Silencing of lncRNA HOTAIR Using Eyedrops as a Potential Treatment for Diabetes-Associated Retinal Dysregulation and Dysfunction

Eric Wang; Biao Feng; Shali Chen; Honglin Wang; Ting Ling; Subrata Chakrabarti

doi:10.1167/iovs.67.1.24

. 2026 Jan 12;67(1):24. doi: 10.1167/iovs.67.1.24

Silencing of lncRNA HOTAIR Using Eyedrops as a Potential Treatment for Diabetes-Associated Retinal Dysregulation and Dysfunction

Eric Wang ¹, Biao Feng ¹, Shali Chen ¹, Honglin Wang ¹, Ting Ling ², Subrata Chakrabarti ^1,^2,^✉

PMCID: PMC12810421 PMID: 41805097

Abstract

Purpose

Diabetic retinopathy (DR), a major cause of blindness in working-age adults, is driven by vascular dysfunction mediated by various angiogenic regulators. Although anti-VEGF therapies reduce vision impairment in some patients, they have limitations that leave room for novel treatments. The long non-coding RNA (lncRNA) HOX transcript antisense intergenic RNA (HOTAIR), which is upregulated in the retina in diabetes and regulates a range of factors including VEGF, contributes to DR pathology. Silencing HOTAIR prevents the dysregulation of VEGF and other factors. We explored targeting HOTAIR using siRNA conjugated to n-acetylgalactosamine (GalNAc) moieties for retinal delivery as a means of preventing diabetes-associated pathology in the retina.

Methods

GalNAc-modified siHOTAIR was evaluated in human retinal endothelial cells in vitro and using various models in vivo. The effects of GalNAc-modified siHOTAIR were assessed on the RNA, protein, and functional levels.

Results

GalNAc-modified siHOTAIR effectively entered retinal endothelial cells in vitro, and inhibited glucose-induced endothelial dysfunction by blocking multiple factors, including VEGF-A. GalNAc-siRNA localized to the retina in vivo following topical delivery, and prevented diabetes-induced pathological retinal changes with efficacy comparable to intravitreal injection.

Conclusions

GalNAc-modified siHOTAIR thus represents a potential therapeutic strategy that not only inhibits VEGF but also targets other pathogenic mediators regulated by HOTAIR, potentially offering broader efficacy than anti-VEGF monotherapy. Furthermore, it achieves this via noninvasive, topical delivery, circumventing the need for intravitreal injections required by current treatments. Thus, with further development, GalNAc-modified siHOTAIR may become an overall better approach to treating DR.

Keywords: long non-coding RNA (lncRNA), HOTAIR, siRNA, diabetic retinopathy (DR), treatment, GalNAc

Diabetic retinopathy (DR) is one of the most prevalent chronic complications of diabetes, affecting nearly all patients with type 1 diabetes, and over 60% of patients with type 2 diabetes.¹^,² DR is broadly separated into two progressive stages, a nonproliferative, and a proliferative phase.³^,⁴ Vision impairments can occur during either phase, making DR the leading cause of vision impairments in working-aged adults.³^,⁴ DR begins with alterations in vascular pathophysiology and can lead to visual impairments via progression to diabetic macular edema via excessive vascular permeability, or to neovascularization via excessive and disorganized vascular growth.³^,⁴ Managing vascular dysfunction in the retina is a key approach to preventing vision loss in DR.³^,⁴

Vascular endothelial growth factor A (VEGF-A) is a key vascular regulator, and influences processes such as angiogenesis and vascular permeability.³^,⁴ VEGF-A is produced and released by various cell types in the retina, including retinal endothelial cells, pigment epithelial cells, Müller glia, astrocytes, and ganglion cells.⁵ VEGF-A binds primarily to receptors on vascular endothelial cells, where they can promote cell division and vascular leakage.³^–⁵ Targeting VEGF is currently a central approach to managing DR.³^–⁵ Anti-VEGF antibodies or other inhibitors, such as fusion proteins, are typically injected into the vitreous where they bind to VEGF proteins and prevent their effects on the retinal vasculature.³^–⁵ Over the past several decades, this approach has been greatly beneficial in reducing the incidence of DR-related blindness.⁶^,⁷ However, anti-VEGF-A therapies do have certain limitations, such as primary or secondary failure in up to 70% of patients, and the induction of adverse local or systemic effects.⁶^–⁸ Furthermore, other angiogenic regulators, such as angiopoietin-like protein 4 (ANGPTL4) and VEGF-C, are also dysregulated in DR and can produce angiogenic effects, unaffected by anti-VEGF-A biologics.⁹^–¹¹

HOX transcript antisense intergenic RNA (HOTAIR) is a long non-coding RNA (lncRNA), which is an upstream regulator of VEGF and other angiogenic factors in the retina.¹² The lncRNAs are a class of RNAs that are transcribed from the genome but not translated into functioning proteins.¹³^,¹⁴ The lncRNAs are regulatory molecules that can influence other cellular regulators and exert broad effects over multiple cellular processes, rather than acting on specific signaling pathways.¹³^,¹⁴ We have shown that the lncRNA HOTAIR is upregulated in the retina in response to high glucose in diabetes, and facilitates epigenetic activation of proinflammatory, proangiogenic, and oxidative pathways in retinal endothelial cells.¹² Inhibition of HOTAIR by transfection of siRNAs can lead to robust reduction in glucose-induced inflammation, angiogenesis, and oxidative stress responses, both in vitro and in the retinas of mice following intravitreal injection of siHOTAIR in liposome-based transfection reagents.¹²

Although effective at suppressing various biological regulators of inflammation, angiogenesis, and oxidative stress response, targeted delivery of RNAs in patients can present with major challenges. Transfection reagents, which form droplets that facilitate entry of siRNA into cells, are nonspecific and can be cytotoxic.¹⁵ Thus, novel ways of delivering siRNA, and siHOTAIR specifically, into the retina without using transfection reagents were needed. N-acetylgalactosamine (GalNAc)-conjugation is an emerging method for siRNA delivery, currently being used to target the liver.¹⁵ GalNAc-siRNAs bind to asialoglycoprotein receptors (ASGPRs), which facilitate uptake via endocytosis.¹⁵ ASGPRs are expressed at highest levels in hepatocytes, and several GalNAc-conjugated siRNA drugs are entering the market for liver diseases.¹⁵^,¹⁶ However, we found, using spatial transcriptomic analysis, that the transcript-level expression of asialoglycoprotein receptor 1 (ASGR1) was expressed in retinal microvascular endothelial cells, and upregulated in diabetes.¹⁷ Thus, we explored the possibility of using siRNA molecules conjugated with GalNAc moieties to effectively facilitate delivery of siRNA and prevent high glucose-induced dysfunction.

Methods

Cell Culture

Human retinal endothelial cells (HRECs; Olaf Pharmaceuticals) were cultured with endothelial cell growth basal medium-2 (EBM2; Lonza) supplemented with microvascular endothelial growth medium-2 (EGM2; Lonza), 10% v/v fetal-bovine serum, and 100 µg/mL penicillin/streptomycin in a humidified hood held at 37°C with 5% CO². Once the cells reached 80% to 90% confluency, the full growth medium was aspirated, replaced with serum-reduced medium, and incubated for 24 hours. After 24 hours of serum starvation, the cells were treated to normal glucose (NG; 5 mM) or high glucose (HG; 25 mM) concentrations for 48 hours. All cells were between passages 4 and 6.

Transfection

HRECs were transfected with anti-HOTAIR siRNA (siHOTAIR) to knock down HOTAIR expression. Transfection with scrambled siRNAs (SCR) were used as a control. Conventional transfection occurred prior to serum starvation and glucose treatments using lipofectamine 2000 (Invitrogen) in OPTI-MEM medium (Gibco), according to the manufacturer's instructions. The siHOTAIR or SCR were transfected at 100 nM into each sample. Following 6 hours of incubation in the transfection mixture, the cells were recovered in full growth medium for 24 hours, after which, the cells were serum starved and treated to varying levels of glucose, as mentioned above.

Three custom GalNAc-modified siHOTAIR molecules were synthesized by BOC Sciences (Figs. 1A–C), and were transfected without lipofectamine, in EBM2 medium supplemented with EGM2. The different GalNAc-modified siHOTAIRs had different GalNAc configurations but had the same sequences, with the sense strand being 5′-CCAAAGAGUCUGAUGUUUACA-3′-GalNAc, and the antisense strand being 5′-UAAACAUCAGACUCUUUGGGG-3′. Then, 100 nM of GalNAc-modified siHOTAIR were used for each sample. The time between transfection and glucose treatment were the same between conventional transfection and reagent-free transfection.

Figure 1. — **GalNAc configurations and ASGR1 expression.** (A) Structural diagram of GalNAc modification version 1, hereafter known as GalNAc-siHOTAIR. (B) Structural diagram of GalNAc modification version 2, hereafter known as GalNAc-siHOTAIR-B. (C) Structural diagram of GalNAc modification version 3, hereafter known as GalNAc-siHOTAIR-C. The mRNA expressions of (D) *Asgr1* and (E) *ASGR1* increased in response to hyperglycemia and high glucose (HG; 25 mM), respectively. (F) HG caused upregulation of HOTAIR compared to normal glucose (NG; 5 mM) groups, blocking *ASGR1* using a neutralizing antibody (Ab) prevented knockdown of HOTAIR by GalNAc-modified siHOTAIR in HG treated cells (mRNA and lncRNA expressions represented as ratios to *ACTB* mRNA, and normalized to the left-most group; n = 4 for mouse *Asgr1*, n = 5 for human *ASGR1*, and n = 6 for *HOTAIR*; data presented as mean ± SD; * = P < 0.05 as determined by Student's t-test or 1-way ANOVA followed by Tukey's HSD test).

ASGR1 Inhibition

Neutralizing antibodies were used to assess the role of ASGR1 in reagent-free transfection of GalNAc-modified siRNA. Anti-ASGR1 antibodies (5 µg/mL; Proteintech) were added to HRECs prior to GalNAc-modified siHOTAIR as a pretreatment. GalNAc-modified siHOTAIR was added after a 1 hour incubation period.

In Vitro Permeability Assay

In vitro permeability was assessed using a transwell assay. HRECs were seeded on a transwell insert membrane in EBM2 with EGM2. The inserts were then transferred to wells containing the same growth medium and incubated until fully confluent. Confluent cells were treated to NG or HG, as described above. After 48 hours of glucose treatment, 5 µL streptavidin-horse radish peroxidase was added to the insert. The inserts were then transferred to new wells containing 1 mL low serum medium and incubated for 24 hours. After incubation, 20 µL of medium from the wells were transferred into a 96-well plate and 50 µL of TMB substrate was added. The plate was shaken until the color change occurred, at which time 50 µL of stop solution was added and the optical density at 450 nm was read using ChroMate Microplate Reader (Awareness Technology).

In Vitro Tube Formation Assay

To assess tube formation, cells were seeded in 96-well plates coated with phenol red-free, reduced growth factor basement membrane extract after transfection, as described previously.¹² Full growth medium (EBM2 with EGM2) was used during seeding. One hour after cells have seeded, full growth medium was replaced with low serum medium containing low (5 mM) or high (25 mM) concentrations of glucose. Cells were incubated for 6 hours and images were taken to assess the progress tube formation (angiogenesis). Analysis of tube formation was done using ImageJ software and the Angiogenesis Analyzer tool.

Animal Models

Animals were held in the university facility and cared for according to the Guiding Principles in the Care and Use of Animals. Experimental protocols were approved by Western University Ethics Committee and Animal Care and Veterinary Services, 2022-095 and 2024-036 for mice and rat models, respectively. All experiments adhere to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Male and female C57BL/6 mice were randomly assigned to either the diabetic group or non-diabetic control group. Diabetes was induced at 8 weeks of age via 5 consecutive daily intraperitoneal injections of streptozotocin (STZ; 50 mg/kg in citrate buffer, pH4.5; controls received only buffer). The inclusion criterion for diabetic mice was blood glucose measurements of over 16.7 mM/L following the final injection. Age- and sex-matched non-diabetic controls were used. Mice were monitored for body weight and blood glucose on a biweekly basis, and for urine ketone and glucose levels on a weekly basis (Supplementary Fig. S1). After 1 month, the mice were euthanized, and the eyes were harvested. Some eyes were randomly selected and fixed in 10% neutral-buffered formalin and embedded in paraffin and used for histological analyses. Other tissues were also fixed similarly for histological analyses. The remainder of the eyes were stored at –80°C for further analyses. All analyses were performed in a masked fashion.

Male Sprague-Dawley rats were randomly assigned to either the diabetic or non-diabetic groups. Diabetes was induced at 6 weeks via a single intraperitoneal injection of STZ (65 mg/kg in citrate buffer, pH4.5; controls received only buffer). The inclusion criteria for diabetic rats was blood glucose measurements of over 20 mM/L 1 week following the injection. Age- and sex-matched non-diabetic controls were used. Rats were monitored for body weight on a biweekly basis (Supplementary Fig. S2). Urine ketone and glucose levels were monitored using a urine stick (URiSCAN GluKeto2, YD Diagnostics Corp) on a weekly basis. Given that urine glucose (+++) and ketone levels (negative or trace) were stable over the monitoring period, blood glucose was periodically assessed in order to minimize injury and stress to the animals. After the experimental period, 1 month for short-term and 3 months for longer-term, the rats were euthanized, and the eyes were harvested. Some eyes were randomly selected and fixed in 10% neutral-buffered formalin and embedded in paraffin and used for histological analyses. Other tissues from the same animal were fixed as well. The remainder of the eyes were stored at −80°C for further analyses. All analyses were performed in a masked fashion.

For a genetic model of type 2 diabetes, male B6.BKS(D)-Lepr^db/J spontaneously diabetic mice were used. The inclusion criterion for the diabetic group was blood glucose measurements of over 20 mM/L. Age-matched B6 mice were used as controls. The mice were monitored as above. After 1 month, they were euthanized, and tissues were collected as above.

In Vivo Matrigel Plug Assay

Cold growth factor reduced Matrigel (Corning) supplemented with VEGF (PeproTech; AF-450-32-10 UG), with or without GalNAc-modified siHOTAIR (sense: 5′-CCAAUAUUUAUUUUUAAAAAA-3′-GalNAc; antisense: 5′-UUUUAAAAAUAAAUAUUGGAG-3′) were injected subcutaneously into the backs of the mice. The Matrigel solidified as it warmed up after injection. The mice were monitored over 14 days, after which they were euthanized and the Matrigel plugs were collected. Isolated Matrigel plugs were fixed in formalin and embedded with paraffin for histological analysis of endothelial cell recruitment and angiogenesis.

Intravitreal Injection

Intravitreal injections were given on a weekly basis. Animals were anesthetized using isoflurane in oxygen (induction at 4% isoflurane with 1.5% O2, maintenance at 2% isoflurane with 1.5% O2). Once proper anesthetic depth was reached, animals were given a drop of Alcaine (Alcon) prior to injection. Then, 1 µL of treatment compound was injected into the left eyes of the mice using a 10 µL glass syringe (Hamilton, Reno, NV, USA) and a 34-gauge needle. Next, 10 µL was injected for rat eyes, using 0.3 mL insulin syringe (Sol M, Chicago, IL, USA) and an integrated 31-gauge needle. Treatment compound was either GalNAc-modified siHOTAIR (100 µM) or aflibercept (120 µg/10 µL). The right eyes received mock treatments of only water for the initial experiment, and eye drops for the latter experiments. Following injection, animals were kept under anesthesia for 1 extra minute, then moved to a heated surface to recover until normal ambulation was observed. Animals were regularly monitored post-injection. No post-surgical ocular complications or toxicity were observed.

Eyedrops

Eyedrops were given daily. For mice, the animal was picked up from the cage, scruffed securely, then held against a flat surface. Then, 2.5 µL of GalNAc-modified siHOTAIR (100 µM) was applied to the right eye using a micropipette. For rats, the animals were securely wrapped, then held against a table. Next, 5 µL of GalNAc-modified siHOTAIR (100 µM) was applied to the right eye using a micropipette (sense: 5′-GAAGAUGCGCCCAGAGAAAUU-3′-GalNAc; antisense: 5′-UUUCUCUGGGCGCAUCUUCUU-3′). All animals were held steady for an additional 15 seconds following the eyedrop to ensure proper coverage of the eye. No recovery period was needed. Animals were regularly monitored; no toxicity was observed.

GalNAc-Modified siRNA Localization

Diabetic mice were given eyedrops as described above, using FAM-tagged GalNAc-modified siHOTAIR in the right eye, and water in the left. The mice were treated for 1 week and euthanized a day after the final eyedrop. Total diabetic duration at time of euthanization was 1 month. Tissues were collected, embedded in optimum cutting temperature (OCT) compound, and cryosectioned. Frozen tissue sections were stained with DAPI and imaged using a fluorescent microscope (Olympus BX51; Olympus, Tokyo, Japan). Images were processed using an Infinity 3 camera (Lumenera Corporation, Ottawa, Canada) and its associated software.

Similar studies were carried out through Pharmalegacy, a CRO, using New Zealand rabbits with STZ-induced diabetes. Similarly to the mice, 1-month diabetic rabbits were given daily eyedrops with FAM-tagged GalNAc-modified siHOTAIR in the right eye and water in the left, for 1 week. Afterward, the animals were euthanized, and tissues were collected and examined as above.

RNA Analysis

For mRNA and lncRNA, total RNA was isolated using TRIzol reagent (Invitrogen) per the manufacturer's instructions. For quantification of siHOTAIR, small RNAs were isolated using miRNeasy (Qiagen) according to the manufacturer's instructions. RNA concentrations were measured using the SpectraMax QuickDrop Spectrophotometer (Molecular Devices). Then, 2 µg of total RNA was used to synthesize cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems) according to the manufacturer's instructions. SYBR qPCR was performed using the LightCycler 96 system (Roche Diagnostics) to assess the expressions of target genes (primer sequences in Table 1). Gene expressions were quantified using the standard curve method, and expressions of all genes of interest were normalized to that of β-actin (ACTB/Actb) and presented relative to the left-most condition/group. For quantification of siHOTAIR, reverse transcription was performed using specifically designed stem loop primers (sequence: 5′- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCCAATA-3′), followed by Taqman qPCR (forward primer: 5′-GCGCGCGTTTTAAAAATAAATA-3′ reverse primer: 5′-AGTGCAGGGTCCGAGGTA-3′ probe: FAM-TCGCACTGGATACGACCTCCAA-BHQ1) and data were normalized to U6 snRNA. This approach has been proven by others for the quantification of siRNA for pharmacokinetic and pharmacodynamic studies.¹⁸^,¹⁹

Table 1.

Primer Sequences for qPCR

Gene	Species Specificity	Sequence (5′–3′)
ACTB	Human	GATGAGATTGGCATGGCTTT
		GTCACCTTCACCGTTCCAGT
HOTAIR	Human	GGTAGAAAAAGCAACCACGAAGC
		ACATAAACCTCTGTCTGTGAGTGCC
VEGFA	Human	GAACTTTCTGCTGTCTTGGG
		CTTCGTGATGATTCTGCCCT
VEGFC	Human	CTCTCTCTCAAGGCCCCAAA
		AGTCATCTCCAGCATCCGAG
ANGPTL4	Human	TTGGTACCTGTAGCCATTCC
		GAGGCTAAGAGGCTGCTGTA
ASGR1	Human	GAGAGTGACCACCATCAGCT
		TCGCTGTGAAGTTGCTGAAC
Actb	Mouse	TGTGGATCAGCAAGCAGGAG
		TGCGCAAGTTAGGTTTTGTC
Hotair	Mouse	GAGCCAGAGCTGAAGGTATG
		AAGACACGCACGGAGAAAGG
Vegfa	Mouse	ATGCGGATCAAACCTCACCA
		CTTTCTTTGGTCTGCATTCAC
Vegfc	Mouse	CGCTGTGTCCCATCGTATTG
		AGACTTGGGCCTCTGTTACC
Angptl4	Mouse	TTGGTACCTGTAGCCATTCC
		GAGGCTAAGAGGCTGCTGTA
Asgr1	Mouse	TTCCAGCACCTGGACAATGA
		ACAGACAACCACCAGCAACA
Il1b	Mouse	ACCTGGGCTGTCCTGATGAGAG
		CCACGGGAAAGACACAGGTAGC
Ccl2	Mouse	TTGTCACCAAGCTCAAGAGAGA
		GAGGTGGTTGTGGAAAAGGTAG
Actb	Rat	GGACTTCGAGCAAGAGATGG
		AGGAAGGAAGGCTGGAAGAG
Hotair	Rat	CAGAGGTCCCCAACAGAGAA
		CTATGGCTGGTCCTCTTCCA
Vegfa	Rat	GCCCTGAGTCAAGAGGACAG
		GAGGAGGAGGAGCCATTACC
Vegfc	Rat	CGCTGTGTCCCATCATATTG
		CTGTCTGGTCACTGGCAGAA
Angptl4	Rat	AGTGACTGGAGGACCCCTTT
		GCTCCTGGGAACCCTATCTC
Ang2	Rat	TCAGCACTATGATGCCAAGC
		GTGGTGATCTGGAAGGGAGA

Open in a new tab

*Primers were designed to be exon-spanning, for multi-isoform genes, primers were designed to cover all major isoforms.

Protein Analysis

ELISA was used to quantify protein expression from in vivo samples. Briefly, total protein was extracted from samples using RIPA buffer (Millipore) containing protease inhibitor (Roche). Total protein concentration was assessed using the BCA assay (Thermo). VEGF-A (BIOMATIK; EKF58028) and ANGPTL4 (CUSABIO; CSB-EL001712RA) ELISA kits were used according to the manufacturer's instructions. Optical densities were measured at 450 nm using the ChroMate Microplate Reader (Awareness Technology).

Immunohistochemical and Histologic Analyses

For immunohistologic analyses, formalin-fixed paraffin embedded sections (5 µm) were stained using with diaminobenzidine (DAB Peroxidase Substrate; Vector Laboratories) against CD31 (ab281583; abcam), IgG (Goat Anti-Rat IgG Polymer Detection Kit; Vector Laboratories), or albumin (ab192603; abcam). The slides were counterstained with hematoxylin and examined on a microscope. CD31+ cells were counted to quantify cell recruitment. IgG and albumin staining were used to assess vascular permeability, stained sections were scored in a masked fashion (–, ±, +, and ++). For histological analyses, the tissues were stained with hematoxylin and eosin and examined using a bright field microscope.

Serum Toxicology Analyses

Blood was taken at the time of euthanization and allowed to clot at room temperature overnight at 4°C. The blood was centrifuged to separate and isolate the serum. The serum assays for aspartate transferase (AST), alanine aminotransferase (ALT), and creatinine were performed by the Animal Health Laboratory at the University of Guelph.

Statistical Analysis

Statistical analyses were done using the PRISM version 10 software (GraphPad). Statistical significances were determined using Student's t-test, 1-way ANOVA, followed by Tukey's post hoc test, or 2-way ANOVA as necessary. The threshold of significance (α) was set at P ≤ 0.05.

Results

High Glucose Increases ASGR1 Expression in HRECs, Facilitating Uptake of GalNAc-Modified siHOTAIR With Biological Effects

First, we wanted to confirm the findings of the transcriptomic data (GSE263128). We found that high glucose significantly induced the expression of Asgr1 in retinas of diabetic compared to non-diabetic mice (Fig. 1D). Specifically, we found that high glucose increased ASGR1 expressions retinal endothelial cells in vitro (Fig. 1E). We further found that ASGR1 is important for the uptake of GalNAc-modified siRNA by HRECs (Fig. 1F). Following this, we assessed the importance of GalNAc configuration by using various different GalNAc-modified siHOTAIRs with the same sequence but different GalNAc modifications. Each configuration was effective at knocking down HOTAIR and its downstream angiogenic effector molecules, VEGFA and ANGPTL4 (Figs. 2A–C). None of the configurations showed significantly better performance than any of the others, thus, we decided to move forward with the simplest configuration.

Figure 2. — **Suppression of HOTAIR and angiogenic factors.** Different configurations of GalNAc siHOTAIR similarly knocked down expressions of (A) HOTAIR and prevented the upregulation of (B) *VEGFA* and (C) *ANGPTL4* following induction by high glucose (HG; 25 mM). Using transfection reagent did not significantly influence the effect GalNAc-siHOTAIR on (D) HOTAIR or (E) *VEGFA*. Protein expressions of (F) VEGFA and (G) VEGFC were similarly reduced by GalNAc-siHOTAIR following HG induction (lncRNA and mRNA expressions represented as ratios to *ACTB* mRNA, and normalized to the left-most group; protein expressions presented as ng/mL; n = 6 for RNA data, and n = 4 for protein data; data presented as mean ± SD; * = P < 0.05 as determined by 1-way ANOVA followed by Tukey's HSD test).

After confirming the ability to enter cells without transfection reagents, we wanted to see if the efficacy of GalNAc-modified siHOTAIR would be improved with the usage of transfection reagent. We also wanted to compare the efficacy of GalNAc-modified siHOTAIR with conventional siHOTAIR. We found that the addition of transfection reagent did not improve the efficacy of GalNAc-modified siHOTAIR in knocking down HOTAIR or its main angiogenic effector, VEGFA (Figs. 2D, 2E). Furthermore, GalNAc-modified siHOTAIR with or without transfection reagent, had similar efficacy as conventional siHOTAIR with transfection reagent (Supplementary Fig. S3). GalNAc-modified siHOTAIR without transfection reagent had similar efficacy as conventional siHOTAIR with transfection reagent in inhibiting protein expressions of VEGF-A and VEGF-C (Figs. 2F, 2G). Furthermore, GalNAc-modified siHOTAIR recovered glucose-induced suppression of microRNAs 146a and 200b (Supplementary Fig. S4), which we have previously shown to mediate inflammation and angiogenic processes in diabetic retinopathy.²⁰^,²¹ We have also previously shown that miRNA 146a and 200b suppression are glucose-specific responses and independent of osmolarity.²⁰^,²¹

GalNAc-Modified siHOTAIR Prevents Glucose-Induced Functional Alterations in Endothelial Cells

Beyond gene expression changes, we wanted to assess the ability of GalNAc-modified siHOTAIR to effect glucose-induced functional alterations in endothelial cells. To this effect, we conducted in vitro tube formation and permeability assays, and an in vivo Matrigel plug assay. We found that GalNAc-modified siHOTAIR significantly reduced the endothelial permeability in the high glucose-treated group (Fig. 3A). GalNAc-modified siHOTAIR also significantly reduced the number of meshes, junctions, nodes, and total tubule length in the tube formation assay, reflecting reduced angiogenic activity (Fig. 3B). Similar findings were seen in the in vivo Matrigel plug assay, where GalNAc-modified siHOTAIR inhibited the infiltration of CD31+ endothelial cells into the Matrigel plug following VEGF-A stimulation (Fig. 3C).

Figure 3. — **Functional effects and properties of GalNAc-modified siHOTAIR.** GalNAc-modified HOTAIR prevented high glucose-induced increases in (A) permeability and (B) tube formation capacity in in vitro assays, reflecting its regulation of glucose-related angiogenic processes. (C) GalNAc-modified siHOTAIR also reduced VEGF-A-mediated recruitment of CD31+ endothelial cells in an in vivo Matrigel plug assay. Matrigel sections with VEGF-A only had 70 ± 15 CD31+ cells per high powered field, whereas sections with VEGF-A and GalNAc had 11 ± 8 CD31± cells per field. (D) FAM-labelled GalNAc-modified siHOTAIR further showed the ability to localize to the retina when delivered topically via eyedrops, as seen via green fluorescence in the retina, and lack thereof in the other regions of the eye. (E) Retinal abundance of GalNAc-siHOTAIR increased until the 1-hour mark and plateaued. The liver and kidneys showed minimal abundance of GalNAc-siHOTAIR over the experimental period. Retinal abundances of GalNAc-siHOTAIR, as quantified via stemloop qPCR, were much higher than the abundances in other tissues at all time points; note the axis break in the y-axis (permeability data normalized to the left-most group; siHOTAIR abundance presented as ratios to U6 snRNA; n = 6 for permeability assay, n = 3 for tube formation assay, Matrigel plug assay, FAM-labeled eyedrop study, and organ distribution study; data presented as mean ± SD; * = P < 0.05 as determined by 1-way ANOVA followed by Tukey's HSD test).

Modified siHOTAIR Eyedrops Enter the Eyes and Localize to the Retina

Having shown the efficacy of GalNAc-modified siHOTAIR in reducing glucose-mediated effects in vitro and inhibiting angiogenesis in vivo, we decided to examine its efficacy in situ. We decided to use a noninvasive approach for drug delivery to the retina. To this effect, we used FAM-tagged GalNAc-modified siHOTAIR and delivered it via eyedrop. We found that the FAM-tagged GalNAc-modified siHOTAIR, when given as an eyedrop, was able to localize to the retina (Fig. 3D). There was minimal distribution of the FAM-tagged GalNAc-modified siHOTAIR to the cornea, lens, or the ciliary body (see Fig. 3D). Retinal sections with and without eye drops were compared, the eyes that did not receive eyedrops showed little to no fluorescence in the vascular layers of the retina, and some autofluorescence mainly in the choroid. No evidence of any external abnormalities were seen in the eyes. These findings were replicated using rabbit models with much larger eyes. FAM-tagged GalNAc-modified siHOTAIR localized specifically to the retina (Supplementary Fig. S5).

As a small pharmacokinetic study, siHOTAIR abundance in the retina and some other tissues were also assessed quantitatively via qPCR using stem loop primers (Fig. 3E). The liver was included as a primary indicator for systemic distribution of siHOTAIR, because the liver has the highest expression of ASGPR and is most likely to pick up GalNAc-modified siHOTAIR that enters systemic circulation. Kidney abundance was also assessed as an organ that receives a high blood flow. Retinal abundance of siHOTAIR increased from 30 minutes to 1 hour and plateaued by 2 hours. Compared to the retina, the liver and kidneys showed minimal detection of siHOTAIR.

GalNAc-Modified siHOTAIR Prevents Early Molecular Changes in the Retinas of Diabetic Mice

After finding that GalNAc-modified siHOTAIR specifically enters the retina of diabetic mice when delivered as an eyedrop, we examined the ability of the eyedrops to prevent upregulation of angiogenic factors. We further compared the effects of eyedrop delivery against delivery via intravitreal injection. In this experiment, diabetic mice were either treated for 3 consecutive weeks, with treatments beginning 1 week following the initial onset of diabetes (a prophylactic treatment), or treated for 1 week, after 3 weeks of untreated diabetes (as a therapeutic treatment). We found that both injections and eyedrops significantly inhibited Hotair, as well as downstream vascular regulators such as Vegfa, Vegfc, and Angptl4, in the retinas of diabetic mice (Fig. 4). Eyedrops showed similar effects as intravitreal injections, indicating that GalNAc-modified siHOTAIR exerts strong biological effects after localizing to the retina following topical application. Eyedrops with conventional siHOTAIR did not produce any effect (Supplementary Fig. S6). Age-matched mice showed no sex-related differences in their responses to the eyedrops (Supplementary Fig. S7). Eyedrops further prevented the upregulation of proinflammatory cytokines Il1b, Il6, and Ccl2 (Supplementary Fig. S8). Preliminary experiments in type 2 diabetic mice showed similar trends in their responses to eye drops (Supplementary Fig. S9).

Figure 4. — **GalNAc-modified siHOTAIR prevented and rescued diabetes-induced upregulation of angiogenic molecules in the retinas of mice.** Hyperglycemia significantly increased the expressions of *Hotair* and various angiogenic factors in the retinas of male STZ-induced type 1 diabetic mice. Three-week treatments following 1 week of unmanaged diabetes, with either intravitreal injections or eyedrops containing GalNAc-modified siHOTAIR effectively prevented the upregulation of (A) *Hotair*, (B) *Vegfa*, (C) *Vegfc*, and (D) *Angptl4*. Similarly, 1-week treatments following 3 weeks of unmanaged diabetes, with eyedrops or intravitreal injections also effectively suppressed the diabetes-associated upregulation in (E) *Hotair*, (F) *Vegfa*, (G) *Vegfc*, and (H) *Angptl4*. Eyedrops and intravitreal injections showed no significance difference in any of the genes assessed (lncRNA and mRNA expressions represented as ratios to *Actb* mRNA, and normalized to the left-most group; n = 6; data presented as mean ± SD; * = P < 0.05 as determined by 1-way ANOVA followed by Tukey's HSD test).

GalNAc-Modified siHOTAIR Prevents Early Molecular Changes in the Retinas of Diabetic Rats

After finding good efficacy in mouse models, we reproduced some findings in a rat model of diabetes. Similar to the above mouse studies, the rats were either left untreated for 3 weeks followed with a shorter 1-week treatment, or given a longer 3-week treatment, 1 week following diabetes induction. Similarly to the mice, we found that both injections and eyedrops effectively inhibited Hotair, Vegfa, Vegfc, and Angptl4 (Figs. 5A–D, 5F–I). We further assessed the expressions of Ang2 another angiogenic regulator in the retinas of rats, and found similar results as the other angiogenic factors (Figs. 5E, 5J).

Figure 5. — **GalNAc-modified siHOTAIR prevented and rescued diabetes-induced overexpression of angiogenic regulators in the retinas of rats.** Hyperglycemia significantly increased the expressions of *Hotair* and various angiogenic regulators in the retina of male STZ-induced type 1 diabetic rats. Three-week treatments following 1 week of unmanaged diabetes, with either eyedrops or intravitreal injections containing GalNAc-modified siHOTAIR, effectively prevented the upregulation of (A) *Hotair*, (B) *Vegfa*, (C) *Vegfc*, (D) *Angptl4*, and (E) *Ang2.* Similarly, the shorter-term 1-week treatment following 3 weeks of unmanaged diabetes also significantly reduced the diabetes-induced retinal overexpressions of (F) *Hotair*, (G) *Vegfa*, (H) *Vegfc*, and (I) *Angptl4*, but not (J) *Ang2*. Intravitreal injections showed no significant difference compared with eyedrop treatments (lncRNA and mRNA expressions represented as ratios to *Actb* mRNA, and normalized to the left-most group; n = 6; data presented as mean ± SD; * = P < 0.05 as determined by 1-way ANOVA followed by Tukey's HSD test).

Having shown the effectiveness in both rats and mice over short durations, we conducted a longer-term study, where the total duration of diabetes would be 3 months, in order to assess more chronic effects of dosing and long-term effectiveness. Diabetic rats received treatments either 1 week following model induction, or 1 month prior to euthanization date. Eye drops effectively reduced diabetes-associated induction of Hotair, Vegfa, Vegfc, Angptl4, and Ang2 (Fig. 6) via either dosing regimen.

Figure 6. — **GalNAc-modified siHOTAIR effectively prevented and rescued the expressions of** **angiogenic** **factors over longer diabetes durations and longer-term treatments.** Hyperglycemia significantly increased the expressions of *Hotair* and various angiogenic regulators in the retina of male STZ-induced type 1 diabetic rats. One-month treatment with eyedrops containing GalNAc-modified siHOTAIR following 2 months of untreated diabetes significantly reduced the expressions of (A) *Hotair*, (B) *Vegfa*, (C) *Vegfc*, (D) *Angptl4*, (E) *Ang2,* and (F) Vegf-a protein. Similarly, over a longer treatment term (3 months of treatment following model induction), GalNAc-modified siHOTAIR maintained the suppression of (G) *Hotair*, (H) *Vegfa*, (I) *Vegfc*, (J) *Angptl4*, (K) *Ang2*, and (L) Vegf-a protein. Intravitreal injections showed no significant difference compared with eyedrop treatments (lncRNA and mRNA expressions represented as ratios to *Actb* mRNA, and normalized to the left-most group; protein expressions presented as pg/mL; n = 6; data presented as mean ± SD; * = P < 0.05 as determined by 1-way ANOVA followed by Tukey's HSD test).

GalNAc-Modified siHOTAIR Treatments Showed no Histological and Serum Biochemical Toxicity

Given the potential for systemic effects following ophthalmic treatment, we assessed potential toxicities caused by the GalNAc-modified siHOTAIR. We have previously demonstrated the lack of toxicity following short-term siRNA injection.¹² Here, we used animals that had received longer-term treatments. External observation of the treated mice and rats showed no alterations. Histological examinations from various major organs showed no observable abnormalities (Supplementary Fig. S10). Serum biochemistry analyses showed no significant changes in AST, ALT, or creatinine (Table 2).

Table 2.

Mouse Serum Biochemistry Measurements

Measurement	Reference Ranges	Non-Diabetic	Diabetic	Diabetic + GalNAc siHOTAIR Injection	Diabetic + GalNAc siHOTAIR Eyedrop
ALT, U/L	22–133	27–79	44–99	49–87	34–83
AST, U/L	46–221	44–137	48–112	56–189	44–88
Creatinine, µM/L	9–159	5–9	3–16	4–7	4–14

Open in a new tab

GalNAc-Modified siHOTAIR Eyedrops Reduced Retinal Production of Angiogenic Proteins in the Diabetes and Rescues Diabetes-Associated Vascular Permeability Changes

Having found promising results in GalNAc-modified siHOTAIR, we wanted to compare it against an existing anti-VEGF therapeutic, aflibercept (Eylea). Then, 120 µg of Eylea was delivered in the form of a single 10 µL injection, an estimated vitreous concentration of approximately 2 µg/µL, to represent a high dose, with age- and sex-matched littermates receiving daily eye drops for 1 week. VEGF-A ELISA showed significant induction of VEGF-A protein in the retinas of diabetic rats, and a significant reduction in the aflibercept-treated group (Fig. 7A). However, the group that received eyedrop treatment with GalNAc-modified siHOTAIR showed significantly lower VEGF-A protein expression even compared with the aflibercept-treated group (see Fig. 7A). Furthermore, aflibercept had no significant effect on the protein levels of other vascular mediators, such as ANGPTL4, whereas GalNAc-modified siHOTAIR significantly reduced ANGPTL4 expression (Fig. 7B).

Figure 7. — **GalNAc-modified siHOTAIR inhibits more targets than aflibercept and effectively prevents retinal vascular leakage.** Compared with single intravitreal injections of aflibercept (120 µg in 10 µL), GalNAc-modified siHOTAIR eyedrops (100 µM, 5 µL/day for 1 week) led to stronger suppression of retinal expressions of (A) VEGF-A and (B) ANGPTL4 proteins. GalNAc-modified eyedrops also prevented retinal extravasation of (C) IgG and (D) albumin, as shown by minimal (±) DAB staining in the retinas of diabetic rats treated with eyedrops compared to intense (++) staining in the retinas of untreated diabetic rats (protein expressions represented as pg per µg of total protein; n = 3 for protein expression, and for IHC; data presented as mean ± SD; * = P < 0.05 as determined by 1-way ANOVA followed by Tukey's HSD test; *black bar* = 20 µm).

Following the confirmation of robust inhibition of retinal angiogenic factors by GalNAc-modified siHOTAIR on both the RNA and the protein level, we assessed the effect on retinal vascular function in vivo, using an immunohistochemical method to determine vascular permeability to IgG and albumin protein. Diabetes caused increased the extravasation of IgG and albumin into the retinas of untreated diabetic rats, which may be due to increased vascular permeability. GalNAc-modified siHOTAIR eyedrops prevented IgG and albumin leakage into the retinas of treated diabetic rats (Figs. 7C, 7D).

Discussion

Vascular dysfunction is a central process in the pathogenesis of DR, and inhibition of vascular mediators is a key strategy to reducing ophthalmic impairment. We have previously shown that the lncRNA HOTAIR is a regulator of vascular effectors in response to high glucose and may potentially be a central target for therapeutics.¹² Here, we have created a modified siHOTAIR molecule which is non-toxic and can effectively knock down HOTAIR in cells and the retina without the use of toxic transfection reagents. We have shown that the GalNAc-modified siHOTAIR has robust effects against various vascular regulators, such as VEGF-A, VEGF-C, and ANGPTL4, as well as inflammatory mediators, such as IL-1β, IL-6, and CCL2. We have further demonstrated that inhibition of HOTAIR by GalNAc-modified siHOTAIR improved permeability and angiogenic activities in endothelial cells. Importantly, we have shown that GalNAc-modified siHOTAIR can be delivered topically, as an eyedrop, while achieving a similar efficacy as intravitreal injections. Furthermore, GalNAc-modified siHOTAIR eyedrops compared favorably to a currently used anti-VEGF biologic, in the retinas of diabetic rats.

Glucose-mediated induction HOTAIR lncRNA contributes to the overexpression of VEGF and other vascular regulators, leading to vascular dysfunction in the retina during DR.¹²^,²²^,²³ HOTAIR further influences other factors, such as proinflammatory mediators and oxidative stress pathways, compounding the pathology.¹²^,²⁴^,²⁵ Knockdown of HOTAIR can significantly improve retinal endothelial function, as we have shown previously.¹² However, one of the major considerations is the mechanism of transfection. Strict homeostatic regulation is very important in the retina. It is physically isolated from external stimuli by the sclera, and metabolically separated from systemic stimuli by the blood-retina barrier (BRB), a highly selective barrier akin to the one that protects the brain.²⁶ Transfection approaches that can cause inflammatory responses or those that otherwise lead to disruptions to the BRB can cause more harm than good.²⁷ Transfection reagents can cause cytotoxicity, even in vitro, and in a metabolically sensitive organ, such as the retina, it can lead to significant tissue pathology.¹⁵^,²⁷ Thus, it was critically important that GalNAC-modified siHOTAIR was able to effectively knock down HOTAIR expression without requiring any transfection reagents. GalNAc is a naturally occurring molecule within the body, and studies have shown that even at exaggerated doses, GalNAc-modified siRNAs showed minimal toxicities.²⁸^,²⁹ This means that GalNAc-modification is a good platform for delivering siHOTAIR into the retinal cells to prevent or reverse diabetes-induced retinal pathology.

One of the key limitations with the current therapeutic approaches to DR is the fact that most drugs singularly target VEGF-A. This leads to the development of resistance and reversal of beneficial effects over time, as the role of VEGF-A is taken over by other vascular mediators.³⁰^–³² ANGPTL4 is a potent inducer of angiogenesis, and studies have reported that knockdown of VEGF-A can lead to robust induction of ANGPTL4.³² VEGF-C is another family of the VEGF family and is classically known to be involved with lymphatic endothelial cells.¹¹^,³³ However, VEGF-C has been reported to be an alternative activator of VEGF-receptor in non-retinal conditions with patients undergoing anti-VEGF-A therapy,³⁴ and has also been reported to mediate vascular effects in DR.¹¹^,³³ ANG2 is yet another angiogenic molecule involved in retinal diseases, which often exerts cooperative effects along with VEGF-A.³⁵^,³⁶ HOTAIR lncRNA, being an epigenetic regulator, is capable of regulating a wider array of targets.¹²^–¹⁴ GalNAc-modified siHOTAIR inhibits multiple angiogenic factors in the retina because HOTAIR promotes an overall angiogenic phenotype, as has also been demonstrated in various other disease models.³⁷^–⁴⁰ Furthermore, HOTAIR acts predominantly at the transcriptional stage of gene regulation, meaning that, unlike existing approaches, GalNAc-modified siHOTAIR prevents the production of angiogenic factors, rather than simply blocking their interactions with their receptors, leaving room for competitive binding between the biologic and the cellular receptor. This illustrates the overall robustness of GalNAc-modified siHOTAIR and provides a more favorable outlook compared with single-purpose VEGF-A inhibitors in the treatment of DR.

Another important consideration in the treatment of DR is the difficulty of delivering drugs to the posterior segment of the eye. Due to the BRB inhibiting passage of drugs from the blood, and the anatomic and physiological barriers of the eye largely limiting the passage of drugs via the anterior segment, drug delivery to the retina has mostly relied on intravitreal injections.⁴¹^–⁴³ All available anti-VEGF biologics on the market are delivered via intravitreal injection.⁷ However, despite being the current gold standard, intravitreal injections are associated with negative consequences, such as retinal detachment, iritis, uveitis, endophthalmitis, cataracts, scleral thinning, and intraocular hemorrhage.⁴¹^–⁴⁴ The risk of adverse effects increases with the frequency of injections, thus novel approaches to drug delivery to the retina and the posterior segment of the eye typically involve innovations in targeting, stability, and longevity, however, most still require delivery via intravitreal or another type of injection.⁴¹^–⁴⁴ A few novel retina-targeting drugs use a topical route of delivery, however, they are typically small molecules with singular targets and effects.⁴¹^,⁴² The ability of GalNAc-modified siHOTAIR to localize to the retina following topical administration, as shown via FAM-tagged GalNAc-modified siHOTAIRs in mouse and rabbit models, and via qPCR quantification of siRNA in the retina, is a compelling finding. Topical administration is often less efficient than intravitreal injection, requiring higher or more frequent dosing, however, it provides a non-injurious avenue for getting the drug to the retina, which is more patient-friendly and could result in reduced patient non-compliance.⁴¹^,⁴² In the present study, we found that daily topical administration of GalNAc-modified siHOTAIR was equally as effective as weekly intravitreal injections, suggesting that topical GalNAc-modified siHOTAIR could be a viable treatment for HOTAIR-associated dysfunction in DR.

GalNAc-modified siHOTAIR has proven to be a potent suppressor of HOTAIR and downstream regulators in the retina. However, although there is an abundance of literature on the application of GalNAc-modified siRNAs in liver diseases, descriptions of its application in other diseases are relatively scant, leaving gaps in understanding of the use of this system in retinal disease. Whereas we have shown that the high glucose-induced upregulation of ASGR1 in retinal endothelial cells likely promotes uptake of GalNAc-modified siHOTAIR in diabetes, we are not certain that this effect is limited to retinal endothelial cells. From the previous transcriptomic study, we found ASGR1 upregulation CD31+ endothelial cells and not in NeuN+ neuronal cells, but we have little readout from CD31– NeuN– cells in the retina such as the muller glia and astrocytes. We also do not have a full understanding of the process by which GalNAc-modified siHOTAIR is making its way to the retina following topical application. We hypothesize that some amphipathic properties of the GalNAc-modified siRNA allow it to pass through the cornea, a specialized barrier with different regions that have different permeabilities.⁴⁵ The corneal epithelium and endothelium are more permeable to lipophilic molecules, whereas the stroma, which lies between the epithelium and endothelium, is more permeable to hydrophilic molecules.⁴⁵ The oligonucleotide segment of the modified siRNA is highly hydrophilic, whereas the aliphatic linker region is hydrophobic. GalNAc itself also participates in both hydrophilic and hydrophobic interactions.⁴⁶ A recent study has shown that oral delivery of GalNAc siRNA can effectively pass through multiple barriers and reach liver, producing therapeutic effects.⁴⁷ It is therefore possible that the chemistry of GalNAc moieties help facilitate passage across certain biological barriers, however, further studies will be required to fully elucidate this process. Other, longer-term studies will also be required to better assess long-term efficacy, potential for accumulation, long-term toxicity, and potential adverse effects in retinal applications.

Despite the limitations in our current grasp of certain elements of GalNAc-modified HOTAIR, the findings from the present study are notable. The noninvasive delivery option gives GalNAc-modified siHOTAIR a great advantage over current invasive approaches for DR, because it does not trigger ocular injuries and risk complications every time it needs to be administered. Furthermore, it would not require administration by medical professionals, meaning that GalNAc-modified siHOTAIR would be more accessible to a wider range of patients. Separately, the targeting of a regulatory non-coding RNA rather than individual genes makes GalNAc-modified siHOTAIR more robust than anti-VEGF current approaches. Even many emerging approaches remain focused on inhibition of VEGF,⁴⁸^–⁵⁰ which would likely result in similar limitations as current anti-VEGF biologics. In summary, we have identified a novel, topical, non-toxic, and effective way of delivering siHOTAIR into the retina to prevent diabetes-induced dysfunction. GalNAc-modified siHOTAIR eye drops effectively reduced angiogenesis, permeability, microRNAs, and inflammatory markers, as summarized in Figure 8. Although further studies will be required, the present findings suggest that GalNAc-modified siHOTAIR may offer certain advantages over current treatment approaches, and may potentially be developed into a better alternative to treat DR.

Figure 8. — **Graphical summary of the effects of GalNAc-modified siHOTAIR eye drops.** High glucose in diabetes induced HOTAIR expression in the retina. Following topical administration, GalNAc-modified siHOTAIR localized to the retina and inhibited retinal HOTAIR expression. In so doing, GalNAc-modified siHOTAIR reduced the expressions of several vascular regulators, thereby reducing angiogenesis and vascular permeability. Additionally, GalNAc-modified siHOTAIR reduced the expression of inflammatory markers and expressions of retinopathy-associated microRNAs. Thus, GalNAc-modified siHOTAIR may be a noninvasive and potentially more robust way to address retinal dysregulation and dysfunction in diabetes.

Supplementary Material

Supplement 1

iovs-67-1-24_s001.docx^{(4.7MB, docx)}

Acknowledgments

Supported by BreakthroughT1D (formerly JDRF) and the Western Innovation Fund.

Author Contributions: EW: Investigation, Formal Analysis, Data Curation, Project administration, Writing – Original Draft; BF: Investigation, Methodology, Project administration, Writing – review and editing; ShC: Investigation, Methodology, Project administration, Writing – review and editing; HW: Investigation, Methodology, Writing – review and editing; TL: Writing – review and editing; SuC: Conceptualization, Funding acquisition, Resources, Project Administration, Methodology, Writing – review and editing.

Disclosure: E. Wang, (P); B. Feng, (P); S. Chen, (P); H. Wang, (P); T. Ling, i-RNA Corporation, (O, S); S. Chakrabarti, i-RNA Corporation (O, P)

References

1. Fong DS, Aiello L, Gardner TW, et al.. Retinopathy in diabetes. Diabetes Care. 2004; 27(1): s84–s87. [DOI] [PubMed] [Google Scholar]
2. Deshpande AD, Harris-Hayes M, Schootman M.. Epidemiology of diabetes and diabetes-related complications. Phys Ther. 2008; 88(11): 1254–1264. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Nentwich MM, Ulbig MW.. Diabetic retinopathy - ocular complications of diabetes mellitus. World J Diabetes. 2015; 6(3): 489–499. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Wang W, Lo A.. Diabetic retinopathy: pathophysiology and treatments. Int J Mol Sci. 2018; 19(6): 1816. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Stewart MW. The expanding role of vascular endothelial growth factor inhibitors in ophthalmology. Mayo Clin Proc. 2012; 87(1): 77–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Uludag G, Hassan M, Matsumiya W, et al.. Efficacy and safety of intravitreal anti-VEGF therapy in diabetic retinopathy: what we have learned and what should we learn further? Expert Opin Biol Ther. 2022; 22(10): 1275–1291. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Bahr TA, Bakri SJ.. Update on the management of diabetic retinopathy: anti-VEGF agents for the prevention of complications and progression of nonproliferative and proliferative retinopathy. Life (Basel). 2023; 13(5): 1098. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Fu DJ, Mishra AV, Quek C, et al.. Visual and anatomical failure of anti-VEGF therapy for retinal vascular diseases: a survival analysis of real-world data. Eye. 2025; 39(5): 977–985. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Abcouwer SF. Angiogenic factors and cytokines in diabetic retinopathy. J Clin Cell Immunol. 2013; 1(11): 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Babapoor-Farrokhran S, Jee K, Puchner B, et al.. Angiopoietin-like 4 is a potent angiogenic factor and a novel therapeutic target for patients with proliferative diabetic retinopathy. Proc Natl Acad Sci USA. 2015; 112(23): E3030–E3039. [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Li Y, Chen D, Sun L, et al.. Induced expression of VEGFC, ANGPT, and EFNB2 and their receptors characterizes neovascularization in proliferative diabetic retinopathy. Invest Ophthalmol Vis Sci. 2019; 60(13): 4084–4096. [DOI] [PubMed] [Google Scholar]
12. Biswas S, Feng B, Chen S, et al.. The long non-coding RNA HOTAIR is a critical epigenetic mediator of angiogenesis in diabetic retinopathy. Invest Ophthalmol Vis Sci. 2021; 62(3): 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Kornienko AE, Guenzl PM, Barlow DP, Pauler FM.. Gene regulation by the act of long non-coding RNA transcription. BMC Biology. 2013; 11(1): 59. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Statello L, Guo CJ, Chen LL, Huarte M.. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021; 22(2): 96–118. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Yan Y, Liu XY, Lu A, Wang XY, Jiang LX, Wang JC.. Non-viral vectors for RNA delivery. J Control Release. 2022; 342: 241–279. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Qin ZX, Zuo L, Zeng Z, et al.. GalNac-siRNA conjugate delivery technology promotes the treatment of typical chronic liver diseases. Expert Opin Drug Deliv. 2025; 22(4): 455–469. [DOI] [PubMed] [Google Scholar]
17. Wang E, Feng B, Chen S, Su Z, Chakrabarti S.. Differential microvascular endothelial cell responses in the retina in diabetes compared to the heart and kidneys, a spatial transcriptomic analysis. PLoS One. 2024; 19(12): e0310949. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Yu M, Qin J, Liu X, et al.. Evaluating the oral delivery of GalNAc-conjugated siRNAs in rodents and non-human primates. Nucleic Acids Res. 2024; 52(10): 5423–5437. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Chen L, Bosmajian C, Woo S.. A highly sensitive stem-loop RT-qPCR method to study siRNA intracellular pharmacokinetics and pharmacodynamics. Biol Methods Protoc. 2024; 9(1): bpae029. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. McArthur K, Feng B, Wu Y, Chen S, Chakrabarti S.. MicroRNA-200b regulates vascular endothelial growth factor–mediated alterations in diabetic retinopathy. Diabetes. 2011; 60(4): 1314–1323. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Chen S, Feng B, Thomas AA, Chakrabarti S.. miR-146a regulates glucose induced upregulation of inflammatory cytokines extracellular matrix proteins in the retina and kidney in diabetes. PLoS One. 2017; 12(3): e0173918. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Zhao D, Zhao Y, Wang J, et al.. Long noncoding RNA Hotair facilitates retinal endothelial cell dysfunction in diabetic retinopathy. Clin Sci. 2020; 134(17): 2419–2434. [DOI] [PubMed] [Google Scholar]
23. Raju GSR, Pavitra E, Bandaru SS, et al.. HOTAIR: a potential metastatic, drug-resistant and prognostic regulator of breast cancer. Mol Cancer. 2023; 22(1): 65. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Price RL, Bhan A, Mandal SS.. HOTAIR beyond repression: in protein degradation, inflammation, DNA damage response, and cell signaling. DNA Repair (Amst). 2021; 105: 103141. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. You H, Li H, Gou W.. lncRNA HOTAIR promotes ROS generation and NLRP3 inflammasome activation by inhibiting Nrf2 in diabetic retinopathy. Medicine. 2023; 102(37): e35155. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Katamay R, Nussenblatt RB.. Blood–retinal barrier, immune privilege, and autoimmunity. Retina. 2013;27: 579–589.23222494 [Google Scholar]
27. Prow TW, Bhutto I, Kim SY, et al.. Ocular nanoparticle toxicity and transfection of the retina and retinal pigment epithelium. Nanomedicine. 2008; 4(4): 340–349. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Janas MM, Harbison CE, Perry VK, et al.. The nonclinical safety profile of GalNAc-conjugated RNAi therapeutics in subacute studies. Toxicol Pathol. 2018; 46(7): 735–745. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. An G. Pharmacokinetics and pharmacodynamics of GalNAc-conjugated siRNAs. J Clin Pharmacol. 2024; 64(1): 45–57. [DOI] [PubMed] [Google Scholar]
30. Zheng L, Zhao C, Du Y, et al.. PDGF-CC underlies resistance to VEGF-A inhibition and combinatorial targeting of both suppresses pathological angiogenesis more efficiently. Oncotarget. 2016; 7(47): 77902–77915. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Sharma D, Zachary I, Jia H.. Mechanisms of acquired resistance to anti-VEGF therapy for neovascular eye diseases. Invest Ophthalmol Vis Sci. 2023; 64(5): 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Sharma D, Lau E, Qin Y, et al.. VEGF inhibition increases expression of HIF-regulated angiogenic genes by the RPE limiting the response of wet AMD eyes to aflibercept. Proc Natl Acad Sci USA. 2024; 121(46): e2322759121. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Nagai N, Minami T.. Emerging role of VEGFC in pathological angiogenesis. eBioMedicine. 2015; 2(11): 1588–1589. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Michaelsen SR, Staberg M, Pedersen H, et al.. VEGF-C sustains VEGFR2 activation under bevacizumab therapy and promotes glioblastoma maintenance. Neuro Oncol. 2018; 20(11): 1462–1474. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Chaudhary V, Mar F, Amador MJ, et al.. Emerging clinical evidence of a dual role for Ang-2 and VEGF-A blockade with faricimab in retinal diseases. Graefes Arch Clin Exp Ophthalmol. 2025; 263(5): 1239–1247. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Deissler HL, Rehak M, Lytvynchuk L.. VEGF-A165a and angiopoietin-2 differently affect the barrier formed by retinal endothelial cells. Exp Eye Res. 2024; 247: 110062. [DOI] [PubMed] [Google Scholar]
37. Fu W-M, Lu Y-F, Hu B-G, et al.. Long noncoding RNA Hotair mediated angiogenesis in nasopharyngeal carcinoma by direct and indirect signaling pathways. Oncotarget. 2015; 7(4): 4712–4723. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Guo YP, Wang ZF, Li N, et al.. Suppression of lncRNA HOTAIR alleviates RCC angiogenesis through regulating miR-126/EGFL7 axis. Am J Physiol Cell Physiol. 2021; 320(5): C880–C891. [DOI] [PubMed] [Google Scholar]
39. Wang Y, Mao J, Li X, Wang B, Zhou X.. lncRNA HOTAIR mediates OGD/R‑induced cell injury and angiogenesis in a EZH2‑dependent manner. Exp Ther Med. 2022; 23(1): 1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Liu F, Wang Y, Huang D, Sun Y.. LncRNA HOTAIR regulates the PI3K/AKT pathway via the miR-126-3p/PIK3R2 axis to participate in synovial angiogenesis in rheumatoid arthritis. Immun Inflamm Dis. 2023; 11(10): e1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Kim HM, Woo SJ.. Ocular drug delivery to the retina: current innovations and future perspectives. Pharmaceutics. 2021; 13(1): 108. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Bonilla L, Espina M, Severino P, et al.. Lipid Nanoparticles for the Posterior Eye Segment. Pharmaceutics. 2021; 14(1): 90. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Ramsay E, Lajunen T, Bhattacharya M, et al.. Selective drug delivery to the retinal cells: biological barriers and avenues. J Control Release. 2023; 361: 1–19. [DOI] [PubMed] [Google Scholar]
44. Zinkernagel MS, Schorno P, Ebneter A, Wolf S.. Scleral thinning after repeated intravitreal injections of antivascular endothelial growth factor agents in the same quadrant. Invest Ophthalmol Vis Sci. 2015; 56(3): 1894–1900. [DOI] [PubMed] [Google Scholar]
45. Santana CP, Matter BA, Patil MA, Silva-Cunha A, Kompella UB.. Corneal permeability and uptake of twenty-five drugs: species comparison and quantitative structure–permeability relationships. Pharmaceutics. 2023; 15(6): 1646. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Sanz-Martinez I, Pereira S, Merino P, Corzana F, Hurtado-Guerrero R.. Molecular recognition of GalNAc in mucin-type O-glycosylation. Acc Chem Res. 2023; 56(5): 548–560. [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Yu M, Qin J, Liu X, et al.. Evaluating the oral delivery of GalNAc-conjugated siRNAs in rodents and non-human primates. Nucleic Acids Res. 2024; 52(10): 5423–5437. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Tomita Y, Lee D, Tsubota K, Negishi K, Kurihara T.. Updates on the current treatments for diabetic retinopathy and possibility of future oral therapy. J Clin Med. 2021; 10(20): 4666. [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Wang Z, Zhang N, Lin P, Xing Y, Yang N.. Recent advances in the treatment and delivery system of diabetic retinopathy. Front Endocrinol (Lausanne). 2024; 15: 1347864. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Gonzalez-Cortes JH, Martinez-Pacheco VA, Gonzalez-Cantu JE, et al.. Current treatments and innovations in diabetic retinopathy and diabetic macular edema. Pharmaceutics. 2023; 15(1): 122. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement 1

iovs-67-1-24_s001.docx^{(4.7MB, docx)}

[bib1] 1. Fong DS, Aiello L, Gardner TW, et al.. Retinopathy in diabetes. Diabetes Care. 2004; 27(1): s84–s87. [DOI] [PubMed] [Google Scholar]

[bib2] 2. Deshpande AD, Harris-Hayes M, Schootman M.. Epidemiology of diabetes and diabetes-related complications. Phys Ther. 2008; 88(11): 1254–1264. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib3] 3. Nentwich MM, Ulbig MW.. Diabetic retinopathy - ocular complications of diabetes mellitus. World J Diabetes. 2015; 6(3): 489–499. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib4] 4. Wang W, Lo A.. Diabetic retinopathy: pathophysiology and treatments. Int J Mol Sci. 2018; 19(6): 1816. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] 5. Stewart MW. The expanding role of vascular endothelial growth factor inhibitors in ophthalmology. Mayo Clin Proc. 2012; 87(1): 77–88. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] 6. Uludag G, Hassan M, Matsumiya W, et al.. Efficacy and safety of intravitreal anti-VEGF therapy in diabetic retinopathy: what we have learned and what should we learn further? Expert Opin Biol Ther. 2022; 22(10): 1275–1291. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7. Bahr TA, Bakri SJ.. Update on the management of diabetic retinopathy: anti-VEGF agents for the prevention of complications and progression of nonproliferative and proliferative retinopathy. Life (Basel). 2023; 13(5): 1098. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] 8. Fu DJ, Mishra AV, Quek C, et al.. Visual and anatomical failure of anti-VEGF therapy for retinal vascular diseases: a survival analysis of real-world data. Eye. 2025; 39(5): 977–985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] 9. Abcouwer SF. Angiogenic factors and cytokines in diabetic retinopathy. J Clin Cell Immunol. 2013; 1(11): 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] 10. Babapoor-Farrokhran S, Jee K, Puchner B, et al.. Angiopoietin-like 4 is a potent angiogenic factor and a novel therapeutic target for patients with proliferative diabetic retinopathy. Proc Natl Acad Sci USA. 2015; 112(23): E3030–E3039. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] 11. Li Y, Chen D, Sun L, et al.. Induced expression of VEGFC, ANGPT, and EFNB2 and their receptors characterizes neovascularization in proliferative diabetic retinopathy. Invest Ophthalmol Vis Sci. 2019; 60(13): 4084–4096. [DOI] [PubMed] [Google Scholar]

[bib12] 12. Biswas S, Feng B, Chen S, et al.. The long non-coding RNA HOTAIR is a critical epigenetic mediator of angiogenesis in diabetic retinopathy. Invest Ophthalmol Vis Sci. 2021; 62(3): 20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] 13. Kornienko AE, Guenzl PM, Barlow DP, Pauler FM.. Gene regulation by the act of long non-coding RNA transcription. BMC Biology. 2013; 11(1): 59. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] 14. Statello L, Guo CJ, Chen LL, Huarte M.. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021; 22(2): 96–118. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib15] 15. Yan Y, Liu XY, Lu A, Wang XY, Jiang LX, Wang JC.. Non-viral vectors for RNA delivery. J Control Release. 2022; 342: 241–279. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] 16. Qin ZX, Zuo L, Zeng Z, et al.. GalNac-siRNA conjugate delivery technology promotes the treatment of typical chronic liver diseases. Expert Opin Drug Deliv. 2025; 22(4): 455–469. [DOI] [PubMed] [Google Scholar]

[bib17] 17. Wang E, Feng B, Chen S, Su Z, Chakrabarti S.. Differential microvascular endothelial cell responses in the retina in diabetes compared to the heart and kidneys, a spatial transcriptomic analysis. PLoS One. 2024; 19(12): e0310949. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] 18. Yu M, Qin J, Liu X, et al.. Evaluating the oral delivery of GalNAc-conjugated siRNAs in rodents and non-human primates. Nucleic Acids Res. 2024; 52(10): 5423–5437. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib19] 19. Chen L, Bosmajian C, Woo S.. A highly sensitive stem-loop RT-qPCR method to study siRNA intracellular pharmacokinetics and pharmacodynamics. Biol Methods Protoc. 2024; 9(1): bpae029. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib20] 20. McArthur K, Feng B, Wu Y, Chen S, Chakrabarti S.. MicroRNA-200b regulates vascular endothelial growth factor–mediated alterations in diabetic retinopathy. Diabetes. 2011; 60(4): 1314–1323. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] 21. Chen S, Feng B, Thomas AA, Chakrabarti S.. miR-146a regulates glucose induced upregulation of inflammatory cytokines extracellular matrix proteins in the retina and kidney in diabetes. PLoS One. 2017; 12(3): e0173918. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib22] 22. Zhao D, Zhao Y, Wang J, et al.. Long noncoding RNA Hotair facilitates retinal endothelial cell dysfunction in diabetic retinopathy. Clin Sci. 2020; 134(17): 2419–2434. [DOI] [PubMed] [Google Scholar]

[bib23] 23. Raju GSR, Pavitra E, Bandaru SS, et al.. HOTAIR: a potential metastatic, drug-resistant and prognostic regulator of breast cancer. Mol Cancer. 2023; 22(1): 65. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] 24. Price RL, Bhan A, Mandal SS.. HOTAIR beyond repression: in protein degradation, inflammation, DNA damage response, and cell signaling. DNA Repair (Amst). 2021; 105: 103141. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] 25. You H, Li H, Gou W.. lncRNA HOTAIR promotes ROS generation and NLRP3 inflammasome activation by inhibiting Nrf2 in diabetic retinopathy. Medicine. 2023; 102(37): e35155. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib26] 26. Katamay R, Nussenblatt RB.. Blood–retinal barrier, immune privilege, and autoimmunity. Retina. 2013;27: 579–589.23222494 [Google Scholar]

[bib27] 27. Prow TW, Bhutto I, Kim SY, et al.. Ocular nanoparticle toxicity and transfection of the retina and retinal pigment epithelium. Nanomedicine. 2008; 4(4): 340–349. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib28] 28. Janas MM, Harbison CE, Perry VK, et al.. The nonclinical safety profile of GalNAc-conjugated RNAi therapeutics in subacute studies. Toxicol Pathol. 2018; 46(7): 735–745. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib29] 29. An G. Pharmacokinetics and pharmacodynamics of GalNAc-conjugated siRNAs. J Clin Pharmacol. 2024; 64(1): 45–57. [DOI] [PubMed] [Google Scholar]

[bib30] 30. Zheng L, Zhao C, Du Y, et al.. PDGF-CC underlies resistance to VEGF-A inhibition and combinatorial targeting of both suppresses pathological angiogenesis more efficiently. Oncotarget. 2016; 7(47): 77902–77915. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] 31. Sharma D, Zachary I, Jia H.. Mechanisms of acquired resistance to anti-VEGF therapy for neovascular eye diseases. Invest Ophthalmol Vis Sci. 2023; 64(5): 28. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] 32. Sharma D, Lau E, Qin Y, et al.. VEGF inhibition increases expression of HIF-regulated angiogenic genes by the RPE limiting the response of wet AMD eyes to aflibercept. Proc Natl Acad Sci USA. 2024; 121(46): e2322759121. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33. Nagai N, Minami T.. Emerging role of VEGFC in pathological angiogenesis. eBioMedicine. 2015; 2(11): 1588–1589. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] 34. Michaelsen SR, Staberg M, Pedersen H, et al.. VEGF-C sustains VEGFR2 activation under bevacizumab therapy and promotes glioblastoma maintenance. Neuro Oncol. 2018; 20(11): 1462–1474. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] 35. Chaudhary V, Mar F, Amador MJ, et al.. Emerging clinical evidence of a dual role for Ang-2 and VEGF-A blockade with faricimab in retinal diseases. Graefes Arch Clin Exp Ophthalmol. 2025; 263(5): 1239–1247. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] 36. Deissler HL, Rehak M, Lytvynchuk L.. VEGF-A165a and angiopoietin-2 differently affect the barrier formed by retinal endothelial cells. Exp Eye Res. 2024; 247: 110062. [DOI] [PubMed] [Google Scholar]

[bib37] 37. Fu W-M, Lu Y-F, Hu B-G, et al.. Long noncoding RNA Hotair mediated angiogenesis in nasopharyngeal carcinoma by direct and indirect signaling pathways. Oncotarget. 2015; 7(4): 4712–4723. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib38] 38. Guo YP, Wang ZF, Li N, et al.. Suppression of lncRNA HOTAIR alleviates RCC angiogenesis through regulating miR-126/EGFL7 axis. Am J Physiol Cell Physiol. 2021; 320(5): C880–C891. [DOI] [PubMed] [Google Scholar]

[bib39] 39. Wang Y, Mao J, Li X, Wang B, Zhou X.. lncRNA HOTAIR mediates OGD/R‑induced cell injury and angiogenesis in a EZH2‑dependent manner. Exp Ther Med. 2022; 23(1): 1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib40] 40. Liu F, Wang Y, Huang D, Sun Y.. LncRNA HOTAIR regulates the PI3K/AKT pathway via the miR-126-3p/PIK3R2 axis to participate in synovial angiogenesis in rheumatoid arthritis. Immun Inflamm Dis. 2023; 11(10): e1064. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41. Kim HM, Woo SJ.. Ocular drug delivery to the retina: current innovations and future perspectives. Pharmaceutics. 2021; 13(1): 108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib42] 42. Bonilla L, Espina M, Severino P, et al.. Lipid Nanoparticles for the Posterior Eye Segment. Pharmaceutics. 2021; 14(1): 90. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib43] 43. Ramsay E, Lajunen T, Bhattacharya M, et al.. Selective drug delivery to the retinal cells: biological barriers and avenues. J Control Release. 2023; 361: 1–19. [DOI] [PubMed] [Google Scholar]

[bib44] 44. Zinkernagel MS, Schorno P, Ebneter A, Wolf S.. Scleral thinning after repeated intravitreal injections of antivascular endothelial growth factor agents in the same quadrant. Invest Ophthalmol Vis Sci. 2015; 56(3): 1894–1900. [DOI] [PubMed] [Google Scholar]

[bib45] 45. Santana CP, Matter BA, Patil MA, Silva-Cunha A, Kompella UB.. Corneal permeability and uptake of twenty-five drugs: species comparison and quantitative structure–permeability relationships. Pharmaceutics. 2023; 15(6): 1646. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib46] 46. Sanz-Martinez I, Pereira S, Merino P, Corzana F, Hurtado-Guerrero R.. Molecular recognition of GalNAc in mucin-type O-glycosylation. Acc Chem Res. 2023; 56(5): 548–560. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib47] 47. Yu M, Qin J, Liu X, et al.. Evaluating the oral delivery of GalNAc-conjugated siRNAs in rodents and non-human primates. Nucleic Acids Res. 2024; 52(10): 5423–5437. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib48] 48. Tomita Y, Lee D, Tsubota K, Negishi K, Kurihara T.. Updates on the current treatments for diabetic retinopathy and possibility of future oral therapy. J Clin Med. 2021; 10(20): 4666. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib49] 49. Wang Z, Zhang N, Lin P, Xing Y, Yang N.. Recent advances in the treatment and delivery system of diabetic retinopathy. Front Endocrinol (Lausanne). 2024; 15: 1347864. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib50] 50. Gonzalez-Cortes JH, Martinez-Pacheco VA, Gonzalez-Cantu JE, et al.. Current treatments and innovations in diabetic retinopathy and diabetic macular edema. Pharmaceutics. 2023; 15(1): 122. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Silencing of lncRNA HOTAIR Using Eyedrops as a Potential Treatment for Diabetes-Associated Retinal Dysregulation and Dysfunction

Eric Wang

Biao Feng

Shali Chen

Honglin Wang

Ting Ling

Subrata Chakrabarti

Abstract

Purpose

Methods

Results

Conclusions

Methods

Cell Culture

Transfection

Figure 1.

ASGR1 Inhibition

In Vitro Permeability Assay

In Vitro Tube Formation Assay

Animal Models

In Vivo Matrigel Plug Assay

Intravitreal Injection

Eyedrops

GalNAc-Modified siRNA Localization

RNA Analysis

Table 1.

Protein Analysis

Immunohistochemical and Histologic Analyses

Serum Toxicology Analyses

Statistical Analysis

Results

High Glucose Increases ASGR1 Expression in HRECs, Facilitating Uptake of GalNAc-Modified siHOTAIR With Biological Effects

Figure 2.

GalNAc-Modified siHOTAIR Prevents Glucose-Induced Functional Alterations in Endothelial Cells

Figure 3.

Modified siHOTAIR Eyedrops Enter the Eyes and Localize to the Retina

GalNAc-Modified siHOTAIR Prevents Early Molecular Changes in the Retinas of Diabetic Mice

Figure 4.

GalNAc-Modified siHOTAIR Prevents Early Molecular Changes in the Retinas of Diabetic Rats

Figure 5.

Figure 6.

GalNAc-Modified siHOTAIR Treatments Showed no Histological and Serum Biochemical Toxicity

Table 2.

GalNAc-Modified siHOTAIR Eyedrops Reduced Retinal Production of Angiogenic Proteins in the Diabetes and Rescues Diabetes-Associated Vascular Permeability Changes

Figure 7.

Discussion

Figure 8.

Supplementary Material

Acknowledgments

References

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases