Skip to main content
NCBI home page
Infectious Medicine logoLink to Infectious Medicine
. 2025 Dec 25;5(1):100232. doi: 10.1016/j.imj.2025.100232

Antimicrobial resistance and virulence patterns of Helicobacter pylori among patients with suspected peptic ulcer disease in disenfranchised settings

Marwan Osman a,#,⁎, Rayane Rafei b,#, Kevin J Cummings c, Wassim Rafei d,e,f, Joseph Awada g, Hayssam Moubayed h,i, Farah Majzoub h, Hassan Mallat b, Fouad Dabboussi b, Monzer Hamze b,j,⁎
PMCID: PMC12813601  PMID: 41560759

Highlights

  • •

    Helicobacter pylori clarithromycin resistance has reached alarming levels in Lebanon.

  • •

    Culture and Allplex™ H pylori and ClariR Assay concurred in 91% of cases.

  • •

    In-depth genomic data on H. pylori resistance is urgently needed.

Keywords: Helicobacter pylori, Antimicrobial resistance, Molecular method, Allplex™ H. pylori and ClariR assay, Virulence factor, Lebanon

Abstract

Background

The epidemiology of Helicobacter pylori in Lebanon is underreported. We aimed to estimate the infection proportion, clarithromycin resistance, and virulence determinants of H. pylori among symptomatic patients with suspected peptic ulcers in Tripoli, North Lebanon.

Methods

Eighty-seven patients undergoing routine endoscopy screening for peptic ulcers were selected. Culture and Allplex™ H. pylori and ClariR Assay were performed. Antimicrobial susceptibility testing for clarithromycin, tetracycline, levofloxacin, and rifampicin was performed using the E-test method. The virulence factors (cagA, vacA, dupA, iceA1, iceA2, and oipA) were screened and/or typed by PCR.

Results

Overall, 32.2 % (28/87) of the patients were found to be infected with H. pylori. Five isolates were resistant to clarithromycin, associated with specific point mutations of A2143G (4/5) or A2142C (1/5). The vacA was found in all tested isolates, with s2m2 being the predominant vacA genotype. The 3′ end variable region of cagA was identified in 44.4% of isolates, where cagA typing indicated their belonging to Western types. The other virulence determinants were dupA (77.8%), iceA1 (61.1%), oipA (55.6%), and iceA2 (50%).

Conclusions

Our findings demonstrate the circulation of H. pylori among symptomatic patients with suspected peptic ulcers in Lebanon, characterized by a rich and diverse pool of virulence genes and the emergence of resistance to clarithromycin and levofloxacin. Large-scale surveillance is crucial for quantifying the burden of H. pylori infection, monitoring antimicrobial resistance trends, and ensuring timely updates to eradication treatment policies.

1. Introduction

Helicobacter pylori is a transmissible, Gram-negative bacterium that colonizes specifically the gastric mucosa of humans and is one of the most common and oldest pathogens to have infected humankind.1 After successful colonization, it can trigger a wide spectrum of gastroduodenal diseases. These range from acute and chronic gastritis to peptic ulcers and gastric carcinoma.2 About 90% of non-cardia gastric cancers are attributed to H. pylori.3 Gastric environments pose many challenges for bacterial colonization, including extreme acidity (pH 1.5–3.5) and robust mucosal defense systems.4, 5, 6 To persist and infect such a challenging niche, this pathogen uses an arsenal of virulence factors. These include factors necessary for bacterial colonization, such as OipA, and for gastric pathogenicity, such as CagA, VacA, DupA, and IceA.7 For instance, CagA is an effector protein encoded by the cag pathogenicity island. It is injected directly into gastric epithelial cells by a bacterial type IV secretion apparatus. Once inside, CagA is phosphorylated by host cell kinases on tyrosine residues found on the conserved C-terminal EPI-YA (Glu-Pro-Ile-Tyr-Ala) motifs. The phosphorylated CagA interacts with SHP-2 (a protein tyrosine phosphatase) or Grb2 (an adaptor protein), which induces cellular alterations including proliferation and changes in cell phenotype.8 The biological activity of virulence factors such as CagA and VacA is influenced by polymorphisms in their variable regions, which differ across geographical regions and may contribute to variations in the clinical presentation of gastroduodenal diseases.9

Nearly half of the world's population is estimated to be infected with H. pylori.10 Prevalence varies by country and is influenced by factors such as age, socioeconomic status, educational level, and hygiene. Gastric cancer was the fifth most common cancer and the fourth leading cause of cancer mortality worldwide in 2020.3 H. pylori is an important risk factor for gastric cancer development. As a result, H. pylori eradication therapy is strongly recommended for the treatment and prevention of invasive gastroduodenal diseases. The effectiveness of this treatment in clinical practice is challenged by the emergence of multidrug-resistant H. pylori.11 Notably, clarithromycin-resistant H. pylori have been classified by the WHO in 2017 among the top 12 bacterial families most resistant to antimicrobials and is a high priority for new antimicrobial research and development.12

Even though gastric cancer is among the most common causes of cancer-related death in Lebanon, there are scarce data on the epidemiology of active H. pylori infections, the virulence of circulating strains, and their susceptibility to antimicrobials. Despite high failure rates, most local gastroenterologists treat with standard empirical treatment (e.g., proton pump inhibitor, clarithromycin, and amoxicillin) without routine baseline culture and testing for antimicrobial susceptibility. The widespread use of this practice promotes the dissemination of antimicrobial resistance (AMR) to drugs used in eradication regimens, primarily through point mutations. Resistance to clarithromycin (i.e., the key component used in H. pylori eradication treatment protocols) emerges because of modification of the peptidyltransferase region of the 23S rRNA through A2143G, A2142G, and A2142C point mutations.13 To our knowledge, there is a lack of data on clarithromycin-resistant H. pylori isolates, and the only available information dates back to 2002, reporting that 4% and 2% of isolates were resistant to clarithromycin and tetracycline, respectively.14 Therefore, the current study aimed to generate preliminary data on H. pylori infection, characterize key virulence factors (cagA, vacA, dupA, iceA1, iceA2, and oipA), and identify clarithromycin resistance mechanisms (i.e., the presence of A2142G, A2143G, and A2142C point mutations) in symptomatic patients with suspected peptic ulcers, especially in light of current absence of clarithromycin resistance prevalence in Lebanese population. Additionally, we assessed the susceptibility of H. pylori isolates to clarithromycin, tetracycline, levofloxacin, and rifampicin.

2. Methods

2.1. Study design

This pilot cross-sectional study was conducted from November 2018 to May 2019 at five main healthcare facilities (Nini Hospital, Haykal Hospital, Al Shifaa Hospital, Monla Hospital, and Hamidi Medical Center) in North Lebanon. The patients presented chronic epigastric pain or discomfort, including epigastric discomfort, bleeding, loss of appetite, or weight loss.

2.2. Microbiological analysis of biological samples

During endoscopy, two gastric biopsies from the antrum and the body of the stomach were collected. The samples were placed into Portagerm pylori transport media (bioMérieux®, Marcy L'Etoile, France), stored at 4°C, and processed within 2 h of collection. Subsequently, DNA was extracted from samples according to the manufacturer's instructions using QIAamp DNA Mini Kit (Qiagen®, Hilden, Germany). To screen for H. pylori infection and detect the A2143G, A2142G, and A2142C point mutations within the 23S rRNA gene, DNA-extracted samples were assessed using the Allplex™ H. pylori & ClariR Assay (Seegene®, Seoul, Republic of Korea), a recently validated multiplex real-time polymerase chain reaction (PCR) assay with high performance, according to the manufacturer's instructions.15 The assay was carried out on a CFX96™ real-time PCR system (BioRad, Hercules, USA) and analyzed using Seegene Viewer Software. PCR results were promptly communicated to the clinicians within 6 hours to assist in treatment decisions. In parallel, gastric biopsies were directly processed for standard culture. The samples were spread onto Modified BD Helicobacter Agar (Becton Dickinson®, San Jose, USA) under microaerophilic conditions and incubated for 5 to 10 days. Growing colonies were identified using MALDI-TOF VITEK MS version 3.0 (bioMérieux®, Marcy l'Etoile, France) and confirmed by the Allplex™ H. pylori and ClariR Assay. H. pylori isolates were screened for antibiotic susceptibility using the E-test method, as described in the CA-SFM guidelines (https://www.sfm-microbiologie.org/). The H. pylori CCUG 17874 strain was used for quality control. We also screened for the presence of the 3′ end variable region of cagA gene,16 and we then determined the polymorphism of different EPIYA motifs in that region.17 The variable regions of vacA were genotyped into alleles: the signal (s) region into s1 and s2 alleles18 and the middle (m) regions into m1 and m2 alleles.19 The dupA gene was recorded as positive if it was amplified with any of these primer pairs (dupA-setHF/dupA-setHR; dupA-setAF/dupA-setAR; dupA-setCF/dupA-setCR).20 The presence of iceA alleles and oipA was also determined.21 Notably, although PCR amplification without sequencing may theoretically lead to false positives, the primers used in this study have been validated in previous studies, and this approach is widely employed for detecting these virulence genes (Table 1). For quality control, PCR assays included positive and negative controls to ensure assay reliability.

Table 1.

Primers used for the detection of virulence factors in this study.

Target Primer names Primer sequences (5′–3′) Amplicon size (bp) References
cagA 3′ variable region CAGTF ACCCTAGTCGGTAATGGG 343–811 [16]
CAGTR GCTTTAGCTTCTGAYACYGC
EPIYA motifs Cag2F GGAACCCTAGTCGGTAATG [17]
 EPIYA-A CagAP1Cr GTCCTGCTTTCTTTTTATTAACTTKAGC 264
 EPIYA-B CagAP2TAr TTTAGCAACTTGAGCGTAAATGGG 306
 EPIYA-C/D CagAP3Er ATCAATTGTAGCGTAAATGGG 468
 EPIYA-C CagAWestr TTTCAAAGGGAAAGGTCCGCC 501
 EPIYA-D CagAEastr AGAGGGAAGCCTGCTTGATT 495
vacA s1/s2 VA1-F ATGGAAATACAACAAACACAC 259/286 [18]
VA1-R CTGCTTGAATGCGCCAAAC
vacA m1/m2 VAG-F CAATCTGTCCAATCAAGCGAG 570/645 [19]
VAG-R GCGTCTAAATAATTCCAAGG
iceA1 iceA1-F GTGTTTTTAACCAAAGTATC 247 [21]
iceA1-R CTATAGCCASTYTCTTTGCA
iceA2 iceA2-F GTTGGGTATATCACAATTTAT 229/334 [21]
iceA2-R TTRCCCTATTTTCTAGTAGGT
dupA dupA-setAF TGGTTTCTACTGACAGRGCRC 307 [20]
dupA-setAR AACACGCTRACAGGACAATCYCCC
dupA-setCF GACGATTGAGCGATGGGAATAT 970
dupA-setCR CTGAGAAGCCTTATTATCTTGTTGG
dupA-setHF ATTCACGCCTAAGACCTCA 487
dupA-setHR CTGAGAAGCCTTATTATCTTGTTGG
oipA HPO638F GTTTTTGATGCATGGGATTT 401 [21]
HPO638R GTGCATCTCTTATGGCTTT
Open in a new tab

2.3. Statistical analysis

The analysis was performed using R software (R Core Team, version 4.1.0; R Studio, version 2022.07.1-554). Basic descriptive statistics, including percentages and summary measures, were used to summarize the data.

3. Results and discussion

Eighty-seven dyspeptic patients who underwent routine esophagogastroduodenoscopy were enrolled. Overall, 32% (95% CI: 23%–43%) of the patients were positive for H. pylori infection. When comparing diagnostic methods, PCR was more sensitive than culture; seven PCR-positive cases were either culture-negative (n = 4) or culture-contaminated with other microorganisms (n = 3). However, only one culture-positive case was PCR-negative in the initial sample (Fig. 1). Although culture is considered the gold standard for diagnosing H. pylori infection, exposing samples to oxygen and cool temperatures during the process (e.g., sample transport, biopsy grinding) may reduce the assay's sensitivity, particularly in clinical laboratories with limited experience in the method. The discrepancies observed between culture and PCR results may also be influenced by additional factors, including the presence of PCR inhibitors in biopsy specimens or partial DNA degradation during storage and processing. Our findings are consistent with previously published data in Lebanon, despite differences in study groups and methods. Our recent large-scale retrospective report spanning six years revealed that one-third of dyspeptic patients in northern Lebanon were seropositive for H. pylori,22 which aligns with a cross-sectional study conducted in the same geographical area, reporting a prevalence of 31% among healthy volunteers.23

Fig. 1.

Fig 1

Open in a new tab

Distribution of standard culture and Allplex™ H. pylori and ClariR polymerase chain reaction (PCR) results. Out of 87 samples, culture and PCR concurred in 91% of cases (20 positive and 59 negative results).

Abbreviation: PCR, polymerase chain reaction.

Regarding AMR, five isolates (18%, 95% CI: 8%–36%) were clarithromycin-resistant and carried point mutations at A2143G (4/5) or A2142C (1/5), which are known to confer resistance to this antibiotic.24,25 Importantly, these molecular results were confirmed by E-test, while the remaining isolates, which were negative by the Allplex™ H. pylori and ClariR Assay, were found to be susceptible by phenotypic testing. The percentage of clarithromycin resistance has notably increased compared to previous data,14 which highlights the crucial need for susceptibility testing before prescribing any clarithromycin-containing therapy to ensure prudent antibiotic use and prevent treatment failure. According to the Maastricht IV/Florence Consensus,26 bismuth-containing quadruple therapies are recommended for first-line empirical treatment in areas of high clarithromycin resistance. If this regimen is not available, sequential treatment or a non-bismuth quadruple therapy is recommended. Nowadays, Lebanese physicians are increasingly prescribing bismuth-containing and non-bismuth quadruple therapies. We strongly recommend that national surveillance studies be conducted to accurately determine current clarithromycin resistance rates and trends in Lebanese H. pylori isolates, which should inform evidence-based updates to first-line treatment guidelines. Resistance to levofloxacin was observed in 4.8% of isolates (median minimum inhibitory concentration [MIC] = 0.047 mg/L), suggesting the emergence of fluoroquinolone resistance in Lebanon, although the number of isolates is small. No resistance was detected for rifampicin (median MIC = 0.064 mg/L) or tetracycline (median MIC = 0.016 mg/L).

The Lebanese healthcare system faces significant challenges driven by economic collapse, repercussions of the COVID-19 pandemic, a shortage of well-trained healthcare workers, and the responsibility to provide services for two million Syrian and Palestinian refugees.27 Critically, the lack of suitable diagnostics for infectious diseases and AMR, alongside rising healthcare costs, hinders care for vulnerable groups and strains public health in Lebanon.28, 29, 30 Current standard culture and susceptibility testing for H. pylori are time-consuming, labor-intensive, costly, and mainly accessible in large hospitals for privileged patients. This diagnostic gap highlights an urgent need to prioritize the adoption of efficient molecular methods across Lebanese healthcare facilities. Implementing such diagnostics is essential for antimicrobial stewardship, can curtail inappropriate antimicrobial use, and will substantially improve the quality of patient care. Swift action now will be pivotal in advancing both public health outcomes and equitable access to care in underprivileged settings.

Due to logistical reasons, we identified virulence factors in only 18 isolates (Table 2). The vacA gene was detected in all tested isolates, with the virtually non-toxic genotype s2m2 being the most prevalent (44.4%).31 Such dominance of the s2m2 genotype is concordant with other clinical studies, such as those conducted in Iran,32 Jordan,33 and Morocco.34 The importance of vacA genotypes lies in their potential association with different clinical outcomes.33 While the vacA s1m1 was linked to an increased risk of gastric cancers and duodenal ulcers,35,36 the s2m2 was associated with gastritis.32, 33, 34 Regarding CagA, the 3′ end variable region of cagA was positive in eight isolates, exhibiting three different EPIYA motif patterns: ABC (75%), AB (12.5%), and ABC/D (12.5%). This finding demonstrates the circulation of less virulent Western CagA types in our country (characterized by the occurrence of EPIYA-A and EPIYA-B sites followed by EPIYA-C sites), similar to other countries in the Middle Eastern and North African region,37, 38, 39 rather than the more virulent East Asian CagA types (characterized by EPIYA-A, EPIYA-B sites, and EPIYA-D).40,41 Meanwhile, an increased number of EPIYA-C motifs in Western CagA types was associated with a significant increase in the risk for developing peptic ulcer disease and duodenal ulcer in Asia, and for developing gastric cancer in the United States of America and Europe.42 All the herein studied isolates have a single EPIYA-C repeat coding sequence, which could potentially lower their virulence.

Table 2.

Distribution of virulence factors among the 18 Helicobacter pylori isolates according to the vacA genotypes.

vacA genotypes s2m2 s1m2 s1m1 s0m2* s2m0*
Isolates (n) 8 3 2 4 1
iceA allele frequency
 iceA1 5 1 1 3 1
 iceA2 5 2 0 1 1
iceA genotypes
 iceA1+/2+ 2 0 0 1 1
 iceA1−/2+ 3 2 0 0 0
 iceA1+/2− 3 1 1 2 0
 iceA1−/2− 0 0 1 1 0
dupA 8 1 1 3 1
oipA 7 0 1 2 0
cagA 3′ end positivity 2 2 2 2 0
EPIYA motifs 1 AB
1 ABC		 2 ABC 2 ABC 1 ABC
1 ABC/D		 0
Identified patterns of virulence factors 1 iceA1, vacA, dupA
1 iceA1, vacA, oipA, dupA
2 iceA2, vacA, oipA, dupA
1 iceA2, cagA, vacA, oipA, dupA
2 iceA1, iceA2, vacA, oipA, dupA
1 iceA1, cagA, vacA, oipA, dupA 		1 iceA2, vacA
1 iceA2, cagA, vacA
1 iceA1, cagA, vacA, dupA 		1 cagA, vacA
1 iceA1, cagA, vacA, oipA, dupA 		1 vacA, dupA
1 iceA1, iceA2, vacA
2 iceA1, cagA, vacA, oipA, dupA 		1 iceA1, iceA2, vacA, dupA
Open in a new tab

Note: *s0 means the absence of s region and m0 means the absence of m region.

Moreover, 78%, 61%, 56%, and 50% of isolates carried dupA, iceA1, oipA, and iceA2, respectively. With regards to dupA, a higher prevalence of dupA was observed in Western types compared to Asian types,43 explaining the richness of dupA in our Western-type isolates. Meanwhile, the impact of DupA on H. pylori remains controversial: While dupA has been suggested as a biomarker for peptic ulcer diseases,8 it is paradoxically associated with less severe clinical outcomes with a protection against severe gastric pathologies.44 Although these iceA1/iceA2-positive isolates originated from patients with gastritis and gastric ulcer, Abu-Taleb et al.45 observed an enrichment of these isolates in patients with gastric carcinoma, but not in those with gastritis or peptic ulcer, thus warranting further investigation. While we have not tested OipA expression, a meta-analysis demonstrated that strains with “on” status of oipA—expressing a functional protein—pose a greater risk for developing peptic ulcers and gastric cancer.46

4. Conclusion

This study provided crucial insights into the epidemiology of H. pylori among symptomatic patients with suspected peptic ulcers in Tripoli, North Lebanon, and reported a non-negligible proportion of infection and clarithromycin resistance, along with a diverse pool of virulence genes in the circulating H. pylori isolates. The findings highlighted the utmost need for comprehensive information on H. pylori infection incidence, virulence, and resistance patterns to implement evidence-based treatment, particularly in patients who have been previously treated unsuccessfully. However, due to the limited number of isolates studied in this report, the epidemiologic significance of these findings remains to be confirmed. Large-scale surveillance studies are necessary to understand the burden of H. pylori infection and pathogenicity, investigate the associations between gastric diseases and virulence determinants, monitor the future evolution of AMR, and update eradication treatment policies.

CRediT authorship contribution statement

Marwan Osman: Writing – original draft, Visualization, Validation, Software, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Rayane Rafei: Writing – original draft, Validation, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Kevin J. Cummings: Writing – review & editing, Supervision, Investigation. Wassim Rafei: Resources, Investigation. Joseph Awada: Resources, Investigation. Hayssam Moubayed: Resources, Investigation. Farah Majzoub: Resources, Investigation. Hassan Mallat: Resources, Investigation. Fouad Dabboussi: Writing – review & editing, Software, Methodology, Investigation, Formal analysis. Monzer Hamze: Writing – review & editing, Validation, Supervision, Software, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Informed consent

All patients completed a written informed consent document before participating in the study and after being informed of the research objectives.

Organ donation

Not applicable.

Ethics statement

The study protocol has been approved by the AZM Center/Lebanese University Ethical Committee before commencement (approval number CE-EDST-4-2017), authorized by the Lebanese Ministry of Public Health.

Data availability statement

Raw data collected during the study and all code necessary to replicate the analysis are available at the data repository Figshare (DOI: 10.6084/m9.figshare.21899010).

Animal treatment

Not applicable.

Generative AI

Not applicable.

Funding

This work was supported by a grant from the Lebanese National Council for Scientific Research (CNRS-L Grant Research Program-2017) and the Lebanese University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Declaration of competing interest

The authors declare no conflict of interest.

Acknowledgments

The authors would like to thank Assma Allouch, Taha Abdo, and all the Laboratoire Microbiologie Santé et Environnement (LMSE) staff for their excellent technical assistance.

Contributor Information

Marwan Osman, Email: marwan.osman@yale.edu, mo368@cornell.edu.

Monzer Hamze, Email: mhamze@ul.edu.lb.

References

  • 1.Yang L., Kartsonaki C., Yao P., et al. The relative and attributable risks of cardia and non-cardia gastric cancer associated with Helicobacter pylori infection in China: a case-cohort study. Lancet Public Health. 2021;6(12):e888–e896. doi: 10.1016/S2468-2667(21)00164-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Salvatori S., Marafini I., Laudisi F., et al. Helicobacter pylori and gastric cancer: pathogenetic mechanisms. Int J Mol Sci. 2023;24(3):2895. doi: 10.3390/ijms24032895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Morgan E., Arnold M., Camargo M.C., et al. The current and future incidence and mortality of gastric cancer in 185 countries, 2020–40: a population-based modelling study. EClinicalMedicine. 2022;47 doi: 10.1016/j.eclinm.2022.101404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tsai M.F., Miller C. Substrate selectivity in arginine-dependent acid resistance in enteric bacteria. Proc Natl Acad Sci U S A. 2013;110(15):5893–5897. doi: 10.1073/pnas.1301442110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Padra M., Benktander J., Robinson K., et al. Carbohydrate-dependent and antimicrobial peptide defence mechanisms against Helicobacter pylori infections. Curr Top Microbiol Immunol. 2019;421:179–207. doi: 10.1007/978-3-030-15138-6_8. [DOI] [PubMed] [Google Scholar]
  • 6.Alzahrani S., Lina T.T., Gonzalez J., et al. Effect of Helicobacter pylori on gastric epithelial cells. World J Gastroenterol. 2014;20(36):12767–12780. doi: 10.3748/wjg.v20.i36.12767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ansari S., Yamaoka Y. Helicobacter pylori virulence factors exploiting gastric colonization and its pathogenicity. Toxins. 2019;11(11):677. doi: 10.3390/toxins11110677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sharndama H.C., Mba I.E. Helicobacter pylori: an up-to-date overview on the virulence and pathogenesis mechanisms. Braz J Microbiol. 2022;53(1):33–50. doi: 10.1007/s42770-021-00675-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bridge D.R., Merrell D.S. Polymorphism in the Helicobacter pylori CagA and VacA toxins and disease. Gut Microbes. 2013;4(2):101–117. doi: 10.4161/gmic.23797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Shirani M., Pakzad R., Haddadi M.H., et al. The global prevalence of gastric cancer in Helicobacter pylori-infected individuals: a systematic review and meta-analysis. BMC Infect Dis. 2023;23(1):543. doi: 10.1186/s12879-023-08504-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dascălu R.I., Bolocan A., Păduaru D.N., et al. Multidrug resistance in Helicobacter pylori infection. Front Microbiol. 2023;14 doi: 10.3389/fmicb.2023.1128497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Savoldi A., Carrara E., Graham D.Y., et al. Prevalence of antibiotic resistance in Helicobacter pylori: a systematic review and meta-analysis in World Health Organization regions. Gastroenterology. 2018;155(5):1372–1382. doi: 10.1053/j.gastro.2018.07.007. .e17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gareayaghi N., Kocazeybek B. Detection of A2143G, A2142C, and A2142G point mutations with real-time PCR in stool specimens from children infected with Helicobacter pylori. Diagnostics. 2022;12(9):2119. doi: 10.3390/diagnostics12092119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sharara A.I., Chedid M., Araj G.F., et al. Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxycillin and tetracycline in Lebanon. Int J Antimicrob Agents. 2002;19(2):155–158. doi: 10.1016/s0924-8579(01)00482-4. [DOI] [PubMed] [Google Scholar]
  • 15.Jehanne Q., Bénéjat L., Mégraud F., et al. Evaluation of the Allplex™ H pylori and ClariR PCR assay for Helicobacter pylori detection on gastric biopsies. Helicobacter. 2020;25(4) doi: 10.1111/hel.12702. [DOI] [PubMed] [Google Scholar]
  • 16.Yamaoka Y., Osato M.S., Sepulveda A.R., et al. Molecular epidemiology of Helicobacter pylori: separation of H. pylori from East Asian and non-Asian countries. Epidemiol Infect. 2000;124(1):91–96. doi: 10.1017/s0950268899003209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Schmidt H.A., Goh K.L., Fock K.M., et al. Distinct cagA EPIYA motifs are associated with ethnic diversity in Malaysia and Singapore. Helicobacter. 2009;14(4):256–263. doi: 10.1111/j.1523-5378.2009.00684.x. [DOI] [PubMed] [Google Scholar]
  • 18.Atherton J.C., Cao P., Jr Peek RM, et al. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific VacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270(30):17771–17777. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
  • 19.Yamaoka Y., Kodama T., Gutierrez O., et al. Relationship between Helicobacter pylori iceA, cagA, and VacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999;37(7):2274–2279. doi: 10.1128/JCM.37.7.2274-2279.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jung S.W., Sugimoto M., Shiota S., et al. The intact dupA cluster is a more reliable Helicobacter pylori virulence marker than dupA alone. Infect Immun. 2012;80(1):381–387. doi: 10.1128/IAI.05472-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hemmatinezhad B., Momtaz H., Rahimi E. VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of Helicobacter pylori isolated from various types of ready to eat foods. Ann Clin Microbiol Antimicrob. 2016;15:2. doi: 10.1186/s12941-015-0115-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ismail M.B., Osman M., Bou Raad E., et al. Seroprevalence of Helicobacter pylori among dyspeptic patients in northern Lebanon: a 6-year retrospective study in two tertiary hospitals. Access Microbiol. 2022;4(4):000337. doi: 10.1099/acmi.0.000337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Khoder G., Mina S., Mahmoud I., et al. Helicobacter pylori infection in Tripoli, north Lebanon: assessment and risk factors. Biology. 2021;10(7):599. doi: 10.3390/biology10070599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ménard A., Santos A., Mégraud F., et al. PCR-restriction fragment length polymorphism can also detect point mutation A2142C in the 23S rRNA gene, associated with Helicobacter pylori resistance to clarithromycin. Antimicrob Agents Chemother. 2002;46(4):1156–1157. doi: 10.1128/AAC.46.4.1156-1157.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Albasha A.M., Elnosh M.M., Osman E.H., et al. Helicobacter pylori 23S rRNA gene A2142G, A2143G, T2182C, and C2195T mutations associated with clarithromycin resistance detected in Sudanese patients. BMC Microbiol. 2021;21(1):38. doi: 10.1186/s12866-021-02096-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Malfertheiner P., Megraud F., O’Morain C.A., et al. Management ofHelicobacter pyloriinfection—The maastricht V/Florence consensus report. Gut. 2017;66(1):6–30. doi: 10.1136/gutjnl-2016-312288. [DOI] [PubMed] [Google Scholar]
  • 27.Osman M., Cummings K.J., El Omari K., et al. Catch-22: war, refugees, COVID-19, and the scourge of antimicrobial resistance. Front Med. 2022;9 doi: 10.3389/fmed.2022.921921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Osman M., Yassine I., Hamze M., et al. Emergence of extended-spectrum cephalosporin- and colistin-resistant enterobacterales in otherwise healthy university students. Microb Drug Resist. 2024;30(2):101–107. doi: 10.1089/mdr.2023.0213. [DOI] [PubMed] [Google Scholar]
  • 29.Osman M., Daaboul D., Tajani A.G., et al. Multidrug-resistant pathogens contaminate river water used in irrigation in disenfranchised communities. J Glob Antimicrob Resist. 2024;36:175–180. doi: 10.1016/j.jgar.2023.12.016. [DOI] [PubMed] [Google Scholar]
  • 30.Osman M., Kassem I.I., Dabboussi F., et al. The indelible toll of enteric pathogens: prevalence, clinical characterization, and seasonal trends in patients with acute community-acquired diarrhea in disenfranchised communities. PLoS One. 2023;18(3) doi: 10.1371/journal.pone.0282844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Thi Huyen Trang T., Thanh Binh T., Yamaoka Y. Relationship between VacA types and development of gastroduodenal diseases. Toxins. 2016;8(6):182. doi: 10.3390/toxins8060182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pajavand H., Alvandi A., Mohajeri P., et al. High frequency of VacA s1m2 genotypes among Helicobacter pylori isolates from patients with gastroduodenal disorders in Kermanshah, Iran. Jundishapur J Microbiol. 2015;8(11) doi: 10.5812/jjm.25425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Al-Hyassat M.M., Al-Daghistani H.I., Abu-Niaaj L.F., et al. Allelic variation of Helicobacter pylori VacA gene and its association with gastric pathologies in clinical samples collected in Jordan. Microorganisms. 2025;13(8):1841. doi: 10.3390/microorganisms13081841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Boukhris S.A., Benajah D.A., El Rhazi K., et al. Prevalence and distribution of Helicobacter pylori cagA and VacA genotypes in the Moroccan population with gastric disease. Eur J Clin Microbiol Infect Dis. 2012;31(8):1775–1781. doi: 10.1007/s10096-011-1501-x. [DOI] [PubMed] [Google Scholar]
  • 35.Abdi E., Latifi-Navid S., Latifi-Navid H., et al. Helicobacter pylori vacuolating cytotoxin genotypes and preneoplastic lesions or gastric cancer risk: a meta-analysis. J Gastroenterol Hepatol. 2016;31(4):734–744. doi: 10.1111/jgh.13256. [DOI] [PubMed] [Google Scholar]
  • 36.Zhang B.B., Li Y., Liu X.Q., et al. Association between VacA genotypes and the risk of duodenal ulcer: a meta-analysis. Mol Biol Rep. 2014;41(11):7241–7254. doi: 10.1007/s11033-014-3610-y. [DOI] [PubMed] [Google Scholar]
  • 37.R Jouimyi M., Bounder G., Boura H., et al. The EPIYA-ABCC motif of Helicobacter pylori cagA gene and gastric carcinogenesis in Casablanca population. Afr H Sci. 2022;22(1):573–580. doi: 10.4314/ahs.v22i1.66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kalaf E.A., Al-Khafaji Z.M., Yassen N.Y., et al. Study of the cytoxin-associated gene a (CagA gene) in Helicobacter pylori using gastric biopsies of Iraqi patients. Saudi J Gastroenterol. 2013;19(2):69–74. doi: 10.4103/1319-3767.108474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Shokrzadeh L., Baghaei K., Yamaoka Y., et al. Analysis of 3’-end variable region of the cagA gene in Helicobacter pylori isolated from Iranian population. J Gastro And Hepatol. 2010;25(1):172–177. doi: 10.1111/j.1440-1746.2009.05979.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hanafiah A., Lopes B.S. Genetic diversity and virulence characteristics of Helicobacter pylori isolates in different human ethnic groups. Infect Genet Evol. 2020;78 doi: 10.1016/j.meegid.2019.104135. [DOI] [PubMed] [Google Scholar]
  • 41.Ansari S., Yamaoka Y. Helicobacter pylori infection, its laboratory diagnosis, and antimicrobial resistance: a perspective of clinical relevance. Clin Microbiol Rev. 2022;35(3) doi: 10.1128/cmr.00258-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li Q.P., Liu J.W., Gong Y.H., et al. Association of CagA EPIYA-D or EPIYA-C phosphorylation sites with peptic ulcer and gastric cancer risks: a meta-analysis. Medicine. 2017;96(17):e6620. doi: 10.1097/MD.0000000000006620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Talebi Bezmin Abadi A., Perez-Perez G. Role ofdupAin virulence ofHelicobacter pylori. World J Gastroenterol. 2016;22(46) doi: 10.3748/wjg.v22.i46.10118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Paredes-Osses E., Sáez K., Sanhueza E., et al. Association between cagA, vacAi, and dupA genes of Helicobacter pylori and gastroduodenal pathologies in Chilean patients. Folia Microbiol. 2017;62(5):437–444. doi: 10.1007/s12223-017-0514-y. [DOI] [PubMed] [Google Scholar]
  • 45.Abu-Taleb A.M.F., Abdelattef R.S., Abdel-Hady A.A., et al. Prevalence of Helicobacter pylori cagA and iceA genes and their association with gastrointestinal diseases. Int J Microbiol. 2018;2018 doi: 10.1155/2018/4809093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Liu J.W., He C.Y., Chen M.Y., et al. Association of presence/absence and on/off patterns of Helicobacter pylori oipA gene with peptic ulcer disease and gastric cancer risks: a meta-analysis. BMC Infect Dis. 2013;13:555. doi: 10.1186/1471-2334-13-555. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Raw data collected during the study and all code necessary to replicate the analysis are available at the data repository Figshare (DOI: 10.6084/m9.figshare.21899010).

Articles from Infectious Medicine are provided here courtesy of Elsevier

RESOURCES