulin (B2M), avidin (AVD), immunoglobulin lambda-like polypeptide 1 (IGLL1), ovalbumen-related protein Y (SERPINB14B) (OVALY), ovalbumen-related protein X (SERPINB14C) (OVALX), ovostatin (OVST), protein Ovotransferrin (TF), and protein vitellogenin-2 (VTG2). Ovalbumin (SERPINB14) (OVAL) is the most abundant protein across ED 6–12 for this functionality; although there is no direct evidence that it provides antimicrobial protection, ovalbumin can modify calcium carbonate crystallization and may play a role in eggshell calcification. Many proteins associated with this function are present in different tissues of the developing embryo; for example, SPINK 5 and 7 are major protease inhibitors of the egg white. On the other hand, OVAL could serve as a nutritional source of amino acids for the embryo, while TF, identified in egg white and eggshell, is involved in iron transport. The serpin class family proteins, comprising twenty-seven serpins belonging to clades A, B, C, D, E, F, G, H, and I, were identified within the chicken genome, participating in egg formation. Increasing evidence suggests that the serpin family may play roles in cell proliferation, tissue remodelling, and/or angiogenesis, as well as eggshell biomineralization, egg defense, and embryo nutrition. , Similarly, several serpin proteins were identified at ED 12 and 19 in the CAM and embryonic blood, and eggshell membrane, such as SERPINs (SERPINB1, SERPINB2, SERPINB5, SERPINB10B, SERPINB6, SERPINB14B, SERPINB14C, SERPINH1, and SERPINE2). , The serpin B family is expressed in the hen reproductive tissues and exported into the egg during its formation, where they constitute major protein components in egg structures such as egg white, yolk, and eggshell; three proteins were identified in our proteomics: SERPINB14 (OVAL), SERPINB14B (OVAY), and SERPINB14C (OVAX). SERPINB14C (OVAX) could participate in egg defense, since it is active against listeria and salmonella. CATH1 and CATH2 belong to the major class of cathelicidin proteins. Studies suggest that both CATH1 and CATH2 are major antimicrobial agents. Antimicrobial activity is present in this class of proteins, such that they exhibited antimicrobial activity toward Gram-positive and Gram-negative bacteria. LYZ, OVST, and TF are also major antimicrobial proteins of the egg white and eggshell membrane. , A similar trend is observed for LYZ and TF proteins (Figure ), where their abundance gradually increases as the embryo grows (Figure ). OVST shows a stable but low abundance across all time points studied (Figure ). Other related proteins are detected at lower abundances across our study. The antimicrobial proteins identified in this CAM proteomics study provide a protective mechanism against pathogen invasion.
4.4. In-Ovo Sex Prediction
At ED 5–6, the sexual reproductive organs and sex differentiation have been established (Table ). The early onset of sexual reproductive differentiation could lead to sex-based differences in gene expression and protein abundance. A focus of this study was to investigate a possible correlation between the expression of the CAM proteome and embryo sex. Our proteomic analysis of chick CAM samples across ED 6–12 revealed sex-related patterns emerging during early development, suggesting that biological sex is associated with distinct CAM functionality during critical developmental windows. Such a difference could be related to the observation that male embryos develop faster than females in birds. , Across the studied time points (ED 6–12), female CAM samples consistently showed a higher number of unique proteins and enriched biological pathways compared with male samples (Figure ). For example, at ED6, female samples displayed 614 unique proteins compared to 212 in males, while they shared 1521 common proteins. Across all time points, our analysis revealed that female-based samples exhibited more functional relationships with specific proteins than their counterparts, as observed in our DAVID analysis; thus, more proteins were identified in female samples overall. At ED6, 2,135 proteins were assigned to female samples, and 1733 proteins were assigned to male samples. Functional annotation using DAVID and Gene Ontology (GO) (Table S2a) revealed distinct processes, including autophagy (GO:0,006,914) and hyaluronic acid binding (GO:0,005,540) in females at ED6, and phosphatidylcholine transporter activity (GO:0,008,525) at ED8 (Table S2b). In contrast, male samples at these time points showed fewer distinct functionalities and lower pathway diversity. These results suggest a more metabolically and structurally active CAM environment that favors female embryos during early development, possibly reflecting differential developmental pacing or resource allocation. While early development reveals sex-biased pathways, several core functionalities are conserved across sexes. Shared enrichment of the carbohydrate metabolic process (GO:0,005,975) and tricarboxylic acid cycle (GO:0,006,099) at all time points indicates a common energetic foundation required for CAM function, regardless of sex. The combined KEGG analysis of common proteins across sexes (Figure ) revealed 25 enriched pathways, reinforcing the common roles of the CAM in both males and females. Upon closer examination of the male KEGG analysis (Figure ), it was noted that there are fewer functional pathways, with ED10 and ED12 showing slightly fewer pathways. However, the number and complexity of functionalities were consistently greater in the female CAM proteome, especially in categories such as vesicle transport, lipid metabolism, and protein folding, suggesting a higher functional burden or regulatory flexibility. This is evident in Figure , where the abundance of identified proteins was consistently higher for female-based KEGG pathways compared to those of the male embryos. However, male-based KEGG analysis was more abundant at ED8, where the male CAM proteome was enriched compared with the female embryos. This study shows certain sex-specific protein differences; however, there are only minimal functional differences between males and females for the more common functionalities. Female CAM proteomes show slightly greater functional diversity (Table S2), with higher enrichment in protein-containing complexes, catalytic complexes, and cellular component organization shown in mostly all the KEGG pathways to be the most enriched, whereas male samples are more enriched for anion binding, small molecule binding, and signaling (Figure ), particularly at early stages (ED6–ED10), with differences diminishing by ED12. Understanding such sex-based molecular differences has implications not only for avian developmental biology but also for experimental design in embryology and poultry science, where sex-based variability should be considered in analyses and interventions. This perspective enhances the utility of CAM for the development of novel therapeutic strategies and diagnostic tools, paving the way forward for biomedical innovation.
5. Conclusion
This study provides a comprehensive proteomic characterization of the CAM across early developmental time points (ED 6, 8, 10, and 12), with a novel focus on sex-linked protein expression. Using LC/MS/MS-based proteomics and functional bioinformatics analyses, we identified a total of 2,688 proteins with sex-specific expression patterns and protein constituents related to CAM functions, including gas exchange, calcium transport, immune defense, barrier protection, vessel formation, and embryonic blood elements. A significant finding is the sex-specific proteomic activity observed predominantly at earlier stages, with female CAM samples consistently exhibiting greater protein diversity and enriched pathways, especially related to autophagy, lipid transport, and protein folding. While many core CAM functions were conserved across sexes, these differences highlight sex as a biological variable that influences developmental trajectories even in extraembryonic tissues. Collectively, this research enhances our understanding of the CAM as a dynamic, multifunctional, and sex-responsive tissue, underscoring its potential not only as a model for developmental and biomedical research but also for noninvasive sex determination strategies in poultry science. These findings open new avenues for applications in early diagnostics and in-ovo interventions, offering a promising approach to reduce culling after hatching of 1-day-old male chicks. This includes sex-specific developmental biology, positioning the CAM as a valuable platform for future innovation at the intersection of basic and applied life sciences.
Supplementary Material
Acknowledgments
Funding for this study was provided by the Natural Sciences and Engineering Research Council (NSERC-Discovery- RGPIN-2022-04803; NSERC-Alliance-LLRP 572124 - 22), Egg Farmers of Canada (EFC-552000), and Canadian Poultry Research Council (CPRC-PWB1450). During the preparation of this work, the authors utilized AI tools to enhance the language and readability of a specific component of the discussion. After using this tool/service, the authors reviewed and extensively edited the content as needed, taking full responsibility for the content of the publication.
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.5c10968.
Table S1. Total proteomic inventory for individual CAM samples; Table S2. DAVID analysis for time points ED 6–12 and combined for CAM tissue; and Table S3. The emPAI values of the top hundred most abundant proteins identified in proteomics data of the CAM tissue samples at ED6–12 (PDF)
The authors declare no competing financial interest.
References
- Ahmed T. A. E., Cordeiro C. M. M., Elebute O., Hincke M. T.. Proteomic Analysis of Chicken Chorioallantoic Membrane (CAM) during Embryonic Development Provides Functional Insight. BioMed. Research International. 2022;2022(1):7813921. doi: 10.1155/2022/7813921. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ahmed T. A. E., Suso H.-P., Maqbool A., Hincke M. T.. Processed Eggshell Membrane Powder: Bioinspiration for an Innovative Wound Healing Product. Materials Science and Engineering: C. 2019;95:192–203. doi: 10.1016/j.msec.2018.10.054. [DOI] [PubMed] [Google Scholar]
- Anderson R. E., Gay C. V., Schraer H.. Ultrastructural Localization of Carbonic Anhydrase in the Chorioallantoic Membrane by Immunocytochemistry. J. Histochem Cytochem. 1981;29(10):1121–1127. doi: 10.1177/29.10.6170666. [DOI] [PubMed] [Google Scholar]
- Bellott D. W., Skaletsky H., Cho T.-J., Brown L., Locke D., Chen N., Galkina S., Pyntikova T., Koutseva N., Graves T., Kremitzki C., Warren W. C., Clark A. G., Gaginskaya E., Wilson R. K., Page D. C.. Avian W and Mammalian Y Chromosomes Convergently Retained Dosage-Sensitive Regulators. Nat. Genet. 2017;49(3):387–394. doi: 10.1038/ng.3778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brekken R. A., Sage E. H.. SPARC, a Matricellular Protein: At the Crossroads of Cell–Matrix. Matrix Biology. 2000;19(7):569–580. doi: 10.1016/S0945-053X(00)00105-0. [DOI] [PubMed] [Google Scholar]
- Caunt M., Huang Y.-Q., Brooks P. C., Karpatkin S.. Thrombin Induces Neoangiogenesis in the Chick Chorioallantoic Membrane. Journal of Thrombosis and Haemostasis. 2003;1(10):2097–2102. doi: 10.1046/j.1538-7836.2003.00426.x. [DOI] [PubMed] [Google Scholar]
- Chen L., Wang S., Feng Y., Zhang J., Du Y., Zhang J., Ongeval C. V., Ni Y., Li Y.. Utilisation of Chick Embryo Chorioallantoic Membrane as a Model Platform for Imaging-Navigated Biomedical Research. Cells. 2021;10(2):463. doi: 10.3390/cells10020463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clark, E. R. ; Clark, E. L. . On the origin and early development of the lymphatic system of the chick; Carnegie Institution of Washington, 1919. [Google Scholar]
- Cook M. I., Monaghan P.. Sex Differences in Embryo Development Periods and Effects on Avian Hatching Patterns. Behavioral Ecology. 2004;15(2):205–209. doi: 10.1093/beheco/arg096. [DOI] [Google Scholar]
- Cordeiro C. M. M., Hincke M. T.. Quantitative Proteomics Analysis of Eggshell Membrane Proteins during Chick Embryonic Development. Journal of Proteomics. 2016;130:11–25. doi: 10.1016/j.jprot.2015.08.014. [DOI] [PubMed] [Google Scholar]
- Da Silva M., Beauclercq S., Harichaux G., Labas V., Guyot N., Gautron J., Nys Y., Rehault-Godbert S.. The Family Secrets of Avian Egg-Specific Ovalbumin and Its Related Proteins Y and X. Biol. Reprod. 2015;93(3):71. doi: 10.1095/biolreprod.115.130856. [DOI] [PubMed] [Google Scholar]
- Dakhel S., Davies W. I. L., Joseph J. V., Tomar T., Remeseiro S., Gunhaga L.. Chick Fetal Organ Spheroids as a Model to Study Development and Disease. BMC Mol. and Cell Biol. 2021;22(1):37. doi: 10.1186/s12860-021-00374-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deryugina E. I., Quigley J. P.. Chick Embryo Chorioallantoic Membrane Model Systems to Study and Visualize Human Tumor Cell Metastasis. Histochem Cell Biol. 2008;130(6):1119–1130. doi: 10.1007/s00418-008-0536-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dombre C., Guyot N., Moreau T., Monget P., Da Silva M., Gautron J., Réhault-Godbert S.. Egg Serpins: The Chicken and/or the Egg Dilemma. Seminars in Cell & Developmental Biology. 2017;62:120–132. doi: 10.1016/j.semcdb.2016.08.019. [DOI] [PubMed] [Google Scholar]
- Eliceiri B. P., Cheresh D. A.. The Role of Αv Integrins during Angiogenesis. Mol. Med. 1998;4(12):741–750. doi: 10.1007/BF03401768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eliceiri B. P., Cheresh D. A.. The Role of Αv Integrins during Angiogenesis: Insights into Potential Mechanisms of Action and Clinical Development. J. Clin. Invest. 1999;103(9):1227–1230. doi: 10.1172/JCI6869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gabrielli M. G., Accili D.. The Chick Chorioallantoic Membrane: A Model of Molecular, Structural, and Functional Adaptation to Transepithelial Ion Transport and Barrier Function during Embryonic Development. Journal of Biomedicine and Biotechnology. 2010;2010:1–12. doi: 10.1155/2010/940741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gabrielli M. G., Materazzi G., Cox J. V., Menghi G.. Specialised Cell Types in the Chorioallantoic Membrane Express Carbonic Anhydrase during Chick Embryogenesis. Journal of Anatomy. 2001;198(2):229–238. doi: 10.1046/j.1469-7580.2001.19820229.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gurtner G. C., Davis V., Li H., McCoy M. J., Sharpe A., Cybulsky M. I.. Targeted Disruption of the Murine VCAM1 Gene: Essential Role of VCAM-1 in Chorioallantoic Fusion and Placentation. Genes Dev. 1995;9(1):1–14. doi: 10.1101/gad.9.1.1. [DOI] [PubMed] [Google Scholar]
- Habashy W. S., Milfort M. C., Rekaya R., Aggrey S. E.. Molecular and Cellular Responses of DNA Methylation and Thioredoxin System to Heat Stress in Meat-Type Chickens. Animals. 2021;11(7):1957. doi: 10.3390/ani11071957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Halgrain M., Bernardet N., Crepeau M., Même N., Narcy A., Hincke M., Réhault-Godbert S.. Eggshell Decalcification and Skeletal Mineralization during Chicken Embryonic Development: Defining Candidate Genes in the Chorioallantoic Membrane. Poultry Science. 2022;101(2):101622. doi: 10.1016/j.psj.2021.101622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hennequet-Antier C., Halgrain M., Réhault-Godbert S.. RNA-Seq Dataset of the Chorioallantoic Membrane of Male and Female Chicken Embryos, after 11 and 15 Days of Incubation. Data in Brief. 2024;56:110830. doi: 10.1016/j.dib.2024.110830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He L., Martins P., Huguenin J., Van T.-N.-N., Manso T., Galindo T., Gregoire F., Catherinot L., Molina F., Espeut J.. Simple, Sensitive and Robust Chicken Specific Sexing Assays, Compliant with Large Scale Analysis. PLoS One. 2019;14(3):e0213033. doi: 10.1371/journal.pone.0213033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hincke M. T., Silva M., Guyot N., Gautron J., McKee M. D., Guabiraba-Brito R., Réhault-Godbert S.. Dynamics of Structural Barriers and Innate Immune Components during Incubation of the Avian Egg: Critical Interplay between Autonomous Embryonic Development and Maternal Anticipation. J. Innate Immun. 2019;11(2):111–124. doi: 10.1159/000493719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Horrocks N. P., Hine K., Hegemann A., Ndithia H. K., Shobrak M., Ostrowski S., Williams J. B., Matson K. D., Tieleman B.. Are Antimicrobial Defences in Bird Eggs Related to Climatic Conditions Associated with Risk of Trans-Shell Microbial Infection? Front Zool. 2014;11(1):49. doi: 10.1186/1742-9994-11-49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lindgren I., Zoer B., Altimiras J., Villamor E.. Reactivity of Chicken Chorioallantoic Arteries, Avian Homologue of Human Fetoplacental Arteries. J. Physiol. Pharmacol. 2010;61(5):619–628. [PubMed] [Google Scholar]
- Lokman N. A., Elder A. Sf., Ween M. P., Pyragius C. E., Hoffmann P., Oehler M. K., Ricciardelli C.. Annexin A2 Is Regulated by Ovarian Cancer-Peritoneal Cell Interactions and Promotes Metastasis. Oncotarget. 2013;4(8):1199–1211. doi: 10.18632/oncotarget.1122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mahajan D., Kancharla S., Kolli P., Sharma A. K., Singh S., Kumar S., Mohanty A. K., Jena M. K.. Role of Fibulins in Embryonic Stage Development and Their Involvement in Various Diseases. Biomolecules. 2021;11(5):685. doi: 10.3390/biom11050685. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Makanya A. N., Dimova I., Koller T., Styp-Rekowska B., Djonov V.. Dynamics of the Developing Chick Chorioallantoic Membrane Assessed by Stereology, Allometry, Immunohistochemistry and Molecular Analysis. PLoS One. 2016;11(4):e0152821. doi: 10.1371/journal.pone.0152821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Missirlis E., Karakiulakis G., Maragoudakis M. E.. Angiogenesis Is Associated with Collagenous Protein Synthesis and Degradation in the Chick Chorioallantoic Membrane. Tissue and Cell. 1990;22(4):419–426. doi: 10.1016/0040-8166(90)90071-G. [DOI] [PubMed] [Google Scholar]
- Miura K., Koyanagi-Aoi M., Maniwa Y., Aoi T.. Chorioallantoic Membrane Assay Revealed the Role of TIPARP (2,3,7,8-Tetrachlorodibenzo-p-Dioxin-Inducible Poly (ADP-Ribose) Polymerase) in Lung Adenocarcinoma-Induced Angiogenesis. Cancer Cell Int. 2023;23(1):34. doi: 10.1186/s12935-023-02870-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mojiri A., Stoletov K., Lorenzana Carrillo M. A., Willetts L., Jain S., Godbout R., Jurasz P., Sergi C. M., Eisenstat D. D., Lewis J. D., Jahroudi N.. Functional Assessment of von Willebrand Factor Expression by Cancer Cells of Non-Endothelial Origin. Oncotarget. 2017;8(8):13015–13029. doi: 10.18632/oncotarget.14273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moreau T., Gautron J., Hincke M. T., Monget P., Réhault-Godbert S., Guyot N.. Antimicrobial Proteins and Peptides in Avian Eggshell: Structural Diversity and Potential Roles in Biomineralization. Front. Immunol. 2022;13:946428. doi: 10.3389/fimmu.2022.946428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moreno-Jiménez I., Hulsart-Billstrom G., Lanham S. A., Janeczek A. A., Kontouli N., Kanczler J. M., Evans N. D., Oreffo R. O.. The Chorioallantoic Membrane (CAM) Assay for the Study of Human Bone Regeneration: A Refinement Animal Model for Tissue Engineering. Sci. Rep. 2016;6(1):32168. doi: 10.1038/srep32168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Narbaitz R., Kacew S., Sitwell L.. Carbonic Anhydrase Activity in the Chick Embryo Chorioallantois: Regional Distribution and Vitamin D Regulation*. Development. 1981;65(1):127–137. doi: 10.1242/dev.65.1.127. [DOI] [PubMed] [Google Scholar]
- Nowak-Sliwinska P., Segura T., Iruela-Arispe M. L.. The Chicken Chorioallantoic Membrane Model in Biology, Medicine and Bioengineering. Angiogenesis. 2014;17(4):779–804. doi: 10.1007/s10456-014-9440-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nowak-Sliwinska P., Van Beijnum J. R., Van Berkel M., Van Den Bergh H., Griffioen A. W.. Vascular Regrowth Following Photodynamic Therapy in the Chicken Embryo Chorioallantoic Membrane. Angiogenesis. 2010;13(4):281–292. doi: 10.1007/s10456-010-9185-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pin A.-L., Houle F., Fournier P., Guillonneau M., Paquet É. R., Simard M. J., Royal I., Huot J.. Annexin-1-Mediated Endothelial Cell Migration and Angiogenesis Are Regulated by Vascular Endothelial Growth Factor (VEGF)-Induced Inhibition of miR-196a Expression. J. Biol. Chem. 2012;287(36):30541–30551. doi: 10.1074/jbc.M112.393561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Réhault-Godbert S., Labas V., Helloin E., Hervé-Grépinet V., Slugocki C., Berges M., Bourin M.-C., Brionne A., Poirier J.-C., Gautron J., Coste F., Nys Y.. Ovalbumin-Related Protein X Is a Heparin-Binding Ov-Serpin Exhibiting Antimicrobial Activities. J. Biol. Chem. 2013;288(24):17285–17295. doi: 10.1074/jbc.M113.469759. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ribatti D.. The Chick Embryo Chorioallantoic Membrane (CAM). A Multifaceted Experimental Model. Mech. Dev. 2016;141:70–77. doi: 10.1016/j.mod.2016.05.003. [DOI] [PubMed] [Google Scholar]
- Ribatti D., Tamma R., Annese T.. Chorioallantoic Membrane Vascularization. A Meta-Analysis. Exp. Cell Res. 2021;405(2):112716. doi: 10.1016/j.yexcr.2021.112716. [DOI] [PubMed] [Google Scholar]
- Ribatti D.. The Chick Embryo Chorioallantoic Membrane (CAM) Assay. Reproductive Toxicology. 2017;70:97–101. doi: 10.1016/j.reprotox.2016.11.004. [DOI] [PubMed] [Google Scholar]
- Ribatti D.. Lymphatics in the Chick Embryo Chorioallantoic Membrane. Microvascular Research. 2025;160:104806. doi: 10.1016/j.mvr.2025.104806. [DOI] [PubMed] [Google Scholar]
- Rieder E., Gay C. V., Schraer H.. Autoradiographic Localization of Carbonic Anhydrase in the Developing Chorioallantoic Membrane. Anat Embryol. 1980;159(1):17–31. doi: 10.1007/BF00299252. [DOI] [PubMed] [Google Scholar]
- Riley H. J., Bradshaw A. D.. The Influence of the Extracellular Matrix in Inflammation: Findings from the SPARC-Null Mouse. Anatomical Record. 2020;303(6):1624–1629. doi: 10.1002/ar.24133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rivera L. B., Bradshaw A. D., Brekken R. A.. The Regulatory Function of SPARC in Vascular Biology. Cell. Mol. Life Sci. 2011;68(19):3165–3173. doi: 10.1007/s00018-011-0781-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarnella A., Ferrara Y., Terlizzi C., Albanese S., Monti S., Licenziato L., Mancini M.. The Chicken Embryo: An Old but Promising Model for In Vivo Preclinical Research. Biomedicines. 2024;12(12):2835. doi: 10.3390/biomedicines12122835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saxena I., Tayyab S.. Protein Proteinase Inhibitors from Avian Egg Whites. CMLS, Cell. mol. life sci. 1997;53(1):13–23. doi: 10.1007/PL00000575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Senger D. R., Davis G. E.. Angiogenesis. Cold Spring Harbor Perspect. Biol. 2011;3(8):a005090. doi: 10.1101/cshperspect.a005090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh S., Brocker C., Koppaka V., Chen Y., Jackson B. C., Matsumoto A., Thompson D. C., Vasiliou V.. Aldehyde Dehydrogenases in Cellular Responses to Oxidative/Electrophilicstress. Free Radical Biol. Med. 2013;56:89–101. doi: 10.1016/j.freeradbiomed.2012.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Soulet F., Kilarski W. W., Roux-Dalvai F., Herbert J. M. J., Sacewicz I., Mouton-Barbosa E., Bicknell R., Lalor P., Monsarrat B., Bikfalvi A.. Mapping the Extracellular and Membrane Proteome Associated with the Vasculature and the Stroma in the Embryo. Molecular & Cellular Proteomics. 2013;12(8):2293–2312. doi: 10.1074/mcp.M112.024075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Süß S. C., Werner J., Saller A. M., Weiss L., Reiser J., Ondracek J. M., Zablotski Y., Kollmansperger S., Anders M., Potschka H., Schusser B., Fenzl T., Baumgartner C.. Nociception in Chicken Embryos, Part III: Analysis of Movements before and after Application of a Noxious Stimulus. Animals. 2023;13(18):2859. doi: 10.3390/ani13182859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tagirov M., Golovan S.. Sexual Dimorphism in the Early Embryogenesis of the Chicken (Gallus Gallus Domesticus): SEXUAL DIMORPHISM IN EARLY EMBRYOGENESIS. Mol. Reprod. Dev. 2015;82(5):332–343. doi: 10.1002/mrd.22476. [DOI] [PubMed] [Google Scholar]
- Tetlow N., Board P. G.. Functional Polymorphism of Human Glutathione Transferase A2. Pharmacogenetics. 2004;14(2):111–116. doi: 10.1097/00008571-200402000-00005. [DOI] [PubMed] [Google Scholar]
- Tong Q., Romanini C. E., Exadaktylos V., Bahr C., Berckmans D., Bergoug H., Eterradossi N., Roulston N., Verhelst R., McGonnell I. M., Demmers T.. Embryonic Development and the Physiological Factors That Coordinate Hatching in Domestic Chickens. Poultry Science. 2013;92(3):620–628. doi: 10.3382/ps.2012-02509. [DOI] [PubMed] [Google Scholar]
- Tsopanoglou N. E., Pipili-Synetos E., Maragoudakis M. E.. Thrombin Promotes Angiogenesis by a Mechanism Independent of Fibrin Formation. American Journal of Physiology-Cell Physiology. 1993;264(5):C1302–C1307. doi: 10.1152/ajpcell.1993.264.5.C1302. [DOI] [PubMed] [Google Scholar]
- Tu Z., Lin Y.-N., Lin C.-H.. Development of Fucosyltransferase and Fucosidase Inhibitors. Chem. Soc. Rev. 2013;42(10):4459. doi: 10.1039/c3cs60056d. [DOI] [PubMed] [Google Scholar]
- Tuan R. S.. Carbonic Anhydrase and Calcium Transport Function of the Chick Embryonic Chorioallantoic Membranea . Ann. N.Y. Acad. Sci. 1984;429(1):459–472. doi: 10.1111/j.1749-6632.1984.tb12372.x. [DOI] [PubMed] [Google Scholar]
- Tuan R. S., Carson M. J., Jozefiak J. A., Knowles K. A., Shotwell B. A.. Calcium-Transport Function of the Chick Embryonic Chorioallantoic Membrane: I. in Vivo and in Vitro Characterization. Journal of Cell Science. 1986;82(1):73–84. doi: 10.1242/jcs.82.1.73. [DOI] [PubMed] [Google Scholar]
- Tuan R. S., Zrike J.. Functional Involvement of Carbonic Anhydrase in Calcium Transport of the Chick Chorioallantoic Membrane. Biochem. J. 1978;176(1):67–74. doi: 10.1042/bj1760067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang S., He X., Wu Q., Jiang L., Chen L., Yu Y., Zhang P., Huang X., Wang J., Ju Z., Min J., Wang F.. Transferrin Receptor 1-Mediated Iron Uptake Plays an Essential Role in Hematopoiesis. Haematologica. 2020;105(8):2071–2082. doi: 10.3324/haematol.2019.224899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Branicky R., Noë A., Hekimi S.. Superoxide Dismutases: Dual Roles in Controlling ROS Damage and Regulating ROS Signaling. J. Cell Biol. 2018;217(6):1915–1928. doi: 10.1083/jcb.201708007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Wang M., Shan A., Feng X.. Avian Host Defense Cathelicidins: Structure, Expression, Biological Functions, and Potential Therapeutic Applications. Poultry Science. 2020;99(12):6434–6445. doi: 10.1016/j.psj.2020.09.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wasik A., Ratajczak-Wielgomas K., Badzinski A., Dziegiel P., Podhorska-Okolow M.. The Role of Periostin in Angiogenesis and Lymphangiogenesis in Tumors. Cancers. 2022;14(17):4225. doi: 10.3390/cancers14174225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yáñez, M. ; Gil-Longo, J. ; Campos-Toimil, M. . Calcium Binding Proteins. In Calcium Signaling; Islam, M. S. , Ed.; Springer Netherlands: Dordrecht, 2012; vol 740; pp 461–482. [DOI] [PubMed] [Google Scholar]
- Yang S., Wang L. L., Shi Z., Ou X., Wang W., Chen X., Liu G.. Transcriptional Profiling of Liver Tissues in Chicken Embryo at Day 16 and 20 Using RNA Sequencing Reveals Differential Antioxidant Enzyme Activity. PLoS One. 2018;13(2):e0192253. doi: 10.1371/journal.pone.0192253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yuan Z.-Y., Cheng L.-T., Wang Z.-F., Wu Y.-Q.. Desmoplakin and Clinical Manifestations of Desmoplakin Cardiomyopathy. Chinese Medical Journal. 2021;134(15):1771–1779. doi: 10.1097/CM9.0000000000001581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y., Goss A. M., Cohen E. D., Kadzik R., Lepore J. J., Muthukumaraswamy K., Yang J., DeMayo F. J., Whitsett J. A., Parmacek M. S., Morrisey E. E.. A Gata6-Wnt Pathway Required for Epithelial Stem Cell Development and Airway Regeneration. Nat. Genet. 2008;40(7):862–870. doi: 10.1038/ng.157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y., Zheng X., Zhang Y., Zhang H., Zhang X., Zhang H.. Comparative Transcriptomic and Proteomic Analyses Provide Insights into Functional Genes for Hypoxic Adaptation in Embryos of Tibetan Chickens. Sci. Rep. 2020;10(1):11213. doi: 10.1038/s41598-020-68178-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.



