IRAK1 promotes gastric cancer progression by activating the PI3K/AKT/mTOR pathway and inducing the M2 polarization of tumor-associated macrophages

Abstract

Background:

Interleukin-1 receptor-associated kinase 1 (IRAK1), an active serine/threonine kinase, is an indispensable mediator of inflammatory responses and innate immunity. Emerging evidence has highlighted the oncogenic role of IRAK1 in tumors. However, the role of IRAK1 in gastric cancer (GC) progression remains unclear.

Methods:

IRAK1 expression levels in patients with GC at Peking Union Medical College Hospital were assessed by Western blotting, quantitative real-time polymerase chain reaction, and immunohistochemistry. To elucidate the role of IRAK1 in GC pathogenesis, we established GC cells with clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) mediated IRAK1 knockout and lentiviral vector-mediated IRAK1 overexpression and subsequently conducted in vitro and in vivo experiments. Additionally, we assessed the effect of IRAK1 expression levels in GC cells on the M2 polarization of tumor-associated macrophages (TAMs) via a Transwell coculture system. Functional assays were subsequently carried out to determine whether IRAK1 regulates the proliferation, invasion, and epithelial-mesenchymal transition (EMT) of GC cells through the induction of TAM M2 polarization and to clarify the associated regulatory mechanisms.

Results:

IRAK1 expression was progressively increased during GC progression. Clinicopathological feature analysis revealed that high IRAK1 expression predicted poor survival outcomes. In vitro and in vivo experiments revealed that IRAK1 was highly expressed in GC cells and facilitated the proliferation, migration, invasion, and EMT of GC cells via the phosphatidylinositol 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) pathway. More interestingly, IRAK1 affected the malignant biological behavior of GC cells by inducing M2-like polarization of macrophages. Mechanistically, coculturing M0 macrophages with IRAK1-knockout GC cells suppressed interleukin (IL)-8 secretion, thereby inhibiting Janus kinase 2/signal transducer and activator of transcription 3 (JAK2/STAT3) pathway activation in TAMs. Inactivation of the JAK2/STAT3 pathway suppressed the M2 polarization of TAMs, ultimately inhibiting GC progression.

Conclusions:

IRAK1 influences the malignant biological behavior of GC cells by activating the PI3K/AKT/mTOR pathway and inducing the M2-like polarization of macrophages via the IL-8/JAK2/STAT3 pathway in TAMs. Our findings provide a novel diagnostic biomarker and a promising therapeutic strategy for GC.

Introduction

Gastric cancer (GC) is a prevalent malignant tumor worldwide that seriously threatens the quality of life and longevity of humans. Because of the absence of obvious symptoms and specific and sensitive biomarkers, the early diagnosis of GC remains challenging.^[1] Consequently, the majority of patients with GC are diagnosed at advanced stages, resulting in poor treatment outcomes.^[2,3] Despite remarkable advances in GC treatments, the five-year overall survival rate of patients with GC remains less than 30%.^[4,5] Consequently, it is imperative to elucidate the pathogenesis of GC and identify effective therapeutic targets.

The tumor microenvironment (TME) refers to a complex ecosystem surrounding tumor cells and consists of extracellular components, immune cells, and stromal cells, such as tumor-infiltrating lymphocytes, tumor-associated macrophages (TAMs), endothelial cells, and fibroblasts.^[6,7] Over the past decade, researchers have gradually revealed that immune cells within the TME significantly affect tumor progression.^[6,8] TAMs, which are recruited from circulating monocytes to tumors, constitute the most abundant immune cell population in the TME.^[9,10] As the pivotal cells in the TME, TAMs play an indispensable role in tumor growth, immune regulation, and metastasis.^[11,12] Depending on their phenotype, TAMs can either hinder or foster the development of tumors. Typically, TAMs exist in two polarization states: the proinflammatory M1 phenotype and the anti-inflammatory M2 phenotype.^[13] M1 macrophages exert tumor-suppressive effects by producing interferon (IFN)-γ, interleukin (IL)-12, and IL-6. In contrast, M2 macrophages exert tumor-supportive effects by producing transforming growth factor (TGF)-β, IL-13, and IL-10.^[14] Emerging evidence has revealed that M1 macrophages can transform into M2 macrophages within the TME during tumor progression.^[15] Dynamic changes between M1 and M2 macrophages are highly important in GC. Additionally, M2-polarized TAMs are correlated with poor prognosis in patients with multiple tumors, indicating that M2 macrophages are promising targets for immunotherapy.^[16–18] Therefore, exploring the molecular mechanism of M2 macrophage polarization in the GC microenvironment is crucial.

Interleukin-1 receptor-associated kinase 1 (IRAK1), the first member of the IRAK family, is an essential mediator of inflammatory responses and innate immunity.^[19,20] As an active serine/threonine kinase, IRAK1 is deregulated in various tumors and is involved in tumorigenesis through multiple molecular mechanisms. Recently, the role of IRAK1 in the TME has received increasing attention. IRAK1 can induce the accumulation of myeloid-derived suppressor cells to enhance the immunosuppressive microenvironment, resulting in leukemia progression.^[21] Furthermore, Wang et al^[22] revealed that miR-192-5p-modified TAM-derived exosomes can inhibit the epithelial-mesenchymal transition (EMT) process of tumor cells through modulating the IRAK1/nuclear factor kappa B (NF-κB) axis. Mahmoud et al^[23] reported that the inhibition of IRAK1 could reduce the production of cytokines (such as IL-10 and tumor necrosis factor [TNF]-α) in macrophages, therefore suppressing the growth of tumor cells. However, it remains unknown whether IRAK1 facilitates the development of GC via inducing the polarization of M2 macrophages.

Recently, accumulating research showed that M2-type macrophage polarization is related to the Janus kinase 2/signal transducer and activator of transcription 3 (JAK2/STAT3) pathway inhibition or activation. For example, He et al^[24] discovered that the inhibition of JAK2/STAT3 pathway induced macrophage polarization toward the M1 phenotype. Jiang et al^[25] revealed that PD-1 modulates M2 macrophages polarization and the production of IFN-γ signaling molecules via the JAK2/STAT3 pathway. Furthermore, Su et al^[26] found that maternal embryonic leucine zipper kinase (MELK) induced the polarization of M2 macrophages through the cytokines colony-stimulating factor 1 (CSF-1)/JAK2/STAT3 pathway in GC. However, it remains unknown whether IRAK1 induces the polarization of M2 macrophages via the JAK2/STAT3 pathway, therefore facilitating the development of GC.

In this study, IRAK1 was found to be highly expressed in GC tissues and related to poor patient prognosis. Mechanistically, IRAK1 affects the growth, apoptosis, migration, invasion, and EMT process of GC cells via the phosphatidylinositol 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) pathway both in vitro and in vivo. Furthermore, we demonstrated that IRAK1 facilitates GC progression not only through the activation of tumor cells but also through interactions with macrophages in the TME. Upregulated IRAK1 in GC could also facilitate the migration, invasion, and EMT process of GC cells via promoting the M2-like polarization of macrophages. These findings revealed a novel function of IRAK1 in tumor immunity, highlighting a potential strategy for macrophage-based therapy.

Methods

Clinical samples

In accordance with the Declaration of Helsinki, this study was approved by the Medical Ethics Review Board of Peking Union Medical College Hospital (No. KYC-IEC-2022-II-05). A total of 36 pairs of cancerous and adjacent noncancerous tissues were obtained from patients with GC at Peking Union Medical College Hospital. Thirty-two pairs of fresh tissues were stored in liquid nitrogen within 30 min postoperation for quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting (WB). The remaining four pairs of fresh tissue samples were subjected to single-cell and spatial transcriptomic analysis. All patients were pathologically diagnosed with GC and underwent gastrectomy without preoperative radiotherapy or chemotherapy. Furthermore, early GC, GC, noncancerous, low-, and high-grade gastric intraepithelial neoplasia tissues were formalin fixed and paraffin embedded for immunohistochemistry (IHC) detection. All patients included in the study provided written informed consent.

Analysis of single-cell and spatial transcriptomes

Single-cell sequencing data underwent standard preprocessing and quality control using the R package Seurat (Gikai gene, Shanghai, China), with intersample batch effects corrected via the Harmony algorithm. Malignant and normal cells were distinguished through copy number variation inference using the R package inferCNV. Spatial transcriptomic datasets were processed through Seurat-based normalization (sctransform algorithm), followed by spatial deconvolution to map cellular distributions. Regions were classified as having high malignant cell density or predominant stromal components based on inverse convolution-derived cell population gradients.

Furthermore, to identify the cellular composition within each spot in spatial transcriptomics data, robust cell type decomposition was applied to jointly analyze expression profiles derived from single-cell ribonucleic acid (RNA) sequencing. The gene expression profile of each spot is modeled as a linear combination of the constituent cell types. By leveraging the total RNA content per spot, a statistical fitting model was used to estimate the proportional contributions of each cell type, employing default parameters except for the “doublet_mode” setting, which was set to “full.” The deconvoluted cell type assignments show strong concordance with those identified in the reference single-cell dataset.

Cell culture

GC cells (MKN-45, HGC-27, AGS, MKN-7, and MKN-28) and THP-1 cells were purchased from ATCC (Manassas, VA, USA). AGS cells were cultured in F-12K medium (Gibco, USA). MKN-45, HGC-27, MKN-28, MKN-7, and THP-1 cells were cultured in RPMI-1640 medium (Gibco, USA). All culture media were supplemented with 10% fetal bovine serum (FBS) and penicillin–streptomycin (100 mg/mL). Cells were grown in an incubator containing 5% CO₂ at 37°C.

Stable cell lines transfection and clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) assay

CRISPR-Cas9-IRAK1 guide RNA (gRNA) and IRAK1 overexpression plasmids were synthesized from the Gikai gene (Shanghai, China). Following the manufacturer’s protocols, IRAK1-knockout cell lines (MKN-28 and AGS) and stable IRAK1-overexpressing cell lines (MKN-28 and HGC-27) were constructed through lentivirus infection and puromycin selection. Afterward, Sanger sequencing was performed to confirm that the cell lines grew from single-cell amplification in 96-well plates. WB and qRT-PCR further validated the expression levels of IRAK1 in these cell lines. The above cell lines were categorized into the following groups: control knockout group (NC), IRAK1 knockout group (KO-IRAK1), control overexpression group (NC-overexpression group), and IRAK1 overexpression group (OE-IRAK1).

Macrophage polarization, TAM construction, and enzyme-linked immunosorbent assay

To convert THP-1 cells into M0 macrophages, THP-1 cells were treated with phorbol 12-myristate 13-acetate (PMA)(100 ng/mL; Sigma, USA) for 48 hours. M0 macrophages were subsequently treated with l ipopolysaccharide (LPS) (100 ng/mL; MCE, USA) and IFN-γ (20 ng/mL; MCE) for 48 h and were then considered M1 macrophages. M0 macrophages were treated with IL-13 (20 ng/mL; MCE) and IL-4 (20 ng/mL; MCE, USA) for 48 h and were then considered M2 macrophages. Furthermore, Transwell chambers (0.4 μm pore size; Corning, USA) were used to construct THP-1-derived TAMs (TAM_AGS and TAM_MKN-28). M0 macrophages were cultured in six-well plates, while GC cells (AGS and MKN-28) (NC and KO-IRAK1 groups) were seeded into the upper chambers. After coculturing for 48 h, TAMs, conditioned supernatants, and cocultured GC cells were collected for further experiments.

Enzyme-linked immunosorbent assay (ELISA) was performed to evaluate the effect of IRAK1 on TAM-mediated cytotoxicity and cytokine secretion. Following the manufacturer’s instructions, IL-8 levels in GC cells and conditioned supernatants obtained from cocultures of GC cells and M0 macrophages were measured using an ELISA kit (RE2733H; Reed Biotech, China). The absorbance of the supernatant was read at 450 nm with a microplate reader.

qRT-PCR and WB

TRIzol reagent (Invitrogen, USA) was used to isolate total RNA from cells and tissues. Five microliters of RNA were diluted to a 1:10 ratio using RNase-free H₂O, and the RNA was subsequently detected at 260 nm and 280 nm to determine the concentration and purity of the RNA solution.Complementary DNA (cDNA) was synthesized by reverse transcription with SPARKscript II All-in-one RT SuperMix (SparkJade, China). Finally, qRT-PCR was conducted with the SPARKscript II One-Step RT-PCR Kit (SparkJade, China). The primer sequences are listed in Table 1. The expression levels of mRNA were calculated using the formula 2^−ΔΔCt.

Table 1.

The sequence of primers.

Primer	Forward (5′–3′)	Reverse (5′–3′)
IRAK1	AGCCCCTTCTTCTACCAA	CTCCTCCGAGAAGTTGTG
TNF-α	TCCAGGCGGTGCTTGTTC	TGGCAGGGGCTCTTGATG
ARG-1	GCCAAGTCCAGAACCATAG	TCCCCATAATCCTTCACAT
IL-6	CCCTGAGAAAGGAGACAT	CAAACTCCAAAAGACCAG
IL-10	GAGAACCAAGACCCAGAC	TTCACAGGGAAGAAATCG
iNOS	TGGGACCCGCACCACTAC	CTGCCGAGATTTGAGCCT
CD163	AGACTGTTAGGGAAGGTGT	GTGTTTGTTGCCTGGATT
CD206	CGAGGAAGAGGTTCGGTT	ACATTTGGGTTCGGGAGT
CD80	GTGTTTGTTGCCTGGATT	TTGCCAGTAGATGCGAGTT
IL-1β	GATGGCTTATTACAGTGGC	TAGTGGTGGTCGGAGATT
CD86	TCTGGTGCTGCTCCTCTGA	TTCCTGGTCCTGCCAAAAT
TGF-β	TCCACGGAGAAGAACTGC	CAGGCTCCAAATGTAGGG
GAPDH	ACAACAGCCTCAAGATCATCAGC	GCCATCACGCCACAGTTTCC

Total protein from cells and tissues was extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Ltd., China), and the protein concentration was measured using a bicinchoninic acid (BCA) kit (Beyotime Ltd.). Subsequently, the protein samples were denatured at 100°C for 5 min, separated by 8–12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred to polyvinylidene fluoride (PVDF) membranes. After blocking with 5% nonfat milk, the PVDF membranes were incubated overnight with primary antibodies (Proteintech, China), followed by incubation with anti-rabbit horseradish peroxidase (HRP) IgG (Sangon, China). Finally, an enhanced electrochemiluminescent (ECL) reagent (Sangon) was used to visualize the protein bands on the PVDF membranes.

Immunohistochemistry

IHC analysis was conducted on paraffin-embedded GC, noncancerous, low-grade and high-grade gastric intraepithelial neoplasia tissues. Paraffin-embedded tissue slides (4 μm) were deparaffinized and rehydrated, followed by antigen retrieval in 10 mmol/L citric acid and sodium citrate. After blocking with goat serum, the tissue slides were incubated overnight with primary antibodies against IRAK1 (Proteintech) at 4°C. The following day, the tissue slides were incubated with the secondary antibody (Proteintech) for 1 h after the primary antibody was removed. 3,3′-diaminobenzidine (DAB) reagent and a hematoxylin kit were used to visualize the tissue slides. The staining intensity was categorized as 0 (negative), 1 (weak), 2 (moderate), or 3 (strong). The staining area and intensity were independently evaluated by two clinical pathologists. H-score = Σ (Proportion of positive cells × Staining intensity).

Cell counting kit-8, colony formation, and 5-ethynyl-2′-deoxyuridine assays

Cell proliferation was detected using the cell counting kit (CCK)-8 and colony formation assays. Following the digestion and counting of the cells in each experimental group, the GC cells were cultured in 96-well plates. Each group comprised four time points, with three replicates at each time point. The next day, 10 μL of CCK-8 solution was added to each well and incubated at 37°C for 2 h. The optical density was measured at a wavelength of 450 nm. For the colony formation assay, GC cells were cultivated in six-well plates at a density of 500–1000 cells per well. The culture medium was replaced every three days. After approximately 2 weeks, the GC cells were fixed using 4% paraformaldehyde, and the formation of colonies was subsequently observed by staining with 0.5% crystal violet. Finally, the number of colonies was counted and photographed. An 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed on GC cells that were plated in 24-well plates and cultured overnight to allow adhesion. Following exposure to EdU-containing medium (50 μmol/L) for 2 hours, the cells underwent sequential processing: fixation with 4% paraformaldehyde (15 min), permeabilization using 0.5% Triton X-100 (10 min), exposure to Click-iT reaction mixture (100 μL, 30 min), and nuclear counterstaining with Hoechst 33342 (5 μg/mL, 30 min). Five representative fields per well were captured by fluorescence microscopy for quantitative analysis; EdU+/Hoechst+ double-positive cells were defined as proliferating cells using ImageJ particle analysis.

Wound healing and Transwell assays

Cell migration and invasion capacities were assessed using wound healing and Transwell assays. For the wound healing assay, GC cells were grown to full confluence in six-well plates, after which the culture medium was removed. Linear wounds were created on the surface of the GC cells using a 200 μL pipette tip. The GC cells were then incubated in 2 mL of serum-free medium, and images of the scratches were captured at 0 and 24 hours. For the Transwell assays, chambers that were uncoated (for the migration assays) or precoated with diluted Matrigel (for the invasion assays) were placed in 24-well plates. Two hundred microliters of serum-free medium containing 5×10⁴ GC cells was added to the upper chamber, while the lower chamber was filled with 800 µL of culture media supplemented with 15% FBS. After incubation for 48 h, the migrating or invading cells were fixed (4% paraformaldehyde, 30 min), stained with crystal violet (10 min), and photographed using a microscope.

Flow cytometry

Flow cytometry analysis was used to assess apoptosis, the cell cycle, and macrophage polarization. To assess apoptosis, GC cells were collected, washed with phosphate buffered saline (PBS), and resuspended in 1×binding buffer. The suspension of GC cells was subsequently incubated with 5 μL of 7-Aminoactinomycin D (7-ADD) and 5 μL of Annexin V-Allophycocyanin (Annexin V-APC) for 30 min in the dark. Annexin-V⁺ cells were identified as apoptotic cells using flow cytometry analysis. For the cell cycle, GC cells were washed with PBS and fixed with prechilled 70% alcohol. After 24 h of incubation at 4°C, the GC cells were stained with RNase A (10 mg/mL) and propidium iodide (PI, 0.5 mg/mL). The stained cells were analyzed via flow cytometry. For macrophage polarization analysis, GC cells were suspended in PBS and stained for cell surface markers with APC-conjugated antibodies, phycoerythrin (PE), and fluorescein isothiocyanate (‌FITC). Isotype control and unstained cells were used as controls. The expression of CD86 (M1 macrophage marker; Elabscinence E-AB-F1012D, China), CD206 (M2 macrophage marker; Elabscinence E-AB-F1161E, China), and CD11b (nonspecific macrophage marker; Elabscinence E-AB-F1146C, China) was subsequently detected with a flow cytometer (BD Bioscience, USA).

A flow cytometry bead-based assay was carried out to evaluate the effect of IRAK1 on cytokine secretion. The supernatants from GC cells (NC and KO-IRAK1 groups) were collected and incubated with specific antibodies for 30 min. The samples were subsequently incubated with the fluorescent solution for 15 min in the dark. The concentrations of 12 cytokines in the supernatants were quantitatively analyzed using a flow cytometry bead-based assay (ABplex-100, ABclonal, Wuhan, China). The 12 cytokines analyzed included TNF-α, interleukin-12 protein 70 (IL-12P70), IFN-γ, IL-17A, IL-5, IL-8, IFN-α, IL-6, IL-10, IL-2, IL-4, and IL-1β.

Animal experiments

To investigate the tumorigenic effect of IRAK1, xenograft tumors were established in severe immunodeficient mice. NOD/Prkdcscid /IL2rgnull (NPG) mice (4 weeks old, female) were obtained from Charles River (Beijing, China). All the mice were randomly allocated to four groups: the NC group (n = 5), KO-IRAK1 group (n = 5), NC-overexpression group (n = 6), and OE-IRAK1 group (n = 6). Subsequently, 2 × 10⁶ MKN-28 cells in 100 μL of sterile PBS were inoculated subcutaneously into the flanks of the mice. The body weight and tumor size of NPG mice were assessed every 5 days, and the mice were euthanized after 7 weeks. To further detect the differential expression of IRAK1, E-cadherin, and N-cadherin, the subcutaneously transplanted tumors were removed for qRT-PCR, WB, and IHC analysis. Tumor size was calculated using the following formula: 0.5 × width² × length. All animal experiments were approved by the Animal Ethics Committee of Peking Union Medical College Hospital (No. XHDW-2024-102).

Statistical analysis

All experiments were independently carried out in triplicate. Statistical analyses were conducted using Student’s t-test or one-way analysis of variance (ANOVA), with all computations executed through GraphPad Prism9.5 Software (GraphPad, Boston, MA, USA). Statistical significance was defined as a P-value of less than 0.05.

Results

IRAK1 is highly expressed in GC tissues

Single-cell and spatial transcriptomic analysis revealed that IRAK1 expression was markedly elevated in annotated regions, especially in GC tissues compared with adjacent noncancerous tissues [Figure 1A]. To explore the role of IRAK1 in GC, we also examined differences in IRAK1 expression between tumor and normal samples via the Gene Expression Profiling Interactive Analysis (GEPIA) and University of Alabama at Birmingham Cancer Data Analysis Portal (UALCAN) online databases. IRAK1 expression was markedly upregulated in stomach adenocarcinoma [Figure 1B and C]. We also examined IRAK1 expression in 32 paired GC and adjacent noncancerous tissues by WB and qRT-PCR, which revealed that IRAK1 protein and mRNA were highly expressed in tumor tissues [Figure 1D]. In GC cells, IRAK1 expression is comparatively lower in HGC-27, whereas it was significantly higher in MKN-28 and AGS cells [Figure 1E]. At the protein level, IRAK1 expression was significantly greater in GC tissues than in noncancerous tissues. IRAK1 expression gradually increased from noncancerous, low-grade, and high-grade gastric intraepithelial neoplasia tissues, early GC to GC tissues [Figure 1F]. We further analyzed the clinical significance of IRAK1 via an IHC assay. Highly expressed IRAK1 was positively correlated with tumor size, grade, stage, and T stage [Table 2]. The above findings suggested that upregulated IRAK1 might promote GC progression.

Figure 1.

The expression of IRAK1 in GC. (A) Single-cell and spatial transcriptomic analyses revealed the distribution and abundance of IRAK1 in GC tissues. (B) The detection of IRAK1 in tumors based on the GEPIA database. (C) The detection of IRAK1 in GC based on the UALCAN database. (D) WB and qRT-PCR were used to measure the expression of IRAK1 in GC tissues. (E) WB and qRT-PCR assays were used to measure the expression of IRAK1 in GC cells. (F) IHC analysis of IRAK1 expression in noncancerous, low- and high-grade gastric intraepithelial neoplasia, and GC tissues. ^*P <0.05, ^†P <0.01, and ^‡P <0.001. AGC: Advanced gastric cancer; EGC: Early gastric cancer; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; GEPIA: Gene Expression Profiling Interactive Analysis; HGIN: High-grade gastric intraepithelial neoplasia; IHC: Immunohistochemistry; IRAK1: Interleukin-1 receptor-associated kinase 1; LGIN: Low-grade gastric intraepithelial neoplasia; mRNA: Messenger RNA; MW: Molecular weight; qRT-PCR: Quantitative real-time polymerase chain reaction; STAD: STomach ADenocarcinoma; TCGA: The Cancer Genome Atlas; UALCAN: University of Alabama at Birmingham Cancer Data Analysis Portal; WB: Western blotting.

Table 2.

Analysis of IRAK1 expression in GC tissues and its association with clinicopathological parameters.

Characteristics	IRAK1 Expression (H-score)	P values
Gender		0.2982
Male	86.50 ± 20.84
Female	79.00 ± 11.01
Age (years)		0.1054
≥60	87.27 ± 18.04
<60	75.00 ± 16.90
Tumor size		0.0417
≥5 cm	90.77 ± 17.54
<5 cm	77.65 ± 16.02
Grade		0.0439
Low	89.44 ± 13.92
High	75.83 ± 21.51
Stage		0.0071
I+II	75.33 ± 15.52
III+IV	92.67 ± 17.10
T stage		0.0171
T1+T2	73.00 ± 14.18
T3+T4	89.50 ± 17.91
N stage		0.1137
N0	77.50 ± 20.06
N1+N2+N3	88.33 ± 16.18

Data are presented as mean ± standard deviation. GC: Gastric cancer; IRAK1: Interleukin-1 receptor-associated kinase 1.

IRAK1 affects the proliferation, apoptosis, migration, and invasion of GC cells

To determine whether IRAK1 affects the malignant biological behavior of GC cells, MKN-28 and AGS cells were utilized to establish stable IRAK1-knockout cell lines using CRISPR-Cas9. The knockout efficiency in GC cells was confirmed via WB assays [Figure 2A]. Knockout of IRAK1 significantly suppressed the proliferation of GC cells, as determined by CCK-8, EdU, and colony formation assays [Figure 2B–2D]. Flow cytometry analysis also revealed that IRAK1 knockout could lead to G1 phase cell cycle arrest, therefore inhibiting GC cell proliferation [Figure 2E]. Stable IRAK1-overexpressing MKN-28 and HGC-27 cell lines were subsequently established by lentivirus infection and puromycin selection. WB confirmed the substantial transfection efficiency of the lentivirus [Figure 2F]. In contrast, IRAK1 overexpression had the opposite effect on the proliferation of GC cells [Figure 2G–2J]. To assess the effect of IRAK1 on apoptosis, we conducted flow cytometry with 7-ADD and Annexin V-APC staining. The results revealed that the knockout of IRAK1 resulted in a significant increase in apoptosis rates [Figure 3A]. Furthermore, we performed wound healing, Transwell, and WB assays to evaluate the impact of IRAK1 on GC metastasis. The results revealed that IRAK1 knockout suppressed the migration and invasion of GC cells [Figure 3C–3F]. Moreover, IRAK1 knockout downregulated N-cadherin and upregulated E-cadherin, therefore suppressing the EMT process in GC cells [Figure 3G]. Conversely, upregulated IRAK1expression had the opposite effect on GC cells [Figure 3B, D, F, and H]. Taken together, these findings demonstrated the tumor-promoting effect of IRAK1 on GC progression.

Figure 2.

IRAK1 affects the proliferation of GC cells. (A and F) Detection of knockdown and overexpression efficiency in GC cells. (B and G) A CCK-8 assay was used to assess the growth of the GC cells. (C and H) An EdU assay was used to investigate the effect of IRAK1 on the proliferation of GC cells.(D and I) The proliferation capacity of GC cells was evaluated by a colony formation assay. (E and J) The progression of GC cell cycles was evaluated by flow cytometry analysis.^*P <0.05, ^†P <0.01, and ^‡P <0.001. CCK-8: Cell counting kit-8; DAPI: 4′,6-diamidino-2-phenylindole; EdU: 5-Ethynyl-2′-deoxyuridine; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; IRAK1: Interleukin-1 receptor-associated kinase 1; KO: Knockout; MW: Molecular weight; NC: Normal control; OD: Optical density; OE: Overexpression.

Figure 3.

IRAK1 affects the migration and invasion capabilities of GC cells. (A and B) The apoptosis of GC cells was evaluated by flow cytometry analysis. (C and D) A wound healing assay was used to detect the migratory ability of GC cells. (E and F) The invasive ability of GC cells was assessed via a Transwell assay. (G and H) Key EMT-associated markers (E-cadherin and N-cadherin) were detected in GC cells. ^*P <0.05, ^†P <0.01, and ^‡P <0.001. 6-AAD: 6-Aminoactinomycin D; APC: Allophycocyanin; EMT: Epithelial–mesenchymal transition; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; IRAK1: Interleukin-1 receptor-associated kinase 1; KO: Knockout; MW: Molecular weight; NC: Normal control; OE: Overexpression.

IRAK1 promotes the PI3K/AKT/mTOR pathway in GC

It has been reported that IRAK1 could stimulate the mitogen-activated protein kinase (MAPK) pathways. Meanwhile, MAPK and PI3K/AKT/mTOR pathways frequently coactivate in tumors. Therefore, we hypothesized that IRAK1 exerts its oncogenic effects in GC partially through the PI3K/AKT/mTOR pathway. To test this hypothesis, we investigated alterations in key components of the PI3K/AKT/mTOR pathway following both the upregulation and downregulation of IRAK1 expression. WB analysis demonstrated that IRAK1 knockout resulted in a marked reduction in the expression of p-PI3K, p-AKT, and p-mTOR in GC cells. Conversely, IRAK1 overexpression significantly elevated the levels of these phosphorylated proteins [Figure 4A and B]. To elucidate the modulatory role of the PI3K/AKT/mTOR signaling pathway in IRAK1-induced malignancy in GC cells, we evaluated the effects of the PI3K agonist 740Y-P. We introduced 740Y-P into the culture medium of both the NC and KO-IRAK1 groups and subsequently evaluated alterations in cell proliferation, apoptosis, migration, invasion, and EMT. CCK-8, EdU, colony formation, and cell cycle assays revealed that IRAK1 downregulation significantly inhibited GC cell proliferation, an effect that was partially reversed by 740Y-P treatment [Figure 4C–F]. Similarly, flow cytometry analysis revealed that 740Y-P alleviated the promoting effect of IRAK1 knockout on apoptosis [Figure 4G]. Wound healing and Transwell invasion assays demonstrated that 740Y-P alleviated the inhibitory effect of IRAK1 silencing on cell migration and invasion [Figure 4H and I]. Furthermore, WB analysis revealed that 740Y-P treatment reversed the downregulation of N-cadherin expression and the upregulation of E-cadherin expression, all of which were induced by IRAK1 silencing [Figure 4J]. In conclusion, our findings support that IRAK1 promotes GC progression by modulating the PI3K/AKT/mTOR pathway.

Figure 4.

IRAK1 regulates GC progression via the PI3K/AKT/mTOR pathway. (A and B) Measurement of p-PI3K, p-AKT, p-mTOR, PI3K, AKT, and mTOR protein levels in GC cells. (C, D, and E) The proliferative ability of GC cells was detected to assess the effects of the PI3K agonist 740Y-P via CCK-8, EdU, and colony formation assays. (F and G) The cycle and apoptosis of GC cells was performed to evaluate the effects of the PI3K agonist 740Y-P by the flow cytometry analysis. (H) A wound healing assay was performed to determine the effects of 740Y-P on the migration of GC cells. (I) Transwell assays were conducted to assess the effects of 740Y-P on the migration and invasion of GC cells. (J) The effects of 740Y-P on the EMT process in GC cells were determined by WB. ^*P <0.05, ^†P <0.01, and ^‡P <0.001. 6-AAD: 6-Aminoactinomycin D; APC: Allophycocyanin; AKT: Protein kinase B; CCK-8: Cell counting kit-8; DMSO: Dimethyl sulfoxide; EdU: 5-Ethynyl-2′-deoxyuridine; EMT: Epithelial-mesenchymal transition; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; IRAK1: Interleukin-1 receptor-associated kinase 1; mTOR: Mammalian target of rapamycin; KO: Knockout; MW: Molecular weight; NC: Normal control; OE: Overexpression; PI3K/AKT/mTOR: Phosphatidylinositol 3-kinase/protein kinase B/mammalian target of rapamycin; p-AKT: Phospho-protein kinase B; p-mTOR: Phospho-mammalian target of rapamycin; PI3K: Phosphatidylinositol 3-kinase; p-PI3K: Phospho-phosphatidylinositol 3-kinase.

IRAK1 regulates the polarization of M2 macrophages

In vitro, we used THP-1 cells to construct M0, M1, and M2 macrophages and TAMs. qRT-PCR assays revealed that M2 macrophage markers (CD206, IL-10, TGF-β, CD163, and Arginase-1) were highly expressed in M2 macrophages and TAMs. Meanwhile, M1 macrophage markers (CD80, CD86, TNF-ɑ, iNOS, IL-1β and IL-6) were highly expressed in M1 macrophages [Figure 5A]. Flow cytometric analysis revealed an increased percentage of CD206⁺ cells among M2 macrophages and TAMs and an increased percentage of CD86⁺ cells among M1 macrophages [Figure 5B]. The above results indicated that M0, M1, M2, and TAMs were successfully polarized in vitro and that the phenotypic characteristics of TAMs are similar to those of M2-type macrophages. To further explore the effect of IRAK1 on the M2 polarization of TAMs, we differentiated THP-1 cells into M0 macrophages and cocultured them with NC and KO-IRAK1 GC cells (AGS and MKN-28) [Figure 6A]. qRT-PCR assays revealed that the expression of M2 macrophage markers, including CD206, IL-10, TGF-β, CD163, and Arginase-1, was decreased in KO-IRAK1 GC cells constructed from TAMs [Figure 6B]. WB further verified that knockout of IRAK1 in GC led to the downregulation of M2 macrophage markers (CD206 and Arginase-1) in cocultured macrophages [Figure 6C]. Flow cytometric analysis revealed that the percentage of CD206⁺ M2 macrophages was decreased among the macrophages cocultured with KO-IRAK1 GC cells [Figure 6D].

Figure 5.

Generation and authentication of M0, M1, and M2 macrophages and TAMs. (A and B) qRT-PCR and flow cytometric analyses were performed to identify M1 and M2 macrophage marker expression in M0, M1, M2, and TAMs. ^*P <0.001. ARG-1: Arginase-1; IL: Interleukin; iNOS: Inducible nitric oxide synthase; mRNA: Messenger RNA; qRT-PCR: Quantitative real-time polymerase chain reaction; TAMs: Tumor-associated macrophages; TGF-β: Transforming growth factor-beta; TNF-α: Tumor necrosis factor-alpha.

Figure 6.

IRAK1 affects the proliferation, migration, and invasion of GC cells via M2 polarization of TAMs. (A) The construction of TAMs. (B) qRT–PCR was conducted to identify M1 and M2 macrophage marker expression in THP-1-derived TAMs after silencing IRAK1. (C) WB was conducted to identify M1 and M2 macrophage marker expression in THP-1-derived TAMs after silencing IRAK1. (D) Flow cytometric analysis was conducted to identify M1 and M2 macrophage marker expression in THP-1-derived TAMs after silencing IRAK1. (E) The effect of M2 polarization of TAMs on the proliferative ability of GC cells was assessed via a CCK-8 assay. (F) The effect of M2 polarization of TAMs on the migration and invasion of GC cells was assessed via a Transwell assay. (G) WB was carried out to evaluate the effect of M2 polarization of TAMs on the EMT process in GC cells. ^*P <0.05, ^†P <0.01, and ^‡P <0.001. ARG-1: Arginase-1; CCK-8: Cell counting kit-8; EMT: Epithelial–mesenchymal transition; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; IL: Interleukin; iNOS: Inducible nitric oxide synthase; IRAK1: Interleukin-1 receptor-associated kinase 1; KO: Knockout; mRNA: Messenger RNA; MW: Molecular weight; NC: Normal control; qRT-PCR: Quantitative real-time polymerase chain reaction; TAMs: Tumor-associated macrophages; TGF-β: Transforming growth factor-beta; TNF-α: Tumor necrosis factor-alpha; WB: western blotting.

IRAK1 promotes the migration and invasion of GC cells via M2 polarization of TAMs

Accumulating evidence has revealed that TAMs can facilitate the metastasis of tumor cells. To investigate whether IRAK1 could modulate the biological behaviors of GC cells by influencing TAM polarization, we constructed a coculture system in vitro. We cocultured IRAK1 knockout GC cells with M0 macrophages and then collected conditioned medium (CM) from the cocultured supernatant for cell function assays. A CCK-8 assay revealed that GC cells cultured with IRAK1 knockout CM exhibited significantly suppressed proliferation [Figure 6E]. Transwell migration assays revealed that for GC cells cultured with IRAK1 knockout CM, the number of cells invading the basement membrane significantly decreased [Figure 6F]. Similarly, a Transwell invasion assay revealed that IRAK1 knockout CM reduced the number of GC cells that invaded through the matrix glue and basement membrane [Figure 6F]. Furthermore, WB revealed that IRAK1 knockout CM upregulated E-cadherin expression and downregulated N-cadherin expression in GC cells [Figure 6G]. These findings suggested that IRAK1 facilitates the proliferation, migration, invasion, and EMT of GC cells by inducing M2-like TAM polarization.

IRAK1 regulates M2-like TAM polarization via the IL-8/JAK2/STAT3 pathway

To explore the mechanism by which IRAK1 regulates M2-like TAM polarization, a flow cytometry bead-based assay was performed to measure the concentrations of 12 cytokines in the supernatants of GC cells (the NC and KO-IRAK1 groups). Quantitative analysis revealed that the IL-8 level was significantly lower in the KO-IRAK1 group than in the NC group. However, no statistically significant differences were observed in the remaining 11 cytokines between the two groups [Figure 7A]. Meanwhile, we performed an ELISA to confirm the levels of IL-8 in the supernatants from GC cells and from cocultures of GC cells and M0 macrophages (NC and KO-IRAK1 groups). The ELISA results revealed that the concentrations of IL-8 were markedly reduced in the supernatants of cells in both the KO-IRAK1 groups compared to the control groups [Figure 7B]. These findings suggested that IRAK1 could modulate the secretion of IL-8 to affect M2-like TAM polarization. Previous studies have shown that IL-8 is capable of binding to CXCR1 and/or CXCR2, thereby activating the JAK2/STAT3 signaling pathway.^[27] Therefore, we further investigated alterations in the JAK2/STAT3 pathway in TAMs cocultured with GC cells. The results indicated that IRAK1 downregulated the expression of phospho-Janus kinase 2 (p-JAK2) and phospho-signal transducer and activator of transcription 3 (p-STAT3) in TAMs cocultured with KO-IRAK1 GC cells. In contrast, no significant differences were observed in the expression levels of total JAK2 and STAT3 [Figure 7C]. In summary, we hypothesize that IRAK1 promotes IL-8 secretion to activate the JAK2/STAT3 pathway, thereby facilitating the M2 polarization of TAMs, which subsequently enhances the proliferation, invasion, and EMT of GC cells.

Figure 7.

The mechanism through which IRAK1 regulates M2 polarization of TAMs. (A) A flow cytometry bead-based assay was performed to measure the concentrations of 12 cytokines in the supernatants of GC cells (the NC and KO-IRAK1 groups). (B) ELISA was performed to measure the levels of IL-8 in the supernatants from GC cells and from cocultures of GC cells and M0 macrophages (NC and KO-IRAK1 groups). (C) Measurement of p-JAK2, p-STAT3, JAK2, and STAT3 protein levels in TAMs by WB after silencing IRAK1. ^*P <0.05, ^†P <0.01, and ^‡P <0.001. ELISA: Enzyme-linked immunosorbent assay; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; IL: Interleukin; IFN: Interferon; IRAK1: Interleukin-1 receptor-associated kinase 1; JAK2: Janus kinase 2; KO-IRAK1: IRAK1 knockout group; NC: Control knockout group; p-JAK2: Phospho-Janus kinase 2; p-STAT3: Phospho-signal transducer and activator of transcription 3; STAT3: Signal transducer and activator of transcription 3; TAMs: Tumor-associated macrophages; TNF-α: Tumor necrosis factor α.

IRAK1 promotes tumorigenicity in vivo

To demonstrate the function of IRAK1 in GC progression, xenograft tumor models were established via subcutaneous injection of NC/KO-IRAK1 and NC/OE-IRAK1 GC cells (MKN-28) into NPG mice. After 7 weeks, tumors from the KO-IRAK1 group developed more slowly than those from the NC group [Figure 8A, B]; tumors from the KO-IRAK1 group presented with smaller tumor sizes than those from the NC group [Figure 8C]. qRT-PCR, WB, and IHC revealed a significant decrease of IRAK1 expression in the KO-IRAK1 group [Figure 8D–F]. To determine the effect of IRAK1 on EMT in vivo, changes in EMT markers in xenograft tumors were assessed by WB. WB revealed that IRAK1 knockout in xenograft tumors increased E-cadherin expression and decreased N-cadherin expression [Figure 8G]. Furthermore, WB analysis also indicated that IRAK1 knockout resulted in a diminishing of p-mTOR, p-AKT, and p-PI3K expression levels in xenografted mouse models [Figure 8H]. In contrast, IRAK1 overexpression produced the opposite effects in vivo [Figure 8A–H]. These results indicated that IRAK1 facilitates GC progression in vivo and could be a promising therapeutic target [Figure 9].

Figure 8.

Role of IRAK1 in promoting GC progression in vivo. (A) Representative images depicting tumor growth in mice. (B) The body weight of mice. (C) Growth curves of tumor volumes in mice. (D) The detection of IRAK1 expression in xenografts via qRT-PCR. (E) The detection of IRAK1 expression in xenografts via WB. (F) The detection of IRAK1 expression in xenografts via IHC. (G) E-cadherin and N-cadherin expression in xenografts was detected by WB. (H) Measurement of p-PI3K, p-AKT, p-mTOR, PI3K, AKT, and mTOR protein levels in xenografted mouse models. ^*P <0.05, ^†P <0.01, and ^‡P <0.001. AKT: Protein kinase B; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GC: Gastric cancer; IRAK1: Interleukin-1 receptor-associated kinase 1; IHC: Immunohistochemistry; KO: Knockout; mRNA: Messenger RNA; MW: Molecular weight; mTOR: mammalian target of rapamycin; NC: Normal control; OE: Overexpression; p-AKT: Phospho-protein kinase B; p-mTOR: Phospho-mammalian target of rapamycin; PI3K: Phosphatidylinositol 3-kinase; p-PI3K: Phospho-phosphatidylinositol 3-kinase; qRT-PCR: Quantitative real-time polymerase chain reaction; WB: Western blotting.

Figure 9.

Regulatory mechanism of IRAK1 in GC. AKT: Protein kinase B; CXCR: C-X-C motif chemokine receptor; GC: Gastric cancer; IL-8: Interleukin 8; IRAK1: Interleukin-1 receptor-associated kinase 1; mTOR: Mammalian target of rapamycin; JAK2: Janus kinase 2; PI3K: phosphatidylinositol 3-kinase; STAT3: Signal transducer and activator of transcription 3.

Discussion

GC is a leading cause of global cancer-related mortality, and a deeper understanding of its molecular mechanisms is urgently needed.^[28,29] Chronic inflammation increases the risk of various tumors, such as GC and hepatic and colon cancers.^[30] IRAKs, as vital mediators of the IL-1R and Toll-like receptor (TLR) signaling pathways, affect diverse cellular processes, including cellular differentiation, inflammation, apoptosis, and innate immunity.^[31] Although four IRAK family members (IRAK1–4) are present in the human genome, only IRAK1 and IRAK4 show the activity of kinases.^[32] IRAK1, the first member of the IRAK family, has been reported to be involved in various malignancies.^[33] However, the role of IRAK1 in GC progression remains unclear. In this study, we found that IRAK1 was highly expressed in both GC tissues and cells. In vitro and in vivo experiments further revealed that IRAK1 could facilitate the proliferation, migration, invasion, and EMT process of GC cells via the PI3K/AKT/mTOR pathway. Furthermore, we elucidated that IRAK1 plays a pivotal role in the modulation of the TME. IRAK1 enhances M2-like TAM polarization, therefore promoting the migration, invasion, and EMT of GC cells. Our findings shed light on the new role of IRAK1 in tumor immunity and highlight its potential as a therapeutic target for GC.

IRAK1 levels are upregulated in multiple tumors, including breast cancer, hepatocellular carcinoma, and glioma.^[33–35] In the past decade, emerging evidence has emphasized the oncogenic role of IRAK1 in tumors. For example, Hosseini et al^[36] reported that IRAK1 was highly expressed in acute myeloid leukemia and could be a promising prognostic marker. Li et al^[34] revealed that upregulation of IRAK1 expression in hepatomas facilitated antiapoptotic activity and proliferation primarily via its phosphorylation status. Chen et al^[35] reported that upregulated IRAK1 was correlated with poor prognosis in glioma patients. Mechanistically, heterogeneous nuclear ribonucleoprotein C (HNRNPC) can activate the MAPK pathway by maintaining the stability of IRAK1.^[35] Our research results also underscored the crucial role of IRAK1 in GC initiation and progression. We found that IRAK1 expression was elevated in the early stage of GC and progressively increased during the progression of this disease. Clinicopathological feature analysis revealed that high IRAK1 expression predicted poor survival outcomes. Furthermore, IRAK1 was highly expressed in GC cells. Highly expressed IRAK1 can enhance the proliferative, migrative, and invasive ability of GC cells and activate the EMT process. In vivo experiments demonstrated that IRAK1 promotes tumor growth and metastasis. Our research broadens the understanding of IRAK1 in cancer progression, offering novel diagnostic biomarkers and therapeutic targets for GC. IRAK1 is the primary effector of the TLR pathway and an essential component of the Myddosome complex. Activated TLR and IL1R recruit MYD88, leading to IRAK1 and IRAK4 activation. IRAK1/4 subsequently induces the activation of the p38/MAPK and NF-κB pathways.^[37] This mechanism has been reported in primary effusion lymphoma and diffuse large B-cell lymphoma.^[38,39] Furthermore, the MAPK and PI3K/AKT/mTOR pathways are interconnected at different levels, and coactivation of both pathways frequently occurs in tumors. Therefore, we speculated that IRAK1 affects the biological behaviors of GC cells via the PI3K/AKT/mTOR pathway. In all higher eukaryotic cells, the PI3K/AKT/mTOR pathway is a highly conserved transduction network that plays a critical role in cell survival, growth, and proliferation. Dysregulation of the PI3K/AKT/mTOR pathway has been shown to contribute significantly to tumor progression. Indeed, approximately 50% of human tumors exhibit aberrations in the PI3K/AKT/mTOR pathway, highlighting its frequent activation in cancer.^[40] Accumulating studies have indicated that the PI3K/AKT/mTOR pathway is involved in the proliferation, invasion, and EMT process of tumor cells.^[41–43] We conducted further experiments to evaluate the influence of IRAK1 on the activation of the PI3K/AKT/mTOR axis. Our results demonstrated that IRAK1 knockout in GC cells led to decreased phosphorylation levels of PI3K, AKT, and mTOR. Conversely, IRAK1 overexpression resulted in elevated phosphorylation of these proteins. Additionally, we found that treatment with 740Y-P, a PI3K agonist, partially reversed the inhibitory effects of IRAK1 knockout on GC cell proliferation, migration, invasion, and EMT. These findings suggest that IRAK1 contributes to the oncogenic process in GC at least in part by modulating the PI3K/AKT/mTOR pathway.

TAMs, the most abundant cells in the TME, have attracted increasing attention from tumor researchers. TAMs refer to macrophages present in the TME or infiltrated into tumor tissues and are primarily derived from circulating monocytes. Macrophages differentiate into two types of macrophages: classically activated M1 macrophages and alternatively activated M2 macrophages.^[13] During the progression of tumors, TAMs usually tend to exhibit the properties of M2 macrophages (a protumorigenic macrophage type). Meanwhile, M2-like TAMs are closely related to high tumor grade and poor clinical outcomes in multiple tumors (such as GC, breast cancer, and gliomas), highlighting the importance of exploring the factors driving M2 macrophage polarization.^[44–46] In human macrophages, proinflammatory cytokine production and TLR signaling activation are highly dependent on IRAK1.^[47] Therefore, we further explored the effect of IRAK1 on M2 macrophage polarization. In our study, coculture systems indicated that the knockout of IRAK1 expression in GC cells significantly reduced the percentage of CD206⁺ cells and the expression of M2 macrophage markers. These results suggest that IRAK1 participates in the M2 polarization of TAMs. Furthermore, we investigated the underlying mechanism by which IRAK1 regulates M2-like TAM polarization. To identify cytokines whose secretion is regulated by IRAK1, we conducted a flow cytometry bead-based assay to quantify the levels of 12 cytokines in the supernatants of GC cells (the NC and KO-IRAK1 groups). The results revealed that the IL-8 level was significantly lower in the KO-IRAK1 group than in the NC group. Based on the aforementioned results, we hypothesize that IRAK1 regulates IL-8 secretion to influence M2-like TAM polarization. ELISA further confirmed reduced IL-8 levels in the supernatants obtained from KO-IRAK1 GC cells and from cocultures of KO-IRAK1 GC cells with M0 macrophages. Previous studies have demonstrated that IL-8 could exert a promoting effect on M2 polarization of TAMs in the TME, which is consistent with our findings.^[48] Mechanistic studies revealed that IL-8 is capable of binding to CXCR1 and/or CXCR2, thereby activating the JAK2/STAT3 signaling pathway.^[29] Our results also indicated that the expression levels of p-JAK2 and p-STAT3 were decreased in macrophages cocultured with KO-IRAK1 GC cells. We further demonstrated that IRAK1 enhances IL-8 secretion to activate the JAK2/STAT3 pathway, thereby facilitating the M2 polarization of TAMs.

In recent years, accumulating studies have revealed that the polarization of TAMs into M2 subtypes plays an essential role in modulating tumor progression and metastasis. For example, Dong et al^[49] revealed that M2-like TAMs could secrete vascular endothelial growth factor (VEGF) to stimulate prostate cancer antigen 6 (PCAT6) expression, therefore facilitating triple-negative breast cancer tumorigenesis and angiogenesis. Chen et al^[50] reported that tumor-recruited M2 macrophages could facilitate the metastasis of GC and breast cancer. Mechanistically, M2-secreted chitinase-3-like protein 1 activates the MAPK pathway via binding to interleukin-13 receptor subunit alpha 2 (IL-13Rα2) in cancer cells.^[50] Similarly, Lv et al^[51] reported that M2-like TAMs increase the secretion of Wingless-type MMTV integration site family (‌Wnt)1 and Wnt3a to activate the β-catenin pathway, thus promoting the metastasis of thyroid cancer. Yang et al^[52] reported that exosomal microRNAs (miRNAs) derived from M2 macrophages facilitated the growth and angiogenesis of pancreatic cancer via targeting E2F transcription factor 2. Piao et al^[53] also reported that the interaction between TAMs and tumor cells contributed to GC progression. Mechanistically, macrophage-secreted CXCL8 promoted GC invasion and proliferation via the JAK/STAT1 axis. STAT1 can upregulate IL-10 in GC cells to trigger M2 polarization of TAMs and continue to induce CXCL8 release, resulting in GC progression.^[53] In our study, we found that the proliferation and invasive capacity of GC cells cultured with IRAK1 knockout CM were significantly suppressed. Furthermore, WB revealed that IRAK1 knockout led to the upregulation of E-cadherin and downregulation of N-cadherin in GC cells. In summary, our findings revealed that IRAK1 could induce M2-like TAM polarization via the IL-8/JAK2/STAT3 pathway, thereby facilitating GC cell migration, invasion, and EMT process.

In conclusion, our study demonstrated that IRAK1 is upregulated in GC tissues vs. normal controls. Notably, IRAK1 facilitates GC cell proliferation, migration, invasion, and EMT by activating the PI3K/AKT/mTOR pathway. In addition, IRAK1 dysregulation in TAMs can affect the malignant biological behavior of GC cells by inducing M2-like polarization of macrophages. Mechanistically, IRAK1 enhances IL-8 secretion to activate the JAK2/STAT3 pathway, thereby facilitating the M2 polarization of TAMs. Our findings reveal the pivotal function of IRAK1 in GC progression and metastasis, providing a novel diagnostic biomarker and promising therapeutic strategy for GC.

Conflicts of interest

None.