Skip to main content
NCBI home page
RSC Medicinal Chemistry logoLink to RSC Medicinal Chemistry
. 2026 Jan 16. Online ahead of print. doi: 10.1039/d5md00792e

Novel Pt@BSA nanoparticles improve radiotherapeutic outcomes in breast cancer

Yuhui Zhang a,†,✉, Yihui Liu a,†, Dongju Zheng a
PMCID: PMC12809708  PMID: 41551020

Abstract

Radiotherapy is a standard treatment for breast cancer, but its therapeutic efficacy is often limited by tumor radioresistance and systemic toxicity. Hence, the development of effective radiosensitizers with favorable biocompatibility is urgently needed. We designed and synthesized a biomimetic nanoparticle system, Pt@BSA-RM, by encapsulating platinum nanoparticles within bovine serum albumin (BSA) and cloaking them with a red blood cell membrane (RM). Subsequently, the physicochemical properties, drug loading, stability, and release profiles of Pt@BSA-RM were comprehensively characterized. Next, we assessed the radiosensitizing effect of Pt@BSA-RM in 4T1 BC cells by EdU incorporation, CCK-8, and apoptosis assays, explored the mechanism by ROS generation and γ-H2AX staining, and assessed the effect of Pt@BSA-RM on energy metabolism by GFAAS and JC-1 staining and metabolic flux analysis (OCR/ECAR). A subcutaneous 4T1 tumor model in BALB/c mice was established to assess the in vivo antitumor efficacy and biosafety of Pt@BSA-RM combined with radiotherapy. We found that Pt@BSA-RM nanoparticles possess excellent physical and chemical properties. In vitro studies showed that Pt@BSA-RM significantly enhanced radiation-induced cytotoxicity, inhibited cell proliferation, promoted apoptosis and DNA damage, disrupted mitochondrial membrane potential, and altered glycolytic and oxidative metabolisms. In vivo studies indicated that Pt@BSA-RM combined with X-ray irradiation markedly suppressed tumor growth compared with monotherapy, with reduced systemic toxicity. These results indicated that the red blood cell membrane-coated Pt@BSA nanoparticles effectively improve radiotherapeutic outcomes in breast cancer by enhancing the cellular radiosensitivity and minimizing the adverse effects. This biomimetic nanoplatform holds promise for further translational research in cancer radiotherapy.

We designed a novel nanoplatform, Pt@BSA-RM, that is capable of sensitizing breast cancer cells to radiotherapy.graphic file with name d5md00792e-ga.jpg

1. Introduction

Breast cancer (BC) is the most common malignant tumor among women worldwide and the second leading cause of cancer-related deaths in women. Globally, BC accounts for approximately one-third of all female malignant tumors, with a mortality rate of about 15% of diagnosed cases.1 According to reports, as early as 2020, BC had already surpassed lung cancer to become the most common type of cancer worldwide.2 Although precision medicine guided by molecular typing has significantly improved the outcomes, with a five-year survival rate of 80–90% for primary BC, approximately 20–40% of patients develop distant organ metastases, resulting in poor outcomes.3 This highlights the ongoing challenge of identifying breakthrough treatment options.

Radiation therapy is widely recognized as one of the core treatment modalities for the comprehensive management and control of BC: in the early stages, it serves to consolidate the effects of breast-conserving surgery (BCS) or radical mastectomy, thereby reducing the risk of local recurrence and cancer-related mortality; in locally advanced or oligometastatic stages, it can precisely target residual lesions, thereby extending patient survival. Data indicate that the risk of local recurrence in early-stage breast cancer (eBC) patients following adjuvant radiotherapy decreases from 26% to 7%, with a 5.4% increase in 15 year survival rates.4–6 In particular, patients who underwent BCS and were found to have circulating tumor cells were also shown to have longer overall survival after receiving radiotherapy.7

However, acquired radiation resistance remains an unsolved challenge. Tumor cells cannot be killed after receiving conventional doses of ionizing radiation, leading to lapses in the efficacy of radiation therapy for BC. This is the primary cause of treatment failure and recurrence.8 Improving the efficacy of radiotherapy for cancer patients has thus become a key focus of current research. On one hand, some studies are dedicated to using radiogenomic or transcriptomic techniques to identify genes sensitive to radiotherapy and biomarkers predictive of radiotherapy outcomes, thereby identifying and selecting BC patients who may benefit from radiotherapy and are suitable for targeted therapy.9,10 On the other hand, research focuses on discovering effective radiosensitizers. These agents typically target core pathways such as DNA damage repair, cell cycle checkpoints, and oxidative stress, enhancing radiotherapy efficacy by modulating signal transduction networks. In this regard, the emergence of nanomedicine has provided new insights into the development of novel radiotherapy sensitizers.11,12 Nanoparticle-assisted radiotherapy can enhance tumor tissue sensitivity to ionizing radiation. By constructing a nanoscale drug delivery system, the unique high permeability and high retention effects of tumor tissues can be utilized to enable nanoparticles with high atomic numbers to aggregate at tumor sites, thereby improving local radiation deposition efficiency at tumor sites.13,14 Previous studies have demonstrated that the combination therapy of cisplatin and biosynthetic silver nanoparticles (AgNPs) enhances apoptosis induction in MCF-7 BC cells while reducing cisplatin resistance.15

Bovine serum albumin-coated platinum nanoparticles (Pt@BSA) are spherical composite nanostructures with a natural BSA shell, a zero-valent or low-valent platinum core, and a particle size of 5–30 nm. The BSA shell confers excellent colloidal stability, a long circulation half-life, and good biocompatibility.16 Research has confirmed that BSA-coated platinum–silver bimetallic nanoparticles (Ag–Pt@BSA NPs) can exert a significant sensitizing effect in BC radiotherapy.17 Photoactivatable Pt(iv)-coordinated carbon dots (Pt-CDs) and their BSA complex (Pt-CDs@BSA) can induce immunogenic cell death in 4T1 BC in situ and bilateral models, not only eradicating the primary tumor but also significantly inhibiting lung metastasis by activating CD8+ T cells.18 These findings fully confirm the potential of nanoplatforms to achieve precise sensitization in BC radiotherapy, thereby overcoming the limitations of traditional radiotherapy. In this study, we developed a novel red blood cell membrane-coated Pt@BSA nanoparticle (Pt@BSA-RM) and investigated its radiosensitizing effect through in vivo and in vitro experiments. We compared it with conventional Pt@BSA and demonstrated that it exhibits superior radiosensitizing properties, providing new insights into the exploration of radiosensitizers for BC radiotherapy.

2. Materials and methods

2.1. Materials

Chloroplatinic acid hexahydrate (H2PtCl6·6H2O, ≥37.5% Pt basis) and bovine serum albumin (BSA, ≥98%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Sodium hydroxide (NaOH, analytical grade) was obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Phosphate-buffered saline (PBS, pH 7.4, Gibco, Cat# 10010023) and fetal bovine serum (FBS) were purchased from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). EDTA-coated blood collection tubes were obtained from BD Biosciences (Franklin Lakes, NJ, USA). Polycarbonate membranes (200 nm) were purchased from Whatman (Cytiva, Marlborough, MA, USA). Dialysis membranes (MWCO = 12–14 kDa) were obtained from Spectrum Labs (Rancho Dominguez, CA, USA). All chemicals and reagents were of analytical grade and used without further purification. Ultrapure water was prepared using a Milli-Q system (Millipore, Burlington, MA, USA).

2.2. Synthesis and characterization

2.2.1. Preparation of Pt@BSA nanoparticles

Pt@BSA nanoparticles were prepared following a modified protocol based on previous reports. Briefly, 5 mL of an aqueous bovine serum albumin (BSA) solution (8 mg mL−1, Sigma-Aldrich, Cat# A7906) was mixed with 5 mL of a chloroplatinic acid hexahydrate (H2PtCl6·6H2O) aqueous solution (16 mM, Sigma-Aldrich, Cat# 215490). Subsequently, 0.5 mL of a sodium hydroxide solution (1.5 M, Sigma-Aldrich, Cat# S8045) was added dropwise under stirring. The reaction mixture was stirred continuously for 24 hours in a water bath maintained at 80 °C. After reaction completion, the solution was dialyzed with ultrapure water using a dialysis membrane (MWCO = 12–14 kDa, Spectrum Labs, Cat# 132025) for 24 hours to remove unreacted reagents and impurities. Ultimately, Pt@BSA nanoparticles were obtained, with Pt predominantly in the zero-valent state (Pt0). The resulting Pt@BSA nanoparticles were stored at 4 °C for further use.

2.2.2. Preparation of the red blood cell membrane (RM)

Red blood cells were collected from BALB/c mice in EDTA-coated tubes (BD Vacutainer, Cat# 367841) by cardiac puncture. Blood was centrifuged at 1000 × g for 10 minutes at 4 °C to separate the plasma and buffy coat. The erythrocyte fraction was washed three times with cold PBS to remove residual plasma and leukocytes. Membrane extraction was performed by hypotonic lysis in 0.25 × PBS, followed by repeated centrifugation at 10 000 × g for 10 minutes at 4 °C to obtain purified red blood cell membranes.

2.2.3. Preparation of Pt@BSA-RM nanoparticles

Pt@BSA nanoparticles and RM vesicles were coextruded through a 200 nm polycarbonate membrane (Whatman Nuclepore Track-Etched Membranes, Cat# 111109) using an Avanti mini-extruder (Avanti Polar Lipids, Cat# 610000) at room temperature to achieve membrane coating and nanoparticle cloaking. The resulting Pt@BSA-RM nanoparticles were collected and stored at 4 °C until further use.

2.2.4. Dynamic light scattering (DLS) and zeta potential

The hydrodynamic diameter and surface charge (zeta potential) of Pt@BSA and Pt@BSA-RM nanoparticles were measured using a Zetasizer Nano ZS instrument (Malvern Panalytical, UK). Samples were diluted with PBS to an appropriate concentration and equilibrated at 25 °C before measurement. DLS analyses were conducted at least three times for each sample, with three independent specimens analyzed for each group, and the results were reported as mean ± standard deviation.

2.2.5. Transmission electron microscopy (TEM)

The morphology and size of Pt@BSA-RM nanoparticles were observed by transmission electron microscopy (JEOL JEM-2100, Japan). Samples were prepared by placing a drop of the nanoparticle suspension on a carbon-coated copper grid, followed by the removal of excess solution with filter paper. The samples were then air-dried at room temperature before imaging. TEM analyses were conducted at least three times for each sample, with three independent specimens analyzed for each group.

2.2.6. Stability assessment

Pt@BSA-RM nanoparticles were incubated in different media, including PBS, 10% fetal bovine serum (FBS), simulated body fluid (SBF), and acidic PBS (pH 5.5) at 37 °C to evaluate their colloidal stability. At predetermined time points (0, 10, 20, 40, 50, 60, 70, and 80 hours), samples were withdrawn, and their particle size and zeta potential were measured by DLS, as described above.

2.2.7. Drug release study

The in vitro release of platinum from Pt@BSA-RM nanoparticles was evaluated by incubating the nanoparticles in a 1 mM hydrogen peroxide (H2O2) solution at 37 °C. At specific time points (0, 6, 12, 24, 36, 48, and 60 hours), aliquots of the release medium were collected and centrifuged at 12 000 × g for 10 minutes. The concentration of platinum in the supernatant was quantified by inductively coupled plasma optical emission spectrometry (ICP-OES, Agilent 5110, USA). The cumulative release percentage was calculated based on the total platinum content. ICP-OES analyses were conducted at least three times for each sample, with three independent specimens analyzed for each group.

2.3. Cell culture

Murine breast cancer 4T1 cells were purchased from the American Type Culture Collection (ATCC, Cat# CRL-2539) and cultured in an RPMI-1640 medium (Gibco, Cat# 11875093) supplemented with 10% fetal bovine serum (FBS, Gibco, Cat# 10099141) and 1% penicillin–streptomycin (Gibco, Cat# 15140122). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.

2.4. Cell viability assays

Cell viability was assessed using the cell counting kit-8 (CCK-8; Dojindo Molecular Technologies, Cat# CK04). Briefly, 4T1 cells were seeded in 96-well plates at 5 × 103 cells per well and treated with indicated concentrations of Pt, Pt@BSA nanoparticles or Pt@BSA-RM nanoparticles combined with or without X-ray irradiation. After 24, 48, and 72 h of incubation, 10 μL of the CCK-8 solution was added to each well, followed by 2 h of incubation at 37 °C. The absorbance was measured at 450 nm using a microplate reader (BioTek Instruments).

2.5. EdU proliferation assay

Cell proliferation was detected using the EdU incorporation assay kit (Thermo Fisher Scientific, Cat# C10337) following the manufacturer's instructions. 4T1 cells were incubated with the EdU reagent for 2 h, fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and stained with Alexa Fluor 488 azide. Nuclei were counterstained with Hoechst 33342. Images were captured using a fluorescence microscope (Nikon Eclipse Ti).

2.6. Apoptosis analysis by flow cytometry

Apoptosis was analyzed using the Annexin V-FITC/PI apoptosis detection kit (BD Biosciences, Cat# 556547). After treatment, 4T1 cells were harvested, washed twice with cold PBS, and stained with Annexin V-FITC and propidium iodide according to the protocol. Data acquisition was performed on a BD FACSCanto II flow cytometer, and results were analyzed with FlowJo software.

2.7. ROS content detection

After the exposure of 4T1 cells (1 × 105) to the corresponding platinum-based drugs or combined X-ray treatment, the cells were loaded with 10 μM DCFH-DA (Beyotime active oxygen detection kit, Cat# S0033S) in the DMEM for 30 min at 37 °C in the dark, washed twice with PBS, immediately detached with trypsin–EDTA, resuspended in ice-cold PBS, and analyzed by flow cytometry (488/525 nm) within 30 min, and the mean fluorescence intensity was normalized to untreated controls.

2.8. Immunofluorescence assay

4T1 cells seeded on glass coverslips were fixed with 4% paraformaldehyde (Sigma-Aldrich, Cat# P6148) for 15 min, permeabilized with 0.2% Triton X-100 for 10 min, blocked with 5% goat serum for 1 h, incubated overnight at 4 °C with rabbit anti-γ-H2AX (1 : 800, Cell Signaling Technology, Cat# 9718) and then with Alexa Fluor 488-conjugated goat antirabbit IgG (Invitrogen, Cat# A11008) for 1 h at room temperature, counterstained with DAPI (Sigma-Aldrich, Cat# D9542), mounted in ProLong Gold (Invitrogen, Cat# P36930), and imaged by a fluorescence microscope.

2.9. Mitochondrial membrane potential assay (JC-1)

Changes in the mitochondrial membrane potential were evaluated using the JC-1 mitochondrial membrane potential assay kit (Beyotime Biotechnology, Cat# C2006).

Treated 4T1 cells were incubated with a JC-1 working solution at 37 °C for 20 min and then washed. Images of green monomers and red aggregates were captured immediately using a confocal microscope (Zeiss LSM 880), giving an overlay that visualized the mitochondrial membrane potential.

2.10. Metabolic flux analysis (OCR and ECAR)

The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using the Seahorse XF analyzer (Agilent Technologies). 4T1 cells were seeded in Seahorse XF96 plates and treated as described. Mitochondrial stress test and glycolysis stress test kits (Agilent, Cat# 103015-100 and 103020-100, respectively) were used according to the manufacturer's instructions.

2.11. ATP and lactate assays

Intracellular ATP levels were determined using an ATP assay kit (Beyotime Biotechnology, Cat# S0026) following the manufacturer's protocol. The lactate concentration in culture supernatants was measured using a lactate assay kit (Sigma-Aldrich, Cat# MAK064).

2.12. Measurements of mitochondrial platinum contents

4T1 cells were suspended in 1 mL of PBS and isolated using the mitochondria isolation kit (Thermo Fisher Scientific) according to the manufacturer's instructions. The isolated mitochondrial pellet was dissolved in 200 μL of 65% HNO3 (PlasmaPURE® Plus, SCP Science) and digested overnight at room temperature with 400 rpm shaking on an Eppendorf ThermoMixer™ F1.5. After 10-fold dilution with ultrapure water, the Pt content was quantified by graphite-furnace atomic absorption spectrometry (GFAAS, SpectrAA 880Z, Varian) at 266 nm with D2 background correction against matrix-matched standards prepared from a 1000 mg L−1 Pt stock (BDH Spectrosol); values were normalized to the protein concentration of the mitochondrial fraction determined by the BCA assay and expressed as ng Pt μg−1 protein.

2.13. Western blot

Total protein was extracted from 4T1 cells using the RIPA lysis buffer (Beyotime Biotechnology, Cat# P0013B) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific, Cat# 78440). Protein concentrations were quantified using a BCA assay kit (Thermo Fisher Scientific, Cat# 23225). Equal amounts of protein (30 μg) were separated by 10% SDS-PAGE and transferred to PVDF membranes (Millipore, Cat# IPVH00010). Membranes were blocked with 5% nonfat milk and incubated overnight at 4 °C with the following primary antibodies: HK2 (Cell Signaling Technology, Cat# 2867, 1 : 1000), PKM2 (Abcam, Cat# ab85555, 1 : 1000), LDHA (Proteintech, Cat# 19987-1-AP, 1 : 1000), and β-actin (Cell Signaling Technology, Cat# 3700, 1 : 2000). After washing, membranes were incubated with HRP-conjugated secondary antibodies (Cell Signaling Technology, Cat# 7074, 1 : 5000) for 1 h at room temperature. Bands were visualized using an enhanced chemiluminescence kit (Thermo Fisher Scientific, Cat# 32106).

2.14. Quantitative real-time PCR (qPCR)

Total RNA was extracted using the TRIzol reagent (Thermo Fisher Scientific, Cat# 15596018). Reverse transcription was performed using the high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Cat# 4368814). qPCR was carried out using the PowerUp SYBR green master mix (Thermo Fisher Scientific, Cat# A25742) on a QuantStudio 3 real-time PCR system (Table 1).

Table 1. Primer sequences used for qPCR (5′ → 3′).

Gene Forward primer Reverse primer
HK2 AGCCACAGAGAAGCACTGGA TTGCTGTGGGTCTGTCTTCC
PKM2 CAGCAGGTGCTGAGGAAGTT CTTCCACATCCTTGCCCTTT
LDHA GGCTGGACCTTGGTGGTAAG AAGGTTTGAGGGCTGGTGTT
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
Open in a new tab

2.15. Animal models

All animal experiments were approved by the Animal Ethics Committee of Ningxia Hui Autonomous Region People's Hospital (approval number: 2022-NZR-033) and conducted in accordance with institutional guidelines and the ARRIVE guidelines.

Female BALB/c mice (6 weeks old, 18–22 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed under specific pathogen-free (SPF) conditions with free access to food and water. Subcutaneous BC models were established by injecting 1 × 106 4T1 cells suspended in 100 μL of PBS into the right flank of each mouse. When tumors reached 50–100 mm3, mice were randomly divided into four groups (n = 6 per group): (1) control (PBS), (2) Pt@BSA-RM, (3) Pt@BSA combined with X-ray irradiation (Pt@BSA + X-ray) and (4) Pt@BSA-RM combined with X-ray (Pt@BSA-RM + X-ray). Pt@BSA or Pt@BSA-RM nanoparticles were administered via local intratumoral injection at a dose of 2.5 mg kg−1 every 2 days. For groups receiving radiotherapy, localized X-ray irradiation (5 Gy)19 was applied to tumors 30 minutes postinjection20 every 2 days for a total of four treatments. Tumor volumes were measured every 2 days using calipers and calculated as (length × width2)/2. After 14 days, mice were euthanized, and tumors were excised, weighed, and processed for further analysis.

The sample size was determined using the resource equation method.21,22 For one-way ANOVA, the acceptable error degree of freedom (DF = N–k, N = total number of subjects, k = number of groups) is 10–20. DF = 20 in the design of the present in vivo study, which is within this range.

2.16. Histological and immunohistochemical analyses

Excised tumor tissues and organs were fixed in 10% neutral-buffered formalin for 24 hours, embedded in paraffin, and sectioned at a 4 μm thickness. Hematoxylin and eosin (H&E) staining was performed to evaluate tumor histopathology.

For immunohistochemistry (IHC), sections were deparaffinized and rehydrated, followed by antigen retrieval in a citrate buffer (pH 6.0). The sections were incubated overnight at 4 °C with the anti-Ki-67 antibody (Abcam, Cat# ab16667, dilution = 1 : 200) to assess proliferative activity. Detection was performed using an HRP-conjugated secondary antibody with a diaminobenzidine (DAB) substrate. Counterstaining was done with hematoxylin.

Apoptotic cells were detected by the TUNEL assay using an in situ cell death detection kit (Roche, Cat# 11684817910) according to the manufacturer's instructions. Fluorescent images were acquired using a fluorescence microscope (Nikon Eclipse Ti), and quantitative analysis was performed with ImageJ software.

2.17. Statistical analysis

All results were expressed as the mean ± SD. Statistical analysis was performed using GraphPad Prism 10.0 (San Diego, CA, USA). A t-test was used to test the differences between two groups, and comparisons among multiple groups were performed with a one-way ANOVA, followed by Tukey's posthoc test. A p-value of <0.05 was considered to be statistically significant. All data were obtained from at least three independent experiments.

3. Results

3.1. Physicochemical characterization of Pt@BSA and Pt@BSA-RM nanoparticles

To verify the fundamental physicochemical properties of the constructed nanoplatform, ICP-OES was performed to scan for Pt elemental signals. The results showed the prominent characteristic peak of Pt at a wavelength of 266 nm (Fig. 1A). Based on this, a Pt quantitative standard curve was established at an absorbance of 266 nm, providing a basis for the subsequent content analysis (Fig. 1B).

Fig. 1. Physicochemical characterization of Pt@BSA and Pt@BSA-RM nanoparticles. (A) ICP-OES spectrum showing the characteristic platinum (Pt) signal at 266 nm. (B) Standard calibration curve of the Pt concentration at 266 nm used for quantification. (C) Optimization of the blood volume for coincubation with nanoparticles. (D) Hydrodynamic diameter distributions of Pt@BSA and Pt@BSA-RM nanoparticles measured by DLS (n = 3). (E) Zeta potential values of Pt@BSA and Pt@BSA-RM nanoparticles (n = 3). (F) Transmission electron microscopy (TEM) image of Pt@BSA-RM nanoparticles showing the intact membrane coating (scale bar = 100 nm). (G) Stability assessment of Pt@BSA-RM nanoparticles in different media (PBS (pH 7.4), 10% FBS, SBF, and acidic PBS (pH 5.5)) over 72 h, monitored by DLS and zeta potential. (H) In vitro drug release profiles of Pt@BSA and Pt@BSA-RM nanoparticles under 1 mM H2O2 stimulation over 60 h. Data are presented as mean ± SD. *p < 0.05; ***p < 0.001; ns, no significance.

Fig. 1

Open in a new tab

In coincubation experiments with blood, different volumes of blood were screened to determine its optimal usage (Fig. 1C). DLS analysis revealed that the average hydrodynamic diameters of Pt@BSA and Pt@BSA-RM nanoparticles were 8.6 ± 2.1 nm and 112.4 ± 3.4 nm, respectively, while their zeta potentials were −18.2 ± 1.8 mV and −25.9 ± 2.3 mV, respectively (Fig. 1D and E). The increase in the particle size and the shift in the surface charge after membrane coating indicated the successful cloaking of the nanoparticles by the red blood cell membrane.

TEM images further confirmed that Pt@BSA-RM exhibited an intact membrane-coated structure (Fig. 1F). To evaluate their stability in physiological environments, nanoparticles were incubated for 72 hours in PBS (pH 7.4), 10% FBS, SBF, and acidic PBS (pH 5.5). Results demonstrated minimal changes in the particle size and zeta potential of the membrane-coated nanoparticles under PBS (pH 7.4), 10% FBS and SBF conditions, indicating their excellent colloidal stability (Fig. 1G). Under simulated oxidative stress conditions, treatment with 1 mM hydrogen peroxide (H2O2) induced significant drug release from Pt@BSA and Pt@BSA-RM nanoparticles, suggesting that the system possesses notable oxidation-responsive drug release properties (Fig. 1H).

3.2. Pt@BSA-RM combined with X-ray strongly inhibited BC cell proliferation and promoted apoptosis

We then analyzed the anticancer properties of the red blood cell membrane-based nanoplatform. As shown by the analysis of EdU incorporation, cell proliferation in the X-ray irradiation treatment (X-ray) group was inhibited compared to the control (Ctrl) group. The proliferation inhibition in the conventional radiotherapy sensitizer cisplatin + X-ray treatment group (cisplatin + X-ray) was slightly stronger than that in the X-ray group, and the same for Pt@BSA (Pt@BSA + X-ray), whereas the group treated with Pt@BSA-RM and X-ray irradiation (Pt@BSA-RM + X-ray) demonstrated an optimal tumor growth inhibition effect (Fig. 2A and B). Similarly, the CCK-8 assay showed that the Pt@BSA-RM + X-ray group had a significantly stronger cell proliferation inhibition effect than the X-ray group, cisplatin + X-ray group and Pt@BSA + X-ray group (Fig. 2C). As expected, further apoptosis detection revealed that Pt@BSA-RM combined with X-ray irradiation exhibited the most promising proapoptotic effect on BC cells (Fig. 2D and E). These results indicate that the Pt@BSA-RM treatment increases the radiation sensitivity of BC cells to X-rays, thereby exhibiting better tumor suppression effects.

Fig. 2. Pt@BSA-RM combined with X-ray irradiation showed the best proliferation inhibition and apoptosis promotion effects in BC cells. (A and B) Immunofluorescence analysis of EdU incorporation in BC cells in the control, treated with Pt@BSA alone, and treated with Pt@BSA-RM alone or cisplatin groups as well as these treatments in combination with X-ray irradiation (n = 3) (scale bar = 100 μm) groups. (C) Cell proliferation from the above cells measured via CCK-8 analysis (n = 3). (D and E) Representative flow cytometry images for each group and the percentage of apoptotic cells (n = 3). Data are presented as mean ± SD. *p < 0.05; ***p < 0.001; ***p < 0.0001; ns, no significance.

Fig. 2

Open in a new tab

Next, we explored the radiosensitization mechanism of the metallic platinum nanoparticles, Pt@BSA-RM. It has been shown that high-atomic-number metallic nanoparticles usually generate ROS through enzyme-like catalytic activity, which enhances oxidative stress and DNA damage in tumor cells, which is their main sensitizing mechanism.23 Therefore, we examined ROS generation in breast cancer cells. As expected, Pt@BSA-RM greatly facilitated ROS production, with a superior effect compared to cisplatin and Pt@BSA (Fig. 3A). Similarly, the DNA damage marker γ-H2AX was also elevated maximally after the Pt@BSA-RM treatment (Fig. 3B and C). These results suggest that Pt@BSA-RM promotes oxidative stress and DNA damage.

Fig. 3. Pt@BSA-RM promoted ROS generation and DNA damage. (A) ROS content detected by the active oxygen detection kit (n = 3). (B and C) Expression of the DNA damage marker γ-H2AX detected by immunofluorescence staining (n = 3). Data are presented as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, no significance.

Fig. 3

Open in a new tab

3.3. Pt@BSA-RM combined with X-ray further impaired the BC cells' energy metabolism

Studies have shown that radiotherapy causes mitochondrial damage and that an enhanced glycolytic flux is an energy compensation mechanism following mitochondrial damage.24 These alterations result in short-term increases in the glycolytic flux and total ATP content as cells significantly increase glucose uptake in response to radiation-induced DNA damage in an attempt to rapidly energize cellular repair, along with a significant increase in the metabolic byproduct lactate.25–27 In order to investigate the effect of Pt@BSA-RM on the energy metabolism in BC cells, we examined the platinum content in mitochondria. GFAAS results showed that the administration of Pt@BSA, Pt@BSA-RM and X-ray alone had no significant effect on the platinum content in the mitochondria of 4T1 cells, but it was significantly elevated in comparison with Pt@BSA when Pt@BSA-RM was administered prior to the X-ray treatment (Fig. 4A). Furthermore, the JC-1 fluorescent probe indicated that Pt@BSA-RM further decreased the X-ray-induced reduction in the mitochondrial membrane potential, as manifested by the greater enhancement in green fluorescence (Fig. 4B). These results suggest that Pt@BSA-RM combined with radiotherapy promotes mitochondrial platinum accumulation. Once platinum enters the mitochondria, it disrupts the mitochondrial membrane potential, as previously reported.28 In addition, following X-ray irradiation, the total ATP content and lactate production increased; however, these effects were significantly reversed after supplementation with Pt@BSA-RM, with superior efficacy compared to Pt@BSA (Fig. 4C and D). Consistent with the above results, western blot and RT-qPCR analyses showed that compared with the increase in glycolytic enzymes HK2, PKM2, and LDH1 caused by X-ray irradiation alone, the expression of these proteins was significantly reduced after the Pt@BSA combined treatment, while Pt@BSA-RM could further reduce their expression (Fig. 4E and F). Next, we examined the effect of Pt@BSA-RM on the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of BC cells treated with radiotherapy. As shown in Fig. 4G and H, Pt@BSA-RM inhibited the X-ray-induced imbalance in the energy metabolism, as evidenced by the inhibition of glycolysis and the cellular shift back to OXPHOS for energy supply. All these results suggest that Pt@BSA-RM synergistic radiation therapy further disrupts mitochondria and reduces glycolytic fluxes to inhibit the tumor energy metabolism.

Fig. 4. Pt@BSA-RM exacerbated X-ray-induced mitochondrial damage and inhibited glycolysis. (A) Mitochondrial platinum accumulation detected by GFAAS (n = 3). (B) Detection of the mitochondrial potential using the JC-1 assay (JC-1 aggregate, red; JC-1 monomer, green) (scale bar = 100 μm). (C) Intracellular ATP levels in BC cells detected using the ATP assay (n = 3). (D) Extracellular lactate levels in BC cells detected using the lactic acid assay (n = 3). (E) Western blot analysis showing the HK2, PKM2, and LDH1 protein expressions in different groups (n = 3). (F) Relative mRNA expression of HK2, PKM2, and LDH1 in different groups (n = 3). (G) ECAR of BC cells detected as an indicator of the deduced glycolysis flux and glycolytic capacity in the control group, after treatment with Pt@BSA alone and Pt@BSA-RM alone and these treatments in combination with X-ray irradiation (n = 3). (H) OCR detected as an indicator for oxidative phosphorylation (OXPHOS) in BC cells in the different groups (n = 3). Data are presented as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, no significance.

Fig. 4

Open in a new tab

3.4. Pt@BSA-RM combined with X-ray therapy can significantly inhibit tumor growth in vivo

To validate the unique advantages of the Pt@BSA-RM nanoplatform, we conducted a comprehensive assessment and comparison of the effects of Pt@BSA-RM and Pt@BSA combined with X-rays on tumor growth in vivo. As shown in the tumor photographs, while the Pt@BSA and X-ray therapy (Pt@BSA + X-ray) exhibited some inhibitory effects on tumor growth, the tumor suppression effect was significantly more pronounced in mice that received Pt@BSA-RM injection, followed by X-ray irradiation (Pt@BSA-RM + X-ray) (Fig. 5A). Statistical results of the tumor volume and mass also indicated that the synergistic effect of Pt@BSA-RM and X-rays achieved the optimal tumor suppression effect (Fig. 5B and C). Surprisingly, after a period, the Pt@BSA and X-ray therapy had an adverse effect on the mouse's body weight, indicating that Pt@BSA and radiation therapy inevitably had side effects. However, this adverse effect was eliminated after combined treatment with Pt@BSA-RM (Fig. 5D). These results strongly demonstrate that Pt@BSA-RM mitigates the toxicity of Pt@BSA and X-rays and enhances X-ray sensitivity, thereby inhibiting tumor growth in vivo.

Fig. 5. Inhibitory effect of Pt@BSA-RM combined with X-ray therapy on tumor growth in mice. (A) Tumor photographs of mice in the control group, Pt@BSA-RM group, and Pt@BSA and Pt@BSA-RM combined with X-ray therapy group (n = 3). (B) Tumor volume in each group of mice (n = 3). (C) Tumor weight in each group of mice (n = 3). (D) Body weight of mice in each group (n = 3). Data are presented as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; ns, no significance.

Fig. 5

Open in a new tab

3.5. Pt@BSA-RM rescued Pt-induced damage to mouse kidneys while inhibiting tumor proliferation and enhancing apoptosis

Pt is a commonly used chemotherapy drug with unignorable organ toxicity, particularly to the kidneys, which are the primary excretory organ for Pt compounds and are therefore more susceptible to damage. To further evaluate the systemic effects of the Pt@BSA-RM system on mice, we conducted histological and pathological analyses of various organs and tumor tissues in mice. H&E staining results revealed that Pt@BSA and X-ray had no effect on the spleen, liver, and lungs but did exacerbate vacuolation in the kidneys of mice and caused minor histological damage to the heart. However, Pt@BSA-RM combined with X-ray treatment significantly improved vacuolation degeneration in the kidneys of mice, and the hearts of mice also returned to a normal morphology (Fig. 6A). Next, we assessed the proliferative capacity of tumor tissues through IHC staining. The most effective proliferation inhibition was found in the Pt@BSA-RM + X-ray group, as evidenced by Ki67 expression (Fig. 6B). As expected, Pt@BSA-RM combined with radiotherapy also showed a strong promotion of apoptosis, with the most pronounced TUNEL fluorescence intensity observed in this group (Fig. 6C).

Fig. 6. Pt@BSA-RM combined with X-ray therapy exhibits organ protection and tumor suppression effects. (A) Representative histological sections of the heart, liver, spleen, lungs, and kidneys of mice in each group (scale bar = 100 μm). (B) IHC staining of Ki67 in tumor tissues in each group of mice (scale bar = 100 μm). (C) Apoptosis assessed by TUNEL staining of mice in each group (scale bar = 100 μm).

Fig. 6

Open in a new tab

4. Discussion

In general, this study prepared a physically and chemically stable nanoplatform, Pt@BSA-RM. Furthermore, through in vitro experiments, we preliminarily confirmed that the combination of Pt@BSA-RM with X-ray radiation enhanced the anticancer efficacy of radiotherapy, manifested as further inhibition of BC cell proliferation and increased apoptosis. In in vivo experiments, Pt@BSA-RM similarly enhanced the radiosensitivity of X-ray radiation, inhibited the in vivo growth of tumor cells, and resulted in lower Ki67 expression compared to X-ray radiation alone. More importantly, when combined with Pt@BSA-RM, elevated glycolysis, due to the therapeutic characteristics of radiotherapy, was suppressed, while mitochondrial damage was exacerbated, fully confirming the benefit of Pt@BSA-RM as a sensitizer for radiotherapy in BC treatment.

The benefits of nanotechnology-assisted radiotherapy have been strongly confirmed. RGD-conjugated mesoporous silica-encapsulated gold nanorods (pGNRs@mSiO2-RGD) combined with 6 MV X-ray irradiation can reduce the tumor volume by approximately 70% compared to the radiotherapy-only group in a nude mouse in situ TNBC model.29 Bi2S3–MoS2 nanoparticles (BMNPs) combined with radiation therapy can effectively inhibit lung metastasis in 4T1 TNBC tumor-bearing mice and prolong animal survival.30 Similarly, in our study, Pt@BSA-RM rendered BC cells more sensitive to radiation both in vitro and in vivo, magnified tumor growth inhibition, and achieved a radiotherapy sensitization effect for X-rays.

The molecular basis for tumor resistance to radiotherapy is highly complex. Hypoxia-induced HIF-1α suppresses radiation-induced apoptosis by activating the autophagy pathway.31 Triple-negative breast cancer (TNBC) cells activate the eIF2α/ATF4 axis to induce excessive glutathione (GSH) synthesis, significantly increasing the intracellular GSH level and ROS scavenging capacity, ultimately leading to reduced radiosensitivity.32 The upregulation of KAT7 in BC cells enhances the PI3K/AKT signaling pathway and confers radiation resistance to cells.33 More seriously, radiotherapy exerts pressure on the epigenetic reprogramming of tumor cells, alleviating ionizing radiation damage through chromatin remodeling and relying on effective DNA damage repair, cell cycle regulation, and metabolic reprogramming to achieve resistance to radiotherapy. These measures promote the selective retention and amplification of drug-resistant clones, which is also the biological basis for subsequent local recurrence and distant metastasis.33 In this study, we found that Pt@BSA-RM coirradiation promoted the production of ROS in breast cancer cells and led to the aggravation of DNA damage, which is the mechanism of radiosensitization of this novel nanosystem.

In this study, we found that radiation exposure exacerbated metabolic reprogramming in BC cells, with increased glycolysis and decreased oxidative phosphorylation, leading to an elevated total ATP content and lactate production to facilitate the rapid functional repair of damage. However, these apparently deleterious effects on cancer inhibition were corrected by the combined use of Pt@BSA-RM and X-ray irradiation, where the excessive accumulation of platinum in the mitochondria disrupted the membrane potential, decreased the expression of glycolytic enzymes, and interrupted the supply of aerobic and anaerobic energy. Similar to our findings, in in situ hepatocellular carcinoma, the nanoplatform HA-PEG@CuO2, synergistically with radiotherapy, can reverse the tumor's hypoxic microenvironment, promoting a shift in the cellular metabolism from glycolysis to OXPHOS, thereby enhancing the therapeutic effect on the tumor.34 Indeed, the regulation of glycolytic enzymes by platinum drugs has been demonstrated, although the mechanism is still unclear. For example, Zhang et al. found that cisplatin downregulated HK2 in cisplatin-sensitive ovarian cancer cells, which is an important mechanism for chemosensitization.35 The platinum complex downregulated the expression of LDHA and LDHB, inhibited glycolysis and glucose oxidation, and ameliorated drug resistance caused by immune escape.36

As is well known, the use of platinum-based drugs inevitably leads to organ toxicity, such as kidney damage.37 Consistent with this, we observed severe kidney vacuolization in a BC tumor-bearing mouse model, suggesting that traditional platinum-based radiotherapy strategies indeed cause severe kidney damage. However, encouragingly, the use of Pt@BSA-RM avoided histological changes in the kidneys, thereby maximizing the benefits of radiotherapy, although the mechanism needs to be fully validated prospectively.

Our study also has some limitations. For example, we did not validate the difference in the inhibitory effect of Pt@BSA-RM versus cisplatin separately combined with X-ray treatment on breast cancer in vitro through an animal model. Furthermore, the present work used a fixed radiation schedule (5 Gy, four fractions) and a single injection-to-irradiation interval (30 min) and did not establish the minimal effective radiation dose or the optimal temporal window for X-ray delivery. A comprehensive comparison of multiple single-fraction doses and a systematic variation in the irradiation interval will be essential in future studies to fully translate the nanoplatform toward clinical application. Besides, we found that Pt@BSA-RM was able to decrease the expression of glycolytic enzymes. However, whether this effect stems from mitochondrial damage or by a direct modulation induced by platinum needs to be further investigated, and the mechanism by which Pt@BSA-RM reduces nephrotoxicity remains to be studied. In summary, our study has fully demonstrated the potential of the Pt@BSA-RM platform in synergistic radiotherapy for BC. This biocompatible nanomaterial system provides a new paradigm for precise radiotherapy in BC, balancing therapeutic efficacy and organ protection.

5. Conclusion

The combination of red blood cell membrane-coated Pt@BSA nanoparticles and radiation therapy has dual benefits: on the one hand, it enhances the sensitivity of BC cells to radiation, inhibits cell proliferation, induces apoptosis, and corrects the overactivation of glycolysis; on the other hand, it reduces the toxicity of Pt. This combined treatment strategy maximizes anticancer effects while minimizing organ damage, thereby effectively improving the efficacy of radiation therapy for BC.

Author contributions

Yuhui Zhang contributed to conceptualization, data curation, formal analysis, investigation, visualization, methodology, and drafting the original manuscript. Yihui Liu contributed to conceptualization, original manuscript drafting, and validation. Dongju Zheng contributed to methodology, formal analysis, and validation. Yihui Liu was responsible for project administration and manuscript review and editing. Yuhui Zhang contributed to conceptualization, methodology, supervision, funding acquisition, and manuscript review and editing.

Conflicts of interest

The authors have no conflicts of interest to declare that are relevant to the content of this article.

Supplementary Material

MD-OLF-D5MD00792E-s001

Acknowledgments

This study was supported by the Natural Science Foundation of Ningxia, China (grant number: 2023AAC03448).

Data availability

All relevant data supporting the findings of this study are included within the article. The data that support the findings of this study are available from the corresponding author upon reasonable request.

Supplementary information, including uncropped Western blot gels, is available. See DOI: https://doi.org/10.1039/d5md00792e.

Notes and references

  1. Xiong X. Zheng L.-W. Ding Y. Chen Y.-F. Cai Y.-W. Wang L.-P. Huang L. Liu C.-C. Shao Z.-M. Yu K.-D. Signal Transduction Targeted Ther. 2025;10:49. doi: 10.1038/s41392-024-02108-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arnold M. Morgan E. Rumgay H. Mafra A. Singh D. Laversanne M. Vignat J. Gralow J. R. Cardoso F. Siesling S. Soerjomataram I. Breast. 2022;66:15–23. doi: 10.1016/j.breast.2022.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Trebinska-Stryjewska A. Szafron L. Rembiszewska A. Wakula M. Tabor S. Sienkiewicz R. Owczarek J. Balcerak A. Felisiak-Golabek A. Grzybowska E. A. J. Oncol. 2019;2019:6375025. doi: 10.1155/2019/6375025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aibe N. Karasawa K. Aoki M. Akahane K. Ogawa Y. Ogo E. Kanamori S. Kawamori J. Saito A. I. Shiraishi K. Sekine H. Tachiiri S. Yoshimura M. Yamauchi C. J. Radiat. Res. 2019;60:142–149. doi: 10.1093/jrr/rry095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Tanić M. Krivokuća A. Čavić M. Mladenović J. Plesinac Karapandžić V. Beck S. Radulović S. Susnjar S. Janković R. Radiat. Oncol. 2018;13:193. doi: 10.1186/s13014-018-1129-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Jiao S. Wang Y. Ma J. Shen J. Zhang X.-Q. Zhou B. Sun X. Xu H. Liu X. Hu K. Zhang F. Hou X. Qiu J. BMC Cancer. 2024;24:1321. doi: 10.1186/s12885-024-13076-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Goodman C. R. Seagle B.-L. L. Friedl T. W. P. Rack B. Lato K. Fink V. Cristofanilli M. Donnelly E. D. Janni W. Shahabi S. Strauss J. B. JAMA Oncol. 2018;4:e180163. doi: 10.1001/jamaoncol.2018.0163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ma Y. Yu L. Yan W. Qiu L. Zhang J. Jia X. BioMed Res. Int. 2022;2022:1987519. doi: 10.1155/2022/1987519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Coates J. T. T. Pirovano G. El Naqa I. J. Med. Imaging. 2021;8:031902. doi: 10.1117/1.JMI.8.3.031902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Rao X. Wang X. He C. Jiang Y. Shao Z. Feng Y. Zhou J. Guo X. Chen X. Clin. Transl. Med. 2024;14:e1787. doi: 10.1002/ctm2.1787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Tew B. Y. Kalfa A. J. Yang Z. Hurth K. M. Simon T. Abnoosian E. Durant S. T. Hamerlik P. Salhia B. Clin. Cancer Res. 2023;29:4492–4503. doi: 10.1158/1078-0432.CCR-23-0290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lu L. Dong J. Wang L. Xia Q. Zhang D. Kim H. Yin T. Fan S. Shen Q. Oncogene. 2018;37:5292–5304. doi: 10.1038/s41388-018-0340-y. [DOI] [PubMed] [Google Scholar]
  13. Arnold C. R. Mangesius J. Portnaia I. Ganswindt U. Wolff H. A. Front. Oncol. 2024;14:1379986. doi: 10.3389/fonc.2024.1379986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ternad I. Penninckx S. Lecomte V. Vangijzegem T. Conrard L. Lucas S. Heuskin A. C. Michiels C. Muller R. N. Stanicki D. Laurent S. Nanomaterials. 2023;13(1):201. doi: 10.3390/nano13010201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Majd M. H. Cancer Plus. 2024;6(1):2770. [Google Scholar]
  16. Da X. Liu X. Li C. Peng Y. Jian Y. Zhou W. Xu Y. Wu Y. Wang X. Zhou Q. Chin. Chem. Lett. 2023;34:108317. [Google Scholar]
  17. Ghorbani Y. Saeedzadeh E. Danafar H. Babapour Mofrad F. Nosrati H. J. Mol. Liq. 2024;409:125472. [Google Scholar]
  18. Guo D. Lei J. H. Rong D. Zhang T. Zhang B. Tang Z. Shen H. M. Deng C. X. Qu S. Adv. Sci. 2022;9:e2205106. doi: 10.1002/advs.202205106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gerweck L. E. Vijayappa S. Kurimasa A. Ogawa K. Chen D. J. Cancer Res. 2006;66:8352–8355. doi: 10.1158/0008-5472.CAN-06-0533. [DOI] [PubMed] [Google Scholar]
  20. Liu S. Piao J. Liu Y. Tang J. Liu P. Yang D. Zhang L. Ge N. Jin Z. Jiang Q. Cui L. Nanomedicine. 2018;13:1371–1383. doi: 10.2217/nnm-2018-0059. [DOI] [PubMed] [Google Scholar]
  21. Charan J. Kantharia N. D. J. Pharmacol. Pharmacother. 2013;4:303–306. doi: 10.4103/0976-500X.119726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Arifin W. N. Zahiruddin W. M. Malays. J. Med. Sci. 2017;24:101–105. doi: 10.21315/mjms2017.24.5.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Abdul Rashid R. Zainal Abidin S. Khairil Anuar M. A. Tominaga T. Akasaka H. Sasaki R. Kie K. Abdul Razak K. Pham B. T. T. Hawkett B. S. Carmichael M.-A. Geso M. Rahman W. N. OpenNano. 2019;4:100027. [Google Scholar]
  24. Li F. L. Liu J. P. Bao R. X. Yan G. Feng X. Xu Y. P. Sun Y. P. Yan W. Ling Z. Q. Xiong Y. Guan K. L. Yuan H. X. Nat. Commun. 2018;9:508. doi: 10.1038/s41467-018-02950-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Buss L. G. Rheinheimer B. A. Limesand K. H. Sci. Rep. 2024;14:845. doi: 10.1038/s41598-023-50877-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Zhong J. Rajaram N. Brizel D. M. Frees A. E. Ramanujam N. Batinic-Haberle I. Dewhirst M. W. Radiother. Oncol. 2013;106:390–396. doi: 10.1016/j.radonc.2013.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Judge J. L. Owens K. M. Pollock S. J. Woeller C. F. Thatcher T. H. Williams J. P. Phipps R. P. Sime P. J. Kottmann R. M. Am. J. Physiol. 2015;309:L879–L887. doi: 10.1152/ajplung.00153.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Gurunathan S. Jeyaraj M. La H. Yoo H. Choi Y. Do J. T. Park C. Kim J. H. Hong K. Int. J. Mol. Sci. 2020;21(2):440. doi: 10.3390/ijms21020440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zhao N. Yang Z. Li B. Meng J. Shi Z. Li P. Fu S. Int. J. Nanomed. 2016;11:5595–5610. doi: 10.2147/IJN.S104034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Gao F. Wang D. Zhang T. Ghosal A. Guo Z. Miao Y. Li G. Liu X. Lu J. Yu J. Fan H. Zhao L. Chem. Eng. J. 2020;395:125032. [Google Scholar]
  31. Zhong R. Xu H. Chen G. Zhao G. Gao Y. Liu X. Ma S. Dong L. Tumor Biol. 2015;36:7077–7083. doi: 10.1007/s13277-015-3425-z. [DOI] [PubMed] [Google Scholar]
  32. Bai X. Ni J. Beretov J. Wasinger V. C. Wang S. Zhu Y. Graham P. Li Y. Redox Biol. 2021;43:101993. doi: 10.1016/j.redox.2021.101993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Song J. Yang P. Chen C. Ding W. Tillement O. Bai H. Zhang S. Signal Transduction Targeted Ther. 2025;10:219. doi: 10.1038/s41392-025-02266-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shao N. Yang Y. Hu G. Luo Q. Cheng N. Chen J. Huang Y. Zhang H. Luo L. Xiao Z. J. Nanobiotechnol. 2024;22:772. doi: 10.1186/s12951-024-03011-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhang X. Y. Zhang M. Cong Q. Zhang M. X. Zhang M. Y. Lu Y. Y. Xu C. J. Int. J. Biochem. Cell Biol. 2018;95:9–16. doi: 10.1016/j.biocel.2017.12.010. [DOI] [PubMed] [Google Scholar]
  36. Zhang L. Zhao J. Su C. Wu J. Jiang L. Chi H. Wang Q. Front. Immunol. 2025;16:1573686. doi: 10.3389/fimmu.2025.1573686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wu Y. Xu X.-Y. Yan F. Sun W.-L. Zhang Y. Liu D.-L. Shen B. Onco Targets Ther. 2019;12:4849–4857. doi: 10.2147/OTT.S192373. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

MD-OLF-D5MD00792E-s001
MD-OLF-D5MD00792E-s001.pdf (202KB, pdf)

Data Availability Statement

All relevant data supporting the findings of this study are included within the article. The data that support the findings of this study are available from the corresponding author upon reasonable request.

Supplementary information, including uncropped Western blot gels, is available. See DOI: https://doi.org/10.1039/d5md00792e.

Articles from RSC Medicinal Chemistry are provided here courtesy of Royal Society of Chemistry

RESOURCES