Treating acute respiratory distress syndrome with a multifaceted nanomedicine: Inhibition of PANoptosis and enhancement of lung barrier integrity

Abstract

Acute lung injury (ALI)/Acute Respiratory Distress Syndrome (ARDS) is a life-threatening condition marked by severe inflammatory responses and disruption of the alveolar-capillary barrier, leading to high mortality rates and lack of effective treatments. Recent research has underscored the crucial role of programmed cell death pathways-pyroptosis, apoptosis, and necroptosis-in exacerbating inflammation and barrier dysfunction in ALI/ARDS. However, effective therapeutic agents targeting this process remain scarce. In this study, we reveal that PANoptosis, which integrates these cell death pathways through the PANoptosome complex, plays a central role in the pathogenesis and progression of ALI/ARDS. The levels of PANoptosis-related molecules were significantly elevated in both the ALI mice and the clinical ARDS patient samples, highlighting it as a novel therapeutic target. Building on this insight, we developed a multifunctional nanomedicine, TPNs/Sal B, which integrates tea polyphenol-based nanoparticles (TPNs), a bioactive nanomaterial with anti-pyroptotic and anti-necroptotic properties, with salvianolic acid B (Sal B), known for its anti-apoptotic effects. Our results demonstrate that the nanomedcine TPNs/Sal B effectively inhibit PANoptosis, thereby attenuating lung tissue pathological damage, reducing inflammation, and improving lung epithelial barrier function in ALI models. Moreover, we identified LIM and SH3 protein 1 (LASP1) which may play an critical role in modulating alveolar epithelial barrier function during ALI/ARDS progression, and treatment with TPNs/Sal B effectively restored LASP1 levels. Our findings underscore the therapeutic potential of TPNs/Sal B as a targeted treatment for ALI/ARDS, offering a promising strategy for modulating PANoptosis and preserving lung function.

Graphical abstract

1. Introduction

Acute lung injury (ALI)/Acute Respiratory Distress Syndrome (ARDS) represents a prevalent and critical condition encountered in clinical practice. Prior to the COVID-19 pandemic, ARDS accounted for approximately 10.4 % of intensive care unit admissions, with an in-hospital mortality rate approaching 40 % [1]. The advent of COVID-19 has further exacerbated the incidence and mortality associated with ARDS, thereby imposing an immense burden on healthcare systems globally [2]. Current therapeutic approaches for ARDS predominantly focus on supportive interventions, such as mechanical ventilation, fluid management, and anti-infective or anti-inflammatory drug therapy [3]. Although these strategies have contributed to improving patient survival, no specific and effective pharmacological treatment has been identified, underscoring an urgent need for the development of more targeted therapeutic strategies.

The pathophysiology of ALI/ARDS is primarily characterized by an uncontrolled inflammatory response and the subsequent disruption of the alveolar-capillary barrier [4,5]. During the progression of ALI/ARDS, various pathogenic stimuli activate resident lung macrophages, leading to the release of pro-inflammatory cytokines and the initiation of a pulmonary inflammatory cascade. These inflammatory mediators induce structural and functional damage to both alveolar epithelial cells and vascular endothelial cells, resulting in the compromise of the pulmonary air-blood barrier. The breakdown of this barrier facilitates further infiltration of immune cells into the lungs, thereby perpetuating a vicious cycle of inflammatory cascades and barrier disruption, ultimately exacerbating disease severity [4,5]. The lung air-blood barrier, comprising the alveolar epithelial barrier and the vascular endothelial barrier, is essential for effective gas exchange [5,6]. The integrity of the alveolar epithelial barrier, in particular, plays a critical role in determining the severity of ARDS [7], with its disruption involving both cellular death and the dissociation of intercellular junctions [6,7].

Emerging evidence suggests that cell death serves as a key driver of the inflammatory response and barrier disruption in ALI/ARDS [8,9]. While cell death typically functions as a homeostatic mechanism for eliminating unnecessary cells and combating pathogens, rapid and uncontrolled cell death can result in the accumulation of immune cells and the excessive release of pro-inflammatory cytokines [8,9]. This process can further compromise the integrity of tight junctions (TJs) between alveolar epithelial cells [10], leading to impaired alveolar epithelial barrier function and the exacerbation of ALI/ARDS. Consequently, targeting cell death pathways represents a promising therapeutic approach for mitigating ALI/ARDS progression.

Among the various forms of programmed cell death, pyroptosis, apoptosis, and necroptosis have been extensively studied in the context of ALI/ARDS [8,9,11]. Pyroptosis, a highly immunogenic form of cell death characterized by inflammasome activation, has been implicated in ALI/ARDS [9], with clinical data revealing upregulation of pyroptosis-associated proteins such as gasdermin D (GSDMD) and caspase-1/4/5 in neutrophils of ARDS patients [12]. Apoptosis also plays a crucial role, particularly with increased apoptosis of alveolar epithelial cells and delayed neutrophil apoptosis contributing to ALI/ARDS progression [13]. In contrast to apoptosis, necroptosis—a lytic and highly immunogenic form of cell death—can trigger inflammatory cascades through the release of cytoplasmic contents [14]. For instance, Tamada et al. demonstrated that necroptosis predominates in LPS-induced alveolar epithelial cell death in ALI mouse models [15]. Similarly, studies on COVID-19-associated ARDS have highlighted the correlation between angiopoietin-2-mediated vascular injury and necroptosis markers, such as plasma receptor-interacting protein kinase 3 (RIPK3) and lung tissue phosphorylated mixed lineage kinase domain-like protein (p-MLKL), in ARDS patients [16]. These findings underscore the significance of pyroptosis, apoptosis, and necroptosis in ALI/ARDS progression and suggest that targeting these death pathways may ameliorate pathological damage. However, blocking a single cell death pathway may be insufficient due to compensatory activation of alternative pathways, thus limiting therapeutic efficacy. Notably, Wang et al. reported that the combination of apoptosis inhibitor z-VAD-fmk and necroptosis inhibitor Nec-1 provided superior therapeutic benefits in a rat model of ischemia-reperfusion-induced lung injury compared to the use of either inhibitor alone [17]. This evidence suggests that simultaneous inhibition of multiple cell death pathways may offer a more effective therapeutic strategy for ALI/ARDS.

In recent years, substantial crosstalk between pyroptosis, apoptosis, and necroptosis has been increasingly recognized. In 2019, the Kanneganti group introduced the concept of PANoptosis, a form of inflammatory cell death mediated by the PANoptosome complex, which integrates key features of pyroptosis, apoptosis, and necroptosis [18]. This concept underscores the interplay and coordination among these death pathways. Our previous research has demonstrated that Z-DNA binding protein 1 (ZBP1)-mediated PANoptosome activation in alveolar epithelial cells contributes to lipopolysaccharide (LPS)-induced ALI pathology [19]. In the present study, we identified the occurrence of pyroptosis, apoptosis, and necroptosis in a mouse model of ALI and confirmed that these cell death modalities are mediated by PANoptosis (Fig. 1A). Further analysis of clinical samples revealed that PANoptosis levels are elevated in ARDS patients and correlate with disease severity, highlighting the therapeutic potential of targeting PANoptosis in ALI/ARDS.

Fig. 1.

(A) Schematic illustration depicting the involvement of PANoptosis in ALI/ARDS pathogenesis in mouse models and clinical samples. (B) Schematic representation of TPNs/Sal B synthesis. (C) Mechanistic diagram of TPNs/Sal B-mediated inhibition of various cell death pathways. (D) Schematic illustrating the role of TPNs/Sal B in maintaining lung epithelial barrier function through the regulation of LASP1. Created in BioRender. Cui, Y. (2026) https://BioRender.com/t11k604.

Nanomedicines exhibit inherent advantages of small particle size, enhanced targeting capability, excellent biocompatibility, and good bioavailability, and have been extensively studied in the treatment of diseases such as ARDS and cancer [3,5,20,21]. Moreover, nanocarriers enable the co-delivery of multiple therapeutic agents, thereby achieving multifaceted synergistic therapeutic effects [3,5,22]. In this study, we have developed a multifunctional nanomedicine, TPNs/Sal B (Fig. 1B). Tea polyphenol-based nanoparticles (TPNs), a tea polyphenol-based self-assembled nanograin developed by our team, exhibit potent anti-apoptotic and anti-necroptotic activities [23]. Salvianolic acid B (Sal B), the primary active component extracted from Salvia miltiorrhiza, possesses well-documented anti-apoptotic properties [24]. Sal B can be effectively loaded onto the surface of TPNs through interfacial adsorption. Our in vitro and in vivo experiments confirmed that TPNs/Sal B exert anti-PANoptosis activity by synergistically inhibiting multiple cell death pathways, thereby alleviating lung tissue damage, reducing inflammation, and improving lung epithelial barrier function (Fig. 1C). Furthermore, our clinical and animal studies have revealed a strong correlation between ALI/ARDS-induced lung epithelial barrier dysfunction and decreased levels of LIM and SH3 domain protein 1 (LASP1). Our findings suggest that LASP1 may play an intrinsic role in modulating alveolar epithelial barrier function during ALI/ARDS progression. Notably, TPNs/Sal B treatment effectively restores LASP1 expression in lung tissue, thereby preserving lung epithelial barrier integrity (Fig. 1D). This study elucidated the role of PANoptosis as a critical therapeutic target in ALI/ARDS, and developed TPNs/Sal B as a potential nanomedicine that can target and inhibit PANoptosis, offering a promising therapeutic avenue for the treatment of ALI/ARDS.

2. Materials and methods

2.1. Reagents

(−)-Epigallocatechin-3-gallate (EGCG, 98 %; Chengdu Wagott Bio-Tech Co., Ltd), Manganese chloride tetrahydrate (MnCl₂⋅4H₂O; Sigma-Aldrich), Chitosan (RYON), Rhodamine B (Sinopharm), 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT; Solarbio). Dexamethasone (Aladdin), Shikonin (Aladdin), LPS (L2630, sigma), SARS-CoV-2 Envelope Protein (E protein; DRA33, novoprotein), Salvianolic acid B (M4140, Abmole), Protein Extraction Reagent (P0013, Beyotime), Protease and Phosphatase Inhibitor (78442, Thermo), Enhanced BCA Protein Assay Kit (P0010S, Beyotime), SDS-PAGE Gel Kit (CW0022S, CWBIO), GSDMD antibody (A18121, Abclonal), caspase-3 antibody (19677-1-AP, Proteintech), caspase-8 antibody (13423-1-AP, Proteintech), MLKL antibody (66675-1-Ig, Proteintech), Tubulin antibody (66031-1-Ig, Proteintech), LASP1 antibody (10515-1-AP, Proteintech), ZBP1 antibody (sc-271483, Santa Cruz), Mouse TNF-α enzyme-linked immunoassay (ELISA) kit (EMC102a, NeoBioscience), Mouse IL-1β ELISA kit (EMC001b, NeoBioscience), Mouse LASP1 ELISA kit (ZC-55248, ZCIBIO), Human LASP1 ELISA kit (ZC-55237, ZCIBIO), Evans blue (CE5171, Coolaber), 4 % polyformaldehyde (G1101, Servicebio), Trizol (15596026CN, Thermo), HiScript II Q RT SuperMix for qPCR (R223, Vazyme), ChamQ Universal SYBR qPCR Master Mix (Q711-03, Vazyme)

2.2. Animals

C57BL/6J mice (male, 8 weeks old) were purchased from Hunan SJA Laboratory Animal Co. Ltd. and housed in an SPF environment with free access to food and water. All animal experimental studies were approved by the Experimental Animal Ethics Committee of Xiangya hospital, Central South University (202103392).

2.3. ALI model and treatment

The ALI mouse model was established by intratracheal instillation of LPS (5 mg/kg) or E protein (10 μg per mouse) after anaesthesia. For the in vivo therapeutic effect study of TPN/Sal B, the ALI mice were randomly divided into four groups and received different treatments 1 h after LPS administration: (1) control group (Con), with intratracheal instillation of saline; (2) TPNs group, with intratracheal instillation of TPNs (2.5 mg/kg); (3) Sal B group, with intratracheal instillation of Sal B (5 mg/kg); (4) TPNs/Sal B group, with intratracheal instillation of TPNs/Sal B (2.5 mg/kg). A total volume of 60 μl was administered to each mouse via intratracheal instillation. All mice were euthanized to obtain the samples for further analysis 24 h after LPS or E protein administration.

2.4. Hematoxylin-eosin (HE) staining

Lung tissues were fixed in 4 % polyformaldehyde overnight, subsequently embedded in paraffin and sectioned. Tissue sections were dried, deparaffinised and stained with hematoxylin and eosin. Three random visual fields from each stained section were evaluated and scored. Pathological scoring of lung injury was performed using a 0–4 scale (0 indicates no lesion and 4 indicates severe, extensive lesions) based on the following parameters: inflammatory cell infiltration, alveolar wall thickening, hemorrhage, and edema.

2.5. Lung wet/dry (W/D) ratio

The surface water of the lung was absorbed and the wet tissue weight (W) was recorded. The lung tissue was then dried at 65 °C for 48 h to obtain the dry tissue weight (D). The degree of pulmonary edema was assessed using the W/D ratio.

2.6. Collection and analysis of BALF

Bronchoalveolar lavage fluid (BALF) was collected as previously describe [19]. The BALF was centrifuged at 4 °C, 1500 rpm for 10 min, and the supernatant was collected for detection of protein concentration and inflammatory factors. The protein concentration was detected by the BCA method and the levels of TNF-α, IL-1β were detected by ELISA according to the kit instructions.

2.7. Western blotting

Total protein was extracted using protein extraction reagent containing protease and phosphatase inhibitor, and protein quantification was performed by the BCA method. Equal amounts (25–40 μg) of protein were separated by 8 % or 10 % SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. The membranes were blocked with 5 % skimmed milk for 1 h at room temperature and then incubated with the primary antibodies overnight at 4 °C. After incubation with the appropriate secondary antibodies, the membranes were visualised using the LI-COR Odyssey Imaging System. The intensity of each band was quantified by Image J. Relative expression levels of protein were normalized by the ratio of target protein to Tubulin.

2.8. GEO data analysis

The gene expression datasets GSE243066 and GSE172114 were obtained from the Gene Expression Omnibus (GEO) database and preprocessed according to platform's annotation files. Differential expression analysis was performed using the limma package in R, with significance set at an adjusted p < 0.05 and |log2FC|>1.

2.9. Preparation of TPNs/Sal B

TPNs were prepared as previously describe [23]. Briefly, 2.5 mM EGCG and 2 mM MnCl₂ were mixed in 10 mM HEPES buffer and stirred for 1 h. TPNs were obtained by centrifugation at 16000 rpm for 20 min and dispersed in HEPES buffer. To prepare TPNs/Sal B, the TPNs were added to a mixed solution of Sal B and chitosan (CS) with the mass ratio of TPNs:Sal B:CS of 1:0.4:1 and stirred vigorously for 1 h. TPNs/Sal B were collected by centrifugation at 16000 rpm for 20 min.

2.10. Characterization of TPNs/Sal B

Dynamic light scattering (DLS) was used to analyze the sizes of TPNs and TPNs/Sal B. The size of TPNs/Sal B in water and complete culture medium was measured repeatedly within 24 h to investigate colloidal stability. The morphology of TPNs/Sal B was characterised by transmission electron microscopy (TEM).

To investigate Sal B release, TPNs/Sal B were dispersed in 10 mM, phosphate buffer (pH 5.5, 7.4) and shaken (100 rpm, 37 °C). Samples were collected at predetermined time points, and the concentration of Sal B in the supernatant was detected by HPLC (Agilent 1260 Infinity II).

2.11. Cells

Mouse alveolar epithelial cells (MLE-12) were cultured in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (DMEM/F-12; Gibco) with 10 % FBS and 1 % penicillin-streptomycin in an incubator at 37 °C with 5 % CO₂.

2.12. Cellular uptake assay

MLE-12 cells (2.5 × 10⁵ per milliliter) were seeded in 12-well plates and cultured overnight. The cells were then incubated with 40 μg/mL RhB-labeled TPNs/Sal B for 6 h and imaged using a confocal laser scanning microscope (Zeiss LSM Airyscan, Germany). The fluorescence intensities were analyzed by flow cytometry (Cytek-Northern Lights, USA).

2.13. Cytotoxicity assay

MLE-12 cells (5 × 10³ per milliliter) were seeded in 96-well plates and cultured overnight. The cells were then cultured in the medium containing different concentrations of TPNs/Sal B for 24 h. Subsequently, the medium was replaced with by 100 μl of MTT solution (500 μg/ml) and incubated for 4 h. Finally, the medium was removed and 100 μL of dimethyl sulfoxide was added to dissolve the formazan crystals. The absorbance at 490 nm was measured with an enzyme counter.

2.14. In vitro anti-PANoptosis activity

MLE-12 cells were treated with 1 μg/ml LPS for 24 h to establish an ALI cell model. To model pyroptosis, the oxygen glucose deprivation/reoxygenation (OGD/R) model was established by culturing cells in glucose-free medium under hypoxic conditions for 12 h, followed by reoxygenation in complete medium under normoxic conditions for another 12 h. Apoptosis or necroptosis was induced by treating cells with 500 μM dexamethasone or 10 μM shikonin, respectively. Following model induction, cells were treated with varying concentrations of TPNs/Sal B for 24 h to evaluate its effect on each death pathway.

2.15. Evans blue (EB) leakage assay

Mice were injected intravenously with 2 % EB solution (30 mg/kg) after anaesthesia, the lung tissues were collected after 2 h, homogenised in PBS (0.5 ml/100 mg of tissue) and then incubated with formamide at 60 °C for 18 h. After centrifugation at 5000g for 30 min, the supernatant was collected and the absorbance measured at 620 nm.

2.16. qPCR

Total RNA was extracted using the Trizol method and then reverse transcribed to cDNA using HiScript II Q RT SuperMix. mRNA levels of the target molecules were detected using ChamQ Universal SYBR qPCR Master Mix according to the kit instructions. Primer sequences are listed in Table 1. Relative quantitative analysis was performed using the 2^−ΔΔCt method.

Table 1.

Sequences of primers for quantitative PCR.

Gene name	Primer sequence (5′-3′)
	Forward	Reverse
Claudin-3	ACCAACTGCGTACAAGACGAG	CGGGCACCAACGGGTTATAG
Claudin-4	TGGAGGACGAGACCGTCAA	CACGGGCACCATAATCAGCA
Claudin-18	CTGTACGAGCCCTGATGATCG	CATCCATGCTACCAATGCGAAT
Occludin	TTCAGGTGAATGGGTCACCG	AGATAAGCGAACCTGCCGAG
ZO-1	GTTGGTACGGTGCCCTGAAAGA	GCTGACAGGTAGGACAGACGAT
LASP1	GAATAAGGGCAAAGGTTTCAGCG	ACTGGTCGGGATATGGTGAGG
GAPDH	CATGGCCTTCCGTGTTCCTA	TACTTGGCAGGTTTCTCCAGG

2.17. Human samples

The collection of human blood samples was approved by the Ethics Committee of Xiangya Hospital, Central South University (2022020152), and written informed consent was obtained from all participants. 16 patients with ARDS were randomly enrolled, and the enrolment criteria were consistent with those of previous studie [19]. In addition, 16 age- and sex-matched healthy volunteers were enrolled as controls. Peripheral blood samples were taken from ARDS patients within 24 h of diagnosis, then centrifuged at 4 °C, 3000 rpm for 10 min, and the plasma was collected and stored at −80 °C. The concentration of LASP1 in plasma was quantified using a commercial ELISA kit according to the manufacturer's instructions.

2.18. Statistical analysis

Data were expressed as mean ± standard error (mean ± SEM) and analyzed using Graphpad Prism (version 9.5) software. Two-tailed t-test was used to compare data between the two groups, and one-way ANOVA followed by Tukey's post hoc test was used for multiple group comparisons. Pearson correlation analysis was used to examine the correlation between LASP1 and the TJ-related molecules. p < 0.05 was considered a statistically significant difference.

3. Results and discussion

3.1. Upregulation of PANoptosis-Related molecules in ALI model mice and clinical ARDS patient samples

LPS, a virulence factor found in the outer membrane of Gram-negative bacteria, is widely used as an immunostimulant in the construction of ALI models [5]. Similarly, the SARS-CoV-2 envelope protein (E protein), a structural component of the SARS-CoV-2 virus, plays a critical role in eliciting primary immune responses [25] and can effectively induce pathological damage in mouse models of ALI [26]. Based on these considerations, we established bacterial and viral ALI mouse models through intratracheal instillation of LPS and E protein, respectively. HE staining of lung tissues revealed significant pathological changes, including inflammatory cell infiltration and thickening of the alveolar septa in both LPS and E protein-treated groups compared to the control group (Con), which received intratracheal instillation of physiological saline. The lung injury scores were significantly elevated in both LPS and E protein-treated groups (Fig. 2A). Pulmonary barrier damage during ALI/ARDS progression can result in pulmonary edema [3], which can be evaluated by measuring the wet/dry weight ratio of lung tissues and the total protein content in BALF [27]. Notably, both LPS and E protein instillation significantly increased the wet/dry weight ratio of lung tissues (Fig. 2B) and total protein content in BALF (Fig. 2C). All these results confirmed the successful induction of pathological lung injury in model mice.

Fig. 2.

Upregulation of PANoptosis-Related Molecules in ARDS Patients and ALI Mice. (A) Representative HE staining of lung tissues and quantification of lung injury scores in mice, scale bar = 50 μm (n = 3). (B) Wet/dry weight ratio of mouse lung tissue (n = 6). (C) Total protein concentration in mouse BALF (n = 6). (D–I) Analysis of PANoptosis-related protein levels in mouse lung tissue (n = 6), including (E) GSDMD-N, (F) cleaved caspase-3, (G) MLKL, (H) cleaved caspase-8, and (I) ZBP1. (J) Schematic representation of PANoptosis-related molecular pathways. (K–L) Bioinformatics analysis of peripheral blood transcriptomics data from ARDS patients using the (K) GSE243066 and (L) GSE172114 datasets. Data are presented as mean ± SEM. One-way ANOVA was used for statistical analysis in A-C and E-I, while t-tests were used in K–L; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

Next, we assessed the expression levels of PANoptosis-related molecules in the lung tissues of ALI mice. PANoptosis is an inflammatory form of cell death characterized by the concurrent activation of pyroptosis, apoptosis, and necroptosis pathways [18]. We measured PANoptosis by analyzing the levels of the pyroptosis execution protein GSDMD-N, the apoptosis execution protein cleaved caspase-3, and the necroptosis execution protein MLKL. Our results demonstrated that the protein levels of GSDMD-N (Fig. 2D and E), cleaved caspase-3 (Fig. 2D and F), and MLKL (Fig. 2D and G) were significantly upregulated in the lung tissues of both LPS and E protein-treated mice compared to the Con group, indicating increased pyroptosis, apoptosis, and necroptosis.

To investigate the potential crosstalk among these three cell death pathways leading to PANoptosis, we further examined the levels of ZBP1 and cleaved caspase-8. ZBP1 is a key PANoptosis-initiating signaling molecule that recruits various adaptor and effector proteins to form the PANoptosome, thereby triggering pyroptosis, apoptosis, and necroptosis [18]. Caspase-8, a critical component of the PANoptosome, acts as a molecular switch that regulates all three cell death pathways [28]. Our analysis revealed significant upregulation of cleaved caspase-8 (Fig. 2D and H) and ZBP1 (Fig. 2D and I) in the lung tissues of LPS and E protein-treated mice compared to the Con group. Additionally, the protein levels of cleaved caspase-8 were notably different between the LPS and E protein groups, possibly reflecting the distinct injury mechanisms elicited by bacterial and viral stimuli. These findings suggest that ZBP1 signaling initiates PANoptosis in the lung tissues of ALI mice, leading to increased levels of the key execution molecules involved in pyroptosis, apoptosis, and necroptosis (Fig. 2J).

To explore the clinical relevance of PANoptosis, we analyzed ARDS patient samples using the GSE243066 dataset from the GEO database. Our results indicated that, compared to healthy controls, ARDS patients exhibited upregulation of CASP1 (caspase-1) mRNA, which is associated with pyroptosis, and downregulation of the apoptosis-inhibitory molecule B-cell lymphoma-2 (BCL-2). Additionally, there was an upregulation of MLKL mRNA levels, related to necroptosis, and upregulation of the PANoptosis-initiating molecule ZBP1, while the PANoptosis inhibitory molecule transforming growth factor beta-activated kinase 1 (TAK1, also known as mitogen-activated protein kinase kinase 7, MAP3K7) was downregulated (Fig. 2K). These findings suggest an increased PANoptosis level in ARDS patients. Furthermore, to examine the correlation between PANoptosis and ARDS severity, we analyzed data from the GSE172114 dataset. Patients with severe ARDS exhibited more pronounced changes in peripheral blood markers, including upregulation of CASP1 and GSDMD associated with pyroptosis, upregulation of CASP3 associated with apoptosis, downregulation of the apoptosis-inhibitory molecule BCL-2, and upregulation of RIPK1, RIPK3, and MLKL associated with necroptosis (Fig. 2L). Moreover, PANoptosis signaling molecules ZBP1 and CASP8 were also upregulated. These data suggest a potential positive correlation between PANoptosis levels and ARDS severity, indicating that PANoptosis may serve as a promising therapeutic target for ALI/ARDS.

3.2. Construction and Characterization of TPNs/Sal B nanoparticles

Despite advancements in the understanding of PANoptosis, effective therapeutic agents targeting this process remain scarce. In our previous studies, we synthesized TPNs through the oxidative self-polymerization of EGCG, which demonstrated significant pharmacological activities, including anti-pyroptotic and anti-necroptotic effects [23]. However, the anti-apoptotic efficacy of TPNs was found to be limited. To address this limitation, we propose utilizing TPNs as carriers to encapsulate the anti-apoptotic compound Sal B via interfacial adsorption, thereby constructing a nanomedicine with comprehensive anti-PANoptotic properties.

As illustrated in Fig. 3A, EGCG undergoes oxidative self-polymerization under mildly alkaline conditions to form TPNs (Mn²⁺ as catalyst). Subsequently, Sal B is adsorbed onto the nanoparticle surface through intermolecular interactions, and the complex is further coated with chitosan (CS) to form TPNs/Sal B nanoparticles. The drug loading capacity (DLC) and encapsulation efficiency (EE) of Sal B on TPNs were 213.5 μg/mg and 53.4 %, respectively. DLS analysis revealed that the hydrodynamic diameter of TPNs/Sal B increased to approximately 200 nm compared to TPNs alone (Fig. 3B). TEM imaging indicated that TPNs/Sal B exhibited irregular shapes (Fig. 3C). Following CS encapsulation, TPNs/Sal B demonstrated excellent colloidal stability in both aqueous solutions and complete culture medium, underscoring its potential applicability in biological environments (Fig. 3D).

Fig. 3.

Construction and Characterization of TPNs/Sal B Nanoparticles. (A) Schematic illustration of the TPNs/Sal B preparation process. (B) Dynamic light scattering (DLS) analysis of nanoparticle size. (C) Transmission electron microscopy (TEM) images showing the morphology of TPNs/Sal B, scale bar = 200 nm. (D) Colloidal stability of TPNs/Sal B in water and complete culture medium. (E) Drug release profile of TPNs/Sal B under different pH conditions. (F) CLSM imaging and (G) Flow cytometry analysis showing cellular uptake of RhB-labeled TPNs/Sal B nanoparticles (RhB-NPs), scale bar = 20 μm (n = 3). (H) Cytotoxicity assessment of TPNs/Sal B using MTT assay (n = 5). Data are presented as mean ± SEM. One-way ANOVA was used for statistical analysis in F and H; ∗p < 0.05, ∗∗p < 0.01.

The drug release profile of TPNs/Sal B was assessed by quantifying the release of Sal B under different pH conditions. Under physiological pH 7.4, the release of Sal B was slow, with only 20 % cumulative release observed within 48 h (Fig. 3E). However, in a weakly acidic environment (pH 5.5), mimicking the intracellular vesicular/lysosomal conditions, the release rate was significantly accelerated, with 50 % of Sal B released within 12 h. These results suggest that TPNs/Sal B can effectively encapsulate and retain the drug during systemic circulation, preventing premature drug leakage. Upon cellular uptake, the drug is released in response to the acidic microenvironment, thereby exerting its therapeutic effects.

The cellular uptake and biocompatibility of TPNs/Sal B were further evaluated. The uptake of nanoparticles by cells is a prerequisite for their therapeutic action. To monitor cellular uptake, we used Rhodamine B (RhB)-labeled nanoparticles. Following incubation of RhB-labeled TPNs/Sal B with lung epithelial cells, intracellular red fluorescence was observed, indicating successful nanoparticle internalization (Fig. 3F and G). The fluorescence intensity was stronger than free RhB treated group, demonstrating the promotion of cellular uptake by nanoparticle loading. Additionally, the cytotoxicity of TPNs/Sal B was assessed using an MTT assay. No significant reduction in cell viability was observed after 24 h of incubation with TPNs/Sal B at concentrations up to 40 μg/mL, indicating good biocompatibility (Fig. 3H).

3.3. In vitro evaluation of the Anti-PANoptosis effects of TPNs/Sal B

To assess the cellular bioactivity of TPNs/Sal B, we employed various in vitro models of cell death in MLE-12 lung epithelial cells, followed by treatment with TPNs/Sal B. LPS, a well-known inducer of ALI, significantly reduced cell viability, as shown in Fig. 4A. However, as the concentration of TPNs/Sal B increased, cell viability was gradually restored, indicating that TPNs/Sal B could effectively mitigate LPS-induced cell death in this ALI model (Fig. 4A). Next, we simulated a glucose and OGD/R environment to model pyroptosis in cells [29] and evaluated the effect of TPNs/Sal B. The significant reduction in cell viability under these conditions indicated the induction of pyroptosis. Treatment with TPNs/Sal B markedly inhibited cell death, suggesting that TPNs/Sal B can suppress the pyroptosis pathway (Fig. 4B). In an apoptosis model induced by dexamethasone [30], a substantial decrease in cell viability was observed. However, TPNs/Sal B treatment counteracted this effect, demonstrating the compound's ability to inhibit apoptosis (Fig. 4C). Similarly, in a necroptosis model induced by shikonin [31], TPNs/Sal B alleviated cell death, indicating its inhibitory effects on necroptosis (Fig. 4D). Collectively, these findings suggest that TPNs/Sal B can effectively inhibit multiple cell death pathways associated with PANoptosis, highlighting its therapeutic potential for ALI/ARDS.

Fig. 4.

In Vitro Anti-PANoptosis Effects of TPNs/Sal B. (A–D) The protective effect of varying concentrations of TPNs/Sal B on cell viability in models of LPS-induced ALI (A), OGD/R-induced pyroptosis (B), dexamethasone-induced apoptosis (C), and shikonin-induced necroptosis (D) in MLE-12 cells (n = 5). (E–O) The effect of TPNs/Sal B treatment on the expression levels of PANoptosis-related proteins in two ALI cell models (n = 3). (F, K) GSDMD-N expression, (G, L) cleaved caspase-3 expression, (H, M) MLKL expression, (I, N) cleaved caspase-8 expression, and (J, O) ZBP1 expression. Data are presented as mean ± SEM. Statistical analysis was performed using one-way ANOVA for panels A–D and F-O; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

To further substantiate the anti-PANoptosis effects of TPNs/Sal B, we established an ALI cellular model by stimulating MLE-12 cells with LPS and the E protein. In comparison to the untreated control, the expression of PANoptosis-related proteins was significantly upregulated in cells treated with LPS and E protein (Fig. 4E–O), corroborating the results observed in the vivo ALI model, and indicating elevated PANoptosis levels. Notably, TPNs significantly reduced the expression levels of GSDMD-N (Fig. 4E, F and K) and MLKL (Fig. 4E, H, and M), demonstrating their inhibitory effects on pyroptosis and necroptosis, respectively. However, TPNs alone exhibited a limited effect on the expression of cleaved caspase-3, a key apoptosis marker (Fig. 4E, G, and L). Conversely, Sal B effectively reduced cleaved caspase-3 levels, emphasizing its specific anti-apoptotic activity. Consequently, the combination of TPNs and Sal B (TPNs/Sal B) resulted in a significant downregulation of GSDMD-N (Fig. 4E, F, and K), MLKL (Fig. 4E, H, and M), and cleaved caspase-3 (Fig. 4E, G, and L) in LPS and E protein-induced cell models, thereby exerting a comprehensive anti-PANoptosis effect. To further validate the inhibitory effects of TPNs/Sal B on PANoptosis, we measured the expression levels of cleaved caspase-8 and ZBP1. TPNs/Sal B exhibited the most pronounced regulatory effects on both cleaved caspase-8 and ZBP1 in the cellular models (Fig. 4E, I, J, N, and O), indicating a synergistic inhibition of multiple cell death pathways by TPNs and Sal B, which collectively contribute to their anti-PANoptosis efficacy.

3.4. TPNs/Sal B alleviates lung tissue damage and inflammation in ALI mice

Following the confirmation of the anti-PANoptosis activity of TPNs/Sal B at the cellular level, we established an ALI mouse model using LPS and the E protein to evaluate the therapeutic effects of TPNs/Sal B in vivo (Fig. 5A). HE staining of lung tissues revealed significant pathological changes, including inflammatory cell infiltration and alveolar septal thickening, in mice treated with LPS and E protein. Consistently, the lung injury scores of these two groups were significantly higher than those in Untreated group, which confirms the successful establishment of the ALI model (Fig. 5B–D). Treatment with either TPNs or Sal B alone partially alleviated these pathological changes (Fig. 5B–D), consistent with previously reported findings [23,32]. However, the most pronounced improvement was observed in the TPNs/Sal B treatment group, which exhibited lower lung injury scores compared to the groups receiving TPNs or Sal B alone (Fig. 5C and D). Furthermore, in the Untreated group, TPNs/Sal B treatment did not induce histopathological alterations in lung tissue, suggesting no apparent acute toxicity (Fig. 5B).

Fig. 5.

TPNs/Sal B Alleviates Lung Tissue Injury and Inflammation in ALI Mice. (A) Schematic Diagram of the Experimental Workflow. (B–D) Representative HE staining of lung tissues (B) and quantification of lung injury scores in mice (C–D). Scale bar = 50 μm (n = 3). (E–F) Wet/dry weight ratio of mouse lung tissue (n = 4). (G–H) Total protein concentration in BALF of mice (n = 6). (I–L) Concentration of inflammatory cytokines in mouse BALF (n = 6): (I–J) TNF-α, (K–L) IL-1β. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA in panels C–L; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

To assess the impact of TPNs/Sal B on pulmonary edema in ALI mice, we measured the lung wet/dry weight ratio and the total protein content in BALF. In mice exposed to LPS and E protein, both the wet/dry weight ratio of lung tissue (Fig. 5E and F) and the total protein content in BALF (Fig. 5G and H) were significantly elevated, indicating the presence of pulmonary edema. Treatment with TPNs/Sal B significantly reduced these parameters in the ALI model mice, with effects slightly superior to those observed with TPNs or Sal B alone (Fig. 5E–H), suggesting that TPNs/Sal B can effectively alleviate pulmonary edema in ALI.

An excessive inflammatory response is a key pathogenic mechanism and pathological feature of ALI/ARDS [4]. We measured the levels of inflammatory cytokines in the BALF of ALI mice using ELISA. Following LPS and E protein challenge, levels of both TNF-α (Fig. 5I and J) and IL-1β (Fig. 5K and L) were significantly elevated, indicating a robust inflammatory response. Treatment with TPNs significantly reduced the levels of TNF-α and IL-1β in the BALF of ALI model mice, consistent with our previous findings that TPNs possess in vivo anti-inflammatory activity [23,33]. Similarly, Sal B, known for its anti-inflammatory properties [24,32], markedly reduced cytokine levels in ALI mice. Notably, treatment with TPNs/Sal B most markedly reduced the levels of key inflammatory cytokines in ALI mice, demonstrating its superior anti-inflammatory efficacy (Fig. 5I–L).

The localized administration of TPNs/Sal B via intratracheal instillation was strategically employed in this study to specifically target lung injury, which not only enhances the local bioavailability of the therapeutic agent at the lesion site but also minimizes systemic exposure and potential off-target effects. Notably, building upon a series of our prior studies [23,34,35], the biocompatibility and safety of the TPNs carrier system have been thoroughly validated. In multiple independent animal experiments, neither the blank TPNs nor TPNs-loaded nanomedicine induced pathological changes or cumulative toxicity in major organs (heart, liver, spleen, lung, and kidney) across multiple in vivo models. Therefore, the systemic biodistribution of TPNs/Sal B and its potential off-target effects were not explicitly investigated herein. A systematic evaluation of its pharmacokinetics and long-term safety profile remains a requisite for future research to provide a more comprehensive translational assessment. Additionally, evaluating TPNs/Sal B in alternative insult or two-hit models -beyond the single-hit LPS or E protein instillation employed here-will be essential to confirm its therapeutic efficacy across the heterogeneous spectrum of ALI/ARDS.

3.5. In Vivo Anti-PANoptosis efficacy of TPNs/Sal B

PANoptosis is a distinct form of inflammatory cell death that not only results in the loss of normal cellular functions but also promotes the release of inflammatory mediators, activation of inflammatory signaling cascades, and exacerbation of the inflammatory response [18], thereby contributing to the progression of ALI/ARDS. Our in vivo experiments demonstrated that TPNs/Sal B effectively ameliorates lung tissue damage and suppresses inflammation in ALI mice. To further investigate whether the therapeutic efficacy of TPNs/Sal B is associated with its anti-PANoptosis activity, we established an ALI mouse model using LPS and the E protein and assessed the expression levels of proteins related to PANoptosis.

In the lung tissues of ALI model mice, there was a significant increase in the levels of PANoptosis-related proteins, including GSDMD-N (Fig. 6A–C), cleaved caspase-3 (Fig. 6A, D, and E), MLKL (Fig. 6A, F, and G), cleaved caspase-8 (Fig. 6A, H, and I), and ZBP1 (Fig. 6A, J, and K). However, treatment with TPNs/Sal B resulted in a marked downregulation of these proteins, thereby confirming the anti-PANoptosis activity of TPNs/Sal B in vivo. These findings provide strong evidence at the animal level that targeted inhibition of PANoptosis can be an effective therapeutic strategy for ALI/ARDS.

Fig. 6.

In Vivo Anti-PANoptosis Efficacy of TPNs/Sal B. (A) Representative Western blot images and (B–K) quantitative analysis of the effect of TPNs/Sal B on PANoptosis-related protein levels (n = 6). (B–C) GSDMD-N, (D–E) cleaved caspase-3, (F–G) MLKL, (H–I) cleaved caspase-8, (J–K) ZBP1. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA in panels B–K; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

3.6. TPNs/Sal B Improves Lung Epithelial Barrier Function in ALI mice

The structural integrity of the pulmonary epithelial barrier, which is formed by epithelial cells and their intercellular junctions, is critical in maintaining lung function. Disruption of this barrier is a hallmark pathological feature of ALI/ARDS [4], and the extent of this damage is a key determinant of disease severity [7]. Previous studies have demonstrated that PANoptosis contributes to the disintegration of intercellular junctions, thereby compromising the structure and function of the epithelial barrier during ALI/ARDS. Having established the in vivo anti-PANoptosis activity of TPNs/Sal B, we further investigated its protective effects on the lung epithelial barrier.

Using EB dye to assess lung barrier permeability, we found that ALI mice induced by LPS and the E protein exhibited a significant increase in EB leakage into lung tissue (Fig. 7A and B), indicating substantial barrier damage. Treatment with TPNs/Sal B markedly reduced EB leakage in the lung tissue of ALI mice, while having no significant effect on EB levels in the lung tissue of untreated mice. This suggests that TPNs/Sal B has a protective effect on the alveolar-capillary barrier in ALI mice.

Fig. 7.

TPNs/Sal B Improves Lung Epithelial Barrier Function in ALI Mice. (A–B) Assessment of Evans blue (EB) permeability in mouse lung tissue (n = 4). (C) Ultrastructural analysis of tight junctions between lung epithelial cells by TEM, red arrows indicate tight junctions. scale bar = 1 μm (n = 3). (D) mRNA levels of epithelial barrier-related molecules in lung tissue of LPS-induced ALI mice (n = 8). (E) mRNA levels of epithelial barrier-related molecules in lung tissue of E protein-induced ALI mice (n = 8). (F–N) Protein levels of barrier-related molecules in mouse lung tissue (n = 6). (G–H) Claudin-4, (I–J) Claudin-18, (K–L) Occludin, (M–N) ZO-1. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA in B, D-E, and G-N; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

TJs between epithelial cells are crucial for maintaining the integrity and function of the lung epithelial barrier [36,37]. TEM of mouse lung tissue revealed that TJs between alveolar epithelial cells were disrupted in ALI mice; however, treatment with TPNs/Sal B ameliorated this damage (Fig. 7C). We further evaluated the expression of TJ-related molecules by qPCR (Fig. 7D and E) and Western blotting (Fig. 7F–N). Claudin-3, Claudin-4, and Claudin-18 are the principal claudins in pulmonary epithelial TJs [38,39], while Occludin and ZO-1 are key components of TJs [37,40]. In ALI model mice, the mRNA (Fig. 7D and E) and/or protein expression levels (Fig. 7F–N) of TJ-related molecules were significantly reduced following LPS and E protein treatment. Notably, TPNs/Sal B treatment restored the mRNA levels of Claudin-4 and Claudin-18 (Fig. 7D and E) in lung tissue of ALI mice. At the protein level, TPNs/Sal B treatment significantly increased Claudin-4 expression, while Claudin-18 and Occludin showed clear upward trends (p = 0.0907, p = 0.0618, respectively) (Fig. 7F–N). These findings suggest that TPNs/Sal B effectively mitigates lung barrier dysfunction in ALI mice by restoring tight junction integrity between lung epithelial cells.

3.7. TPNs/Sal B Improves Lung Epithelial Barrier Function in ALI Mice Through Upregulation of LASP1

The actin cytoskeleton plays a vital role in the assembly, stabilization, and remodeling of TJs in epithelial cells [36,41]. LASP1 is an F-actin binding protein intimately involved in actin cytoskeleton dynamics, and it may stabilizes the Snail transcriptional repression complex [42], which is crucial for the regulation of TJ molecule expression [43,44]. Furthermore, a reduction in LASP1 levels is associated with increased cell apoptosis [45,46], highlighting its importance in maintaining cellular integrity. We conducted an ELISA assay to measure plasma LASP1 levels in clinical ARDS patients compared to healthy controls (HC). The results demonstrated a significant reduction in LASP1 levels in the plasma of ARDS patients (Fig. 8A). This suggests that LASP1 may highly correlated with the progression of ARDS.

Fig. 8.

TPNs/Sal B Improves Lung Epithelial Barrier Function in ALI Mice Through Upregulation of LASP1. (A) Plasma LASP1 levels in clinical ARDS patients compared to healthy controls (HC) (n = 16). (B) Plasma LASP1 levels in LPS-induced ALI mice (n = 8). (C) Plasma LASP1 levels in E protein-induced ALI mice (n = 8). (D) LASP1 protein levels in lung tissue from LPS or E protein-induced ALI mice (n = 6). (E) LASP1 mRNA levels in lung tissue from LPS-induced ALI mice (n = 8). (F) LASP1 mRNA levels in lung tissue from E protein-induced ALI mice (n = 8). (G–J) Correlation of Claudin-4 (G), Claudin-18 (H), Occludin (I), ZO-1 (J) with LASP1 protein expression (n = 30). Data are presented as mean ± SEM. Statistical significance was determined by t-test in A, by one-way ANOVA in B–F and by Pearson correlation analysis in G–J; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

To explore the regulatory effect of TPNs/Sal B on LASP1 levels, we induced ALI in mouse models using LPS and E protein. Consistent with the clinical findings, plasma LASP1 levels were downregulated in ALI mice, while TPNs/Sal B treatment significantly increased plasma LASP1 levels (Fig. 8B and C). LASP1 protein (Fig. 8D) and mRNA levels (Fig. 8E and F) were significantly reduced in the lung tissues of ALI mice, which was effectively reversed by TPNs/Sal B treatment at both the protein and mRNA levels. Pearson correlation analysis was performed using protein expression data of LASP1 and TJ-related molecules, which were derived from Western blotting analysis of lung tissues from each group of mice. The protein levels of TJ-related molecules (claudin-4, claudin-18, occludin, and ZO-1) showed a significant positive correlation with LASP1 protein expression (Fig. 8G–J). These findings suggest that TPNs/Sal B may enhance lung epithelial barrier function by upregulating LASP1 expression, although the precise mechanisms underlying this effect require further investigation.

4. Conclusion

This study elucidates the pivotal role of PANoptosis in the pathogenesis of ALI/ARDS and highlights the therapeutic potential of targeting this integrated cell death pathway. Our development of TPNs/Sal B, a multifunctional nanomedicine that synergistically combines the anti-pyroptotic and anti-necroptotic effects of TPNs and Sal B, offers a novel approach to ALI/ARDS treatment. The efficacy of TPNs/Sal B in inhibiting PANoptosis and restoring lung epithelial barrier function was demonstrated in both in vitro and in vivo models. Furthermore, we identified LASP1 as a critical factor in maintaining barrier integrity, with its expression being upregulated by TPNs/Sal B treatment. These findings suggest that TPNs/Sal B not only mitigates the deleterious effects of ALI/ARDS but also offers a targeted therapeutic strategy that addresses the underlying mechanisms of the disease. As such, TPNs/Sal B represents a promising candidate for the development of specific and effective therapies for ALI/ARDS, potentially improving outcomes for patients afflicted with this life-threatening condition.

CRediT authorship contribution statement

Yanhui Cui: Writing – review & editing, Project administration, Investigation, Funding acquisition, Conceptualization. Xueqin Wang: Writing – original draft, Visualization, Investigation, Formal analysis. Caiyang Lu: Validation, Methodology. Liling Ran: Validation, Methodology. Zirui Guo: Visualization, Validation. Jiayu Yao: Investigation. Tian Yu: Resources, Methodology. Xuanxi Liu: Investigation. Fang Li: Resources, Methodology. Changqi Li: Supervision, Conceptualization. Yingcai Meng: Writing – review & editing, Visualization, Investigation, Formal analysis. Wenhu Zhou: Writing – review & editing, Supervision, Project administration, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

Data will be made available on request.