Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2025 Dec 12;16:2251. doi: 10.1038/s41598-025-31983-2

Involvement of LncRNA FAF in chemotherapy-induced cardiotoxicity by mediating pyroptosis through modulation of the NLRP3-Caspase-1 signaling pathway

Ziyu Feng 1,#, Jinhui Sun 1,#, Qiang Geng 1, Bichen He 1, Jingjing Zhang 1, Yiheshan Ainiwaer 1, Bing Zhang 1,✉, Yuanming Zhang 2,✉
PMCID: PMC12815921  PMID: 41387942

Abstract

Purpose Chemotherapeutic agents, though highly effective in eliminating tumor cells, frequently cause varying degrees of myocardial injury. Doxorubicin (DOX) is a leading extensively used anthracycline-based chemotherapy agents. The present research sought to explore the role of lncRNA FAF in chemotherapy-induced cardiotoxicity and to elucidate its regulatory function via the NLRP3-Caspase-1 axis. Methods A rat model of DOX-induced cardiac toxicity was generated by administering the drug intraperitoneally, and cardiac function in rats was subsequently evaluated by echocardiography. We assessed morphological changes in rat myocardial tissue by hematoxylin-eosin and Masson staining, and measured the expression of biomarkers associated with cardiac damage, including LDH and CK-MB, using ELISA. Proteins involved in pyroptosis (GSDMD, NLRP3, and C-Caspase-1) were evaluated through TUNEL assay, immunohistochemical staining, and Western blot experiments. Cell viability was determined using the CCK-8 assay, while pyroptosis was inspected by flow cytometry, and lncRNA FAF expression was quantified by qRT-PCR. Results DOX administration induced cardiac dysfunction, myocardial tissue structural disorders and fibrosis, as well as heightened serum concentrations of LDH and CK-MB. In both animal and cell-based experiments, DOX treatment led to a decrease in lncRNA FAF expression in cardiac myocytes, accompanied by a significantly up-regulation of NLRP3, C-Caspase-1, and GSDND-N, thereby promoting cardiomyocyte pyroptosis. In contrast, high expression of lncRNA FAF enhanced cardiac myocytes viability, inhibited pyroptosis, and down-regulated the expression of NLRP3, C-Caspase-1, and GSDND-N. Importantly, these effects were reversed by treatment with the NLRP3 agonist nigericin or the pyroptosis agonist polyphyllin VI in cardiomyocytes treated with lncRNA FAF overexpression. Conclusion lncRNA FAF alleviates DOX-induced cardiomyocyte injury by enhancing cardiomyocyte viability and suppressing pyroptosis by targeting the NLRP3-Caspase-1 axis.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-31983-2.

Keywords: LncRNA FAF, Cardiomyocyte, NLRP3-Caspase-1 axis, Cellular pyroptosis, DOX

Subject terms: Cardiology, Medical research

Introduction

Anthracyclines are among the highly effective chemotherapeutic drugs, and doxorubicin (DOX) represents one of the most extensively used anthracyclines. However, while exerting anti-tumor effects, DOX can also damage healthy tissues and cells1. In particular, DOX induces dose-dependent and potentially life-threatening myocardial injury, with DOX-induced cardiotoxicity (DIC) reported in up to 25% of patients2. At present, the sole cardioprotective agent authorized for use in the U.S. is dexrazoxane, prevention of cardiotoxicity associated with anthracycline therapy3. Nevertheless, its clinical use is limited by risks of bone marrow suppression and secondary malignancies4. Moreover, conventional medications for myocardial injury, such as beta-blockers, have failed to show efficacy against DIC5. These limitations underscore the urgent need to establish new treatment approaches and identify targets to avert or mitigate anthracycline-induced cardiotoxicity.

Cellular pyroptosis is a category of caspase-dependent programmed cell death that can proceed through either the classical Caspase-1-dependent axis or the non-classical Csapase-4/5/11 axis. It is primarily mediated by the initiation of NOD-NLRP3 inflammasomes, which induce pore formation in the cell membrane and trigger the release of IL-1β and IL-186. NLRP3 inflammasomes are predominantly assembled by NLRP3, ASC, and Caspase-17, and they have been shown to mediate pyroptosis of cardiomyocytes8. To illustrate, nanosilica has been reported to induce cardiac myocytes pyroptosis and myocardial hypertrophy through the NLRP3/Caspase-1 axis9, whereas tongxinluo mitigates atherosclerosis by inhibiting NLRP3/Caspase-1-dependent pyroptosis10. Similarly, pyroptosis plays a pivotal role in DIC, indicating the importance of elucidating the intrinsic mechanism of DOX-induced pyroptosis for mitigating DIC11–13.

LncRNAs are long (> 200 nt) non-coding RNAs, yet they play critical regulatory roles in multiple diseases by modulating gene expression through both transcriptional and post-transcriptional mechanisms14. Emerging evidence suggests that lncRNAs may serve as promising therapeutic targets for cardiac repair and regeneration during the progression of heart disease15. For instance, lncRNA PVT1 has been reported to exacerbate adriamycin-triggered cardiac myocytes apoptosis by modulating the miR-187-3p/AGO1 pathway16. Recently, lncRNA FGF9-associated factor (FAF) has been identified as down-regulated in infarcted myocardium and shown to inhibit cardiomyocyte apoptosis and myocardial fibrosis17,18. However, the role of lncRNA FAF in chemotherapy-induced cardiac toxicity remains unexplored. In the present study, we developed a rat model of DOX-induced cardiotoxicity to evaluate the effects of lncRNA FAF on DIC.

Materials and methods

Animal model establishment

All experiments adhered strictly to regulations on use and management of laboratory animals, and gained approval from the Institutional Animal Care and Use Committee. The animal experiments conformed to the ARRIVE guidelines. Eight-week-old male SD rats (Vital River, Beijing) were housed in a 12-hour photoperiod at 25 ± 2 °C and provided with unrestricted access to water and food. For carrying out the experiment, these rats were classified into two groups: model and control. Rats in the model group were injected intraperitoneally with DOX (MedChemExpress, HY-15142 A) at 2 mg/kg body weight (BW) once per week for six weeks straight (cumulative dose: 12 mg/kg), while those in the control group given a matching of sterile 0.9% saline via intraperitoneal injection19. At the end of the experiment, all rats were euthanized. The rats were first placed in an anesthesia induction chamber filled with 5% isoflurane for deep anesthesia. After loss of consciousness, an overdose of sodium pentobarbital (150 mg/kg) was administered intraperitoneally. Following complete cessation of respiration, rapid thoracotomy was performed to excise the heart to confirm death.

Echocardiography

Four weeks after the interventions, general anesthesia was induced in rats using 5% isoflurane, which was subsequently lowered to 1.5% to maintain the anesthetic effect. Left ventricular ejection fraction (LVEF), left ventricular shortening rate (LVFS), left ventricular end-systolic diameter (LVESD), left ventricular systolic pressure (LVSP), and left ventricular end-diastolic pressure (LVEDP) were measured through Small-Animal Ultrasound Imaging System20.

Detection of LDH and CK-MB levels

Following the experiment, rats in each group were fasted overnight for 12 h with free access to water, and their BW was measured. After anesthesia via isoflurane inhalation, the rats were positioned supine, and collect 5–8 mL of blood from the abdominal aortas. Following a 1-h incubation at room temperature, serum was isolated by centrifugation (3000 rpm, 15 min, 4℃) for biochemical assays. Serum levels of LDH and CK-MB were determined using the LDH assay kit (A020-2-2, Nanjing JianCheng) and CK-MB assay kit (H197-1-1, Nanjing JianCheng), respectively.

Histopathological staining

Following blood collection, the thoracic cavity of each rat was fully exposed, and the abdominal aorta was immediately perfused with pre-cooled phosphate-buffered saline (PBS). The heart was then rapidly excised and immersed in 10% formalin for 24 h, after which it was rinsed with tap water. Subsequently, tissues were processed for histology and sectioned at 4 μm. The sections were dried and subjected to deparaffinization and hydration before being stained with hematoxylin and eosin (HE) for histopathological evaluation under a optical microscope (Carl Zeiss AG). Myocardial fibrosis was assessed via Masson staining, while apoptosis was detected using a TUNEL apoptosis identification kit (40308ES60, Yeasen Biotechnology).

Immunohistochemical staining

Paraffin-embedded myocardial tissue sections were dewaxed with xylene and gradient ethanol. We performed antigen retrieval using sodium citrate antigen repair buffer (P0081, Beyotime), and treated the tissue sections with 3% hydrogen peroxide (7722-84-1, Meker). The sections were incubated with the corresponding antibodies. Finally, the sections were stained through DAB staining kit (P0202, Beyotime) and sealed with neutral resin.

Cell model establishment and drug treatment

Cardiomyocytes were harvested from postnatal day 1–3 SD rats according to a previously described method21. In short, the rat heart tissue was minced with 0.25% trypsin and 0.1% collagenase for 15 min in a incubator. After centrifugation, the precipitate was resuspended in DMEM/F-12. Cardiomyocytes were identified via cardiac troponin (cTnT) (ab209813, abcam). To construct an in vitro model of DIC, cells were stimulated with 1 µg/mL DOX for 24 h22, whereas cells in the control group were received an equal volume of PBS. Following DOX treatment, cells were replated and transfected with either the lncRNA FAF overexpression plasmid or its negative control (oe-NC) at 60–80% confluence. After 6 h of transfection, the culture medium was refreshed, and cells were further cultured for 48 h. For functional validation, lncRNA FAF-overexpressing cells were treated with the pyroptosis agonist polyphyllin VI (5 µM, 24 h) or the NLRP3 inflammasome-specific agonist nigericin (10 µM, 1 h).

Detection of IL-1β and IL-18 levels

Levels of IL-1β and IL-18 in rat serum or cell supernatants were measured using ELISA kits. Briefly, rat serum and cell supernatants were obtained, and standard solutions and enzyme conjugates were processed. The target antigens were diluted with coating buffer to appropriate concentrations, each well was added with 100 µL of antigen dilution and incubated at 37℃ for 4 h. Blocking was performed with 5% calf serum at 37℃ for 1 h. Subsequently, samples were co-incubated with the enzyme-labeled antibody (100 µL each) for 1 h. Next, 100 µL of reaction substrate was added to each well for color development at 37℃ in the dark for 5 min.

Detection of apoptosis by TUNEL assay

TUNEL staining was executed on paraffin-embedded myocardial tissue sections and cardiomyocyte climbing slides to evaluate apoptosis. After deparaffinization and rehydration (for tissue sections) or fixation with 4% paraformaldehyde (for cells), antigen retrieval was conducted using proteinase K. Subsequently, the TUNEL reaction solution was added for incubation at 37℃ in the dark for 60 min. Finally, examination by fluorescence microscopy, with the proportion of TUNEL-positive cells serving as the marker of apoptosis.

Western blot(WB)

Proteins were harvested from corresponding tissue and cell samples, and equal amounts (20 µg) were resolved by SDS-PAGE before being applied to activated PVDF membranes (22860, Thermo Fisher). Following overnight incubation with primary antibodies at 4℃, samples were treated with an HRP-conjugated secondary antibody. Protein bands were visualized by chemiluminescence. Primary antibodies: NLRP3 (HY-P80246, MedChemExpress), C-Caspase-1 (89332 S, Cell Signaling Technology), GSDMD (A20728, Abclonal Technology), and β-Actin (8457, Cell Signaling Technology).

qRT-PCR

We collected total RNA from cells using VeZol Reagent (Vazyme, R411-01) and reverse-transcribed it to cDNA with the HiScript III RT SuperMix for qPCR (Vazyme, R323-01).Primers for GAPDH and lncRNA FAF (Table 1), synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., were designed and added to the mixture tubes. LncRNA FAF expression levels were quantified by StepOne™ qPCR.

Table 1.

Primers for qRT-PCR detection.

Primers Sequences 5’−3’
LncRNA FAF-Forward Primer CGCTAAAGGCACAGGGTCAG
LncRNA FAF-Reverse Primer CACCAACCTTTCCCTTCCAGTC
GAPDH -Forward Primer ACGGCAAGTTCAACGGCACAG
GAPDH -Reverse Primer CGACATACTCAGCACCAGCATCAC

CCK-8 assay

The CCK-8 solution was mixed with culture medium at a 1:9 ratio following the manufacturer’s protocol. Following incubation with the CCK-8 solution, a microplate reader was used to measure the absorbance at 450 nm.

Flow cytometry

Pyroptosis was inspected using the FAM-FLICA Caspase-1 Assay Kit (Immunochemistry, K01370). We collected and stained cells with FLICA and PI as per the kit instructions. Subsequently, the cells were washed with the washing buffer and analyzed by flow cytometry (Thermo Fisher).

Cell immunofluorescence staining

Following fixation with 4% paraformaldehyde (Beyotime, P0099), the cells were blocked with blocking solution. Following prolonged incubation with primary antibodies at 4 °C, the cells were washed thrice with PBS and incubated with Hoechst 33,342 (C1022, Beyotime) and the secondary antibody at ambient temperature for 2 h.

Statistical analysis

Statistical analysis was conducted via the GraphPad Prime 8.0 software. All data were displayed as mean ± standard deviation. Comparisons between two groups were conducted by applying the t-test, and differences among multiple groups were analyzed using One-way Analysis of Variance, with p < 0.05 denoting statistical significance. * p < 0.05, ** p < 0.01, *** p < 0.001.

Results

Chemotherapeutic agents promote myocardial injury in rats

To examine the cardiotoxicity of chemotherapeutic agents and the extent of myocardial tissue injury, cardiac dysfunction was induced in rats through intraperitoneal injection of DOX. Cardiac structure and function of rats were assessed via echocardiography (Fig. 1A). It was demonstrated that DOX administration led to cardiac dysfunction, as evidenced by decreased LVEF and LVFS in comparison to the control group (Fig. 1B-C). Regarding the assessment of cardiac structure, higher LVESD (Fig. 1D), notably decreased LVSP (Fig. 1E), and elevated LVEDP (Fig. 1F) were observed in the model group relative to the control group. Considering the relevance of CK-MB and LDH as biomarkers of DOX-induced myocardial injury, we measured the serum levels of LDH and CK-MB, and found that DOX significantly elevated the levels of both LDH and CK-MB (Fig. 1G). HE and Masson staining revealed that DOX induced structural disorganization of myocardial tissue, heightened cytoplasmic vacuolization, loss of myogenic fibers, and expansion of myocardial fibrosis (Fig. 1H-I). These findings suggest that DOX accumulation results in both cardiac insufficiency and myocardial fibrosis in rats.

Fig. 1.

Fig. 1

Chemotherapeutic agents promote myocardial injury in rats. (A) Representative images of echocardiography (quantitative data shown in B-F); (B) LVEF; (C) LVFS; (D) LVESD; (E) LVSP; (F) LVEDP; (G) Serum levels of LDH and CK-MB in DOX-treated rats; (H) Representative images of HE and Masson staining of cardiac tissues collected from DOX-treated rats (magnification: 200×); (I) Quantification of myocardial fibrosis area (%) by Masson staining. N = 6.

Chemotherapeutic agents promote pyroptosis in rat myocardial tissue and inhibit LncRNA FAF expression

To clarify the role of DIC, we initially assessed myocardial tissue injury in rats through TUNEL staining, which showed significant cardiomyocyte apoptosis following DOX treatment (Fig. 2A). To further elucidate the mechanisms of cardiomyocyte death, we examined the expression of proteins associated with NLRP3-mediated pyroptosis12. The experimental results demonstrated that in vivo DOX treatment significantly up-regulated the levels of IL-18 and IL-1β in rat serum (Fig. 2B-C), while also markedly increasing the expression of pyroptosis-related proteins (NLRP3, C-Caspase-1, and GSDMD-N) in rat myocardial tissue (Fig. 2D-E). These findings indicate that DOX induces cardiac myocyte pyroptosis. Furthermore, lncRNA FAF expression was revealed to be reduced in rat myocardial tissues after DOX treatment (Fig. 2F), based on which we hypothesized that lncRNA FAF play a protective role in DIC and is involved in the regulation of cardiac myocyte pyroptosis.

Fig. 2.

Fig. 2

Chemotherapeutic agents promote pyroptosis in rat myocardial tissue and inhibit lncRNA FAF expression. (A) Representative images illustrating TUNEL staining of rat heart tissue (magnification: 200×); (B) Supernatant IL-18 levels (ELISA); (C) Supernatant IL-1β levels (ELISA); (D) Images showing DOX-induced up-regulation of GSDMD-N protein expression in rat myocardium (magnification: 200×); (E) Representative WB electropherograms of NLRP3, C-Caspase1, and GSDMD-N; (F) qRT-PCR detection of lncRNA FAF expression. N = 6.

LncRNA FAF is lowly expressed in a model of chemotherapy-induced cardiomyocyte injury

Primary cardiomyocytes derived from mammals were characterized through cTnT, and their purity was calculated to be 98% (Fig. 3A). These cardiomyocytes were subsequently cultured in vitro to investigate cardiomyocyte injury during DIC and to explore the regulatory mechanisms. CCK-8 assay indicated that DOX treatment significantly inhibited cardiomyocyte viability compared with the PBS group (Fig. 3B). Previous evidence indicates that NLRP3-mediated pyroptosis in DOX-induced cardiac toxicity6 Flow cytometry analysis confirmed that DOX treatment enhanced cardiomyocyte pyroptosis (Fig. 3C-D), and ELISA revealed significantly elevated levels of IL-18 and IL-1β in the cell culture supernatant following DOX treatment (Fig. 3E-F). WB analysis further demonstrated that DOX markedly up-regulated the expression of pyroptosis-related proteins, comprising NLRP3, C-Caspase-1, and GSDMD-N in cardiomyocytes (Fig. 3G). Compared with the PBS group, the DOX group showed down-regulated lncRNA FAF expression (Fig. 3H). These observed results suggest the protective role lncRNA FAF plays in mitigating chemotherapy-induced cardiomyocyte injury.

Fig. 3.

Fig. 3

lncRNA FAF is lowly expressed in a model of chemotherapy-induced cardiomyocyte injury. (A) Identification of cardiomyocytes via immunofluorescence assay targeting cTnT; (B) Evaluation of DOX’s effect on the viability of rat cardiomyocytes via CCK-8 assay; (C-D) Representative flow cytometric speckled plots and quantification of pyroptotic cells; (E) Supernatant IL-18 levels (ELISA); (F) Supernatant IL-1β levels (ELISA); (G) WB electropherograms of NLRP3, C-Caspase1, and GSDMD-N; (H) qRT- PCR detection of lncRNA FAF expression. N = 3.

LncRNA FAF inhibits chemotherapy-induced cardiomyocyte injury

Based on the previous finding that DOX treatment suppresses lncRNA FAF expression in cardiomyocytes, we further investigated the relationship between lncRNA FAF and cardiomyocytes. Cardiomyocytes were transfected with oe-lncRNA FAF overexpression plasmid. Overexpression of lncRNA FAF enhanced cardiomyocyte viability (Fig. 4A) and inhibited cardiomyocyte apoptosis (Fig. 4B-C). Our data indicate that lncRNA FAF alleviates chemotherapy-induced cardiomyocyte injury.

Fig. 4.

Fig. 4

lncRNA FAF inhibits chemotherapy-induced cardiomyocyte injury. (A) oe-lncRNA FAF enhanced the activity of DOX-treated rat cardiomyocytes; (B-C) oe-lncRNA FAF inhibited the apoptosis of DOX-treated rat cardiomyocytes. Representative TUNEL staining plots and corresponding quantification showing the proportion of apoptotic cells. N = 3.

LncRNA FAF inhibits chemotherapy-induced cardiomyocyte pyroptosis

Accumulating evidence indicates that NLRP3-mediated pyroptosis plays a critical role in the pathophysiology of DIC23. From the results of the above-described experiments, we further investigated whether lncRNA FAF modulates NLRP3-mediated pyroptosis. Flow cytometry assay demonstrated that high lncRNA FAF expression was associated with reduced cardiomyocyte pyroptosis compared with the DOX + oe-NC group (Figs. 5A-B). Immunofluorescence staining revealed lower expression of GSDMD-N in the DOX + oe-lncRNA FAF group than in the DOX + oe-NC group (Fig. 5C), WB analysis additionally revealed decreased expression of NLRP3, C-Caspase-1, and GSDND-N (Fig. 5D). All these experimental results suggest that lncRNA FAF effectively attenuates DOX-triggered cardiomyocyte pyroptosis in vitro.

Fig. 5.

Fig. 5

lncRNA FAF inhibits chemotherapy-induced cardiomyocyte injury. (A-B) Representative flow cytometric spot plots and quantification showing the percentage of pyroptosis cells; (C) Representative immunofluorescence staining plots of GSDMD-N expression; (D) WB electropherograms of NLRP3, C-Caspase1, and GSDMD-N; N = 3.

LncRNA FAF alleviates chemotherapy-induced cardiomyocyte injury by inhibiting pyroptosis

To explore the potential mechanism underlying lncRNA FAF’s modulation of chemotherapy-induced cardiomyocyte injury, cardiomyocytes were treated with the pyroptosis agonist polyphyllin VI. Compared with the DOX + oe-lncRNA FAF group, polyphyllin VI decreased cell viability (Fig. 6A), promoted cell pyroptosis (Fig. 6B-C), and elevated the expression of NLRP3, C-Caspase-1, and GSDND-N (Fig. 6D). These results collectively suggest that lncRNA FAF alleviates cardiomyocyte injury by regulating pyroptosis.

Fig. 6.

Fig. 6

lncRNA FAF alleviates chemotherapy-induced cardiomyocyte injury by inhibiting pyroptosis. (A) Effect of polyphyllin VI on the viability of DOX- and oe-lncRNA FAF-treated rat cardiomyocytes; (B-C) Representative flow cytometric speckle maps and quantticication showing the percentage of pyroptosis cells; (D) Representative WB electropherograms of NLRP3, C-Caspase1, and GSDMD-N; N = 3.

LncRNA FAF alleviates chemotherapy-induced cardiomyocyte pyroptosis by suppressing the NLRP3-Caspase-1 axis

To validate whether lncRNA FAF exerts its protective effects through the NLRP3-Caspase-1 signaling route, cardiac myocytes were treated with the NLRP3 agonist nigericin. Nigericin decreased cell viability (Fig. 7A) and enhanced pyroptosis (Fig. 7B-C) in comparison to the DOX + oe-lncRNA FAF group. Moreover, as revealed by WB experiments, the DOX + oe-lncRNA FAF + nigericin group exhibited higher expression levels of NLRP3, C-Caspase-1, and GSDND-N relative to the DOX + oe-lncRNA FAF group (Fig. 7D). These outcomes demonstrate that lncRNA FAF mitigates cardiac myocytes pyroptosis by targeting the NLRP3-Caspase-1 axis.

Fig. 7.

Fig. 7

lncRNA FAF mitigates chemotherapy-induced cardiomyocyte injury by inhibiting pyroptosis. (A) Nigericin inhibited the viability of DOX- and oe-lncRNA FAF-treated rat cardiomyocytes; (B-C) Representative flow cytometric speckle plots and quantification showing the percentage of pyroptosis cells; (D) Representative WB electropherograms of NLRP3, C-Caspase1, and GSDMD-N; N = 3.

Discussion

DOX is widely used to treat various cancers. Nevertheless, its clinical application is often limited by cardiotoxic side effects, which can manifested as acute and chronic cardiotoxicity weeks to months after administration. High cumulative doses, particularly approaching 700 mg/m², are associated with dilated cardiomyopathy and enhanced cardiomyocyte apoptosis, and in severe cases, may result in heart failure24. Current evidence indicates that the mechanism of DIC may involve multiple pathways, including DNA damage, abnormal mitochondrial structure or function, inflammation, calcium overload, ferroptosis, oxidative damage, cardiomyocyte apoptosis, and autophagy25. However, therapeutic strategies targeting these pathways have achieved limited success in mitigating DIC and, in some cases, have compromised the anti-tumor effects of DOX26–28. Therefore, although the molecular mechanisms underlying DIC are increasingly understood, there remains an urgent need to identify novel targets, especially those that can attenuate DIC while preserving the drugs’ anti-tumor activity. DOX induced myocardial injury and cardiac dysfunction in rats, accompanied by down-regulation of lncRNA FAF expression in vivo and in vitro DIC models. Our data imply that lncRNA FAF may represent a promising molecular target for ameliorating myocardial injury related with DIC.

LncRNAs function through transcriptional regulation, post-transcriptional regulation, and epigenetic modification29. Emerging evidence has linked lncRNAs to various human diseases, including heart disease30. For example, Viereck et al. proved that lncRNA Chast acts as an inducer of cardiac hypertrophy31. Similarly, in cardiomyocytes, lncRNA CARL inhibits mitochondrial fission and apoptosis by forming a double-stranded RNA with miR-539 through base complementary pairing32. Despite these insights, the roles of lncRNAs in chemotherapeutic drug-induced cardiotoxicity remain largely unexplored. In this work, we observed that lncRNA FAF expression was altered in a DIC model. Notably, high expression of lncRNA FAF enhanced cardiomyocyte viability and suppressed apoptosis. These results provide evidence that lncRNA FAF mitigates DOX-induced cardiac myocytes injury, which is consistent with previous reports indicating its inhibition on cardiomyocyte apoptosis18.

DOX, an anthracycline-based chemotherapeutic drug, suppresses cancer cell growth through inhibition of DNA synthesis and cell division. During pyroptosis, cells experience DNA damage and undergo cell swelling, LDH release, plasma membrane pore formation, release of intracellular inflammatory factors, activation of Caspase-1, and cleavage of GSDMD6. In recent years, DOX-induced cardiac myocyte pyroptosis has been increasingly reported. For instance, Zheng et al. demonstrated that BCL2 interacting protein 3 mediates DOX-induced cardiac myocytes pyroptosis via the caspase-3/GSDME axis11, the activation of NLRP3 inflammasome by Caspase-1 triggers cardiac myocytes pyroptosis, ultimately leading to cardiac dysfunction12. In addition, Caspase-1 cleaves GSDMD to produce an GSDMD-N, which induces pyroptosis through formation of plasma membrane pores33. Our ex vivo experiments demonstrated that DOX induced cardiac myocytes pyroptosis, as evidenced by an elevation in cardiomyocyte death and concomitant up-regulation of NLRP3, GSDMD-N, and C-Caspase-1. Notably, overexpression of lncRNA FAF inhibited pyroptosis, and enhanced cardiomyocyte viability, thereby mitigating DOX-induced cardiomyocyte injury. These protective effects, however, were reversed upon treatment with pyroptosis agonists, suggesting that lncRNA FAF can alleviate cardiomyocyte injury primarily by suppressing pyroptosis. The NLRP3-Caspase-1 pathway represents a core mechanism mediating inflammatory responses in the innate immune system. It senses danger signals, such as ATP and ROS, to activate NLRP3 inflammasome assembly, leading to Caspase-1 activation. This process leads to GSDMD cleavage, induction of pyroptosis, maturation and release of IL-1β/IL-18, thereby amplifying inflammatory responses. Dysregulation or overactivation of this pathway contributes to pathological processes, including cardiotoxicity, sepsis, and neurodegenerative diseases, with its overactivation potentially causing tissue injury and multi-organ dysfunction. Targeted inhibition of the NLRP3–Caspase-1 axis has been recognized as a potential therapeutic strategy for mitigating inflammatory disorders, yet achieving effective anti-inflammatory effects without disrupting immune homeostasis remains a key challenge. Accumulating evidence indicates that the NLRP3-Caspase-1 signaling axis plays a central role in regulating pyroptosis34. Consistently, our results demonstrated that lncRNA FAF regulates this pathway to inhibit pyroptosis, thereby alleviating DOX-caused cardiomyocyte injury.

In conclusion, our study proved that lncRNA FAF mitigates DIC-induced cardiac myocyte injury by modulating the NLRP3-Caspase-1 axis, inhibiting cardiomyocyte pyroptosis, and enhancing cardiomyocyte viability. These findings highlight lncRNA FAF as a potential therapeutic target for mitigating DIC-induced cardiomyocyte injury, offering a prospect of preserving the anti-tumor efficacy of chemotherapeutic agents while alleviating myocardial injury. It should be noted, however, that the present study primarily elucidates the functional mechanism of lncRNA FAF at the cellular level, and its specific cardioprotective effects in vivo require further validation using conditional gene knockout/overexpression animal models in future investigation.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (641.8KB, zip)
Supplementary Material 2 (219.6KB, pdf)

Acknowledgements

Not applicable.

Author contributions

Conceptualization, ZYF, JHS, BZ, YMZ and QG; methodology, BZ; investigation, ZYF, BCH, JJZ, YA; data curation, ZYF and BZ; writing—original draft preparation, ZYF and BZ; writing—review and editing, YMZ and QG; supervision, JJZ and YA; funding acquisition, BZ. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Laboratory of High Incidence Disease Causes and Prevention in Central Asia, a collaborative project held by the provincial and ministerial governments (SKL-HIDCA-2023-22), and the Natural Science Foundation of Xinjiang Uygur Autonomous Region (2022D01D76).

Data availability

All data from this study are available upon request (Bing Zhang drzhangbing@xjmu.edu.cn).

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

All experiments adhered strictly to regulations on use and management of laboratory animals, and gained approval from the Institutional Animal Care and Use Committee.

Consent for publication

Not applicable.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Ziyu Feng and Jinhui Sun.

Contributor Information

Bing Zhang, Email: drzhangbing@xjmu.edu.cn.

Yuanming Zhang, Email: zym6662024@163.com.

References

  • 1.Wu, B. B., Leung, K. T. & Poon, E. N. Mitochondrial-Targeted therapy for Doxorubicin-Induced cardiotoxicity [J]. Int. J. Mol. Sci., 23(3). 1912 (2022). [DOI] [PMC free article] [PubMed]
  • 2.Christidi, E. & Brunham, L. R. Regulated cell death pathways in doxorubicin-induced cardiotoxicity [J]. Cell Death Dis.12 (4), 339 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Yu, X. et al. Dexrazoxane Protects Cardiomyocyte from Doxorubicin-Induced Apoptosis by Modulating miR-17-5p [J]. BioMed research international, 2020: 5107193. (2020). [DOI] [PMC free article] [PubMed]
  • 4.Chen, Y., Shi, S. & Dai, Y. Research Progress of Therapeutic Drugs for doxorubicin-induced Cardiomyopathy [J] Vol. 156, 113903 (Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 2022). [DOI] [PubMed]
  • 5.Bhagat, A., Kleinerman, E. S. & Anthracycline-Induced Cardiotoxicity Causes, Mechanisms, and Prevention [J]. Advances in experimental medicine and biology, 1257: 181 – 92. (2020). [DOI] [PubMed]
  • 6.Zhang, L. et al. MCC950 Attenuates doxorubicin-induced Myocardial Injury in Vivo and in Vitro by Inhibiting NLRP3-mediated Pyroptosis [J] Vol. 143, 112133 (Biomedicine & Pharmacotherapy, 2021). [DOI] [PubMed]
  • 7.Sun, L. et al. Propofol Directly Induces Caspase-1-dependent Macrophage Pyroptosis Through the NLRP3-ASC Inflammasome [J] Vol. 10, 542 (Cell death & disease, 2019). 8. [DOI] [PMC free article] [PubMed]
  • 8.Yao, C., Veleva, T. & Scott, L. Enhanced cardiomyocyte NLRP3 inflammasome signaling promotes atrial fibrillation [J]. Circulation138 (20), 2227–2242 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wang, F. et al. Silica Nanoparticles Induce Pyroptosis and Cardiac Hypertrophy Via ROS/NLRP3/Caspase-1 Pathway [J] Vol. 182, 171–181 (Free radical biology & medicine, 2022). [DOI] [PubMed]
  • 10.Jiang, X. et al. Tongxinluo attenuates atherosclerosis by inhibiting ROS/NLRP3/Caspase-1-mediated endothelial cell pyroptosis [J]. J. Ethnopharmacol.304, 116011 (2023). [DOI] [PubMed] [Google Scholar]
  • 11.Zheng, X. et al. Bnip3 mediates doxorubicin-induced cardiomyocyte pyroptosis via caspase-3/GSDME [J]. Life Sci.242, 117186 (2020). [DOI] [PubMed] [Google Scholar]
  • 12.Zeng, C. et al. NLRP3 inflammasome-mediated pyroptosis contributes to the pathogenesis of non-ischemic dilated cardiomyopathy [J]. Redox Biol.34, 101523 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fang, G. et al. Amentoflavone mitigates doxorubicin-induced cardiotoxicity by suppressing cardiomyocyte pyroptosis and inflammation through Inhibition of the STING/NLRP3 signalling pathway [J]. Phytomedicine: Int. J. Phytotherapy Phytopharmacology. 117, 154922 (2023). [DOI] [PubMed] [Google Scholar]
  • 14.Gu, J. et al. LncRNA FAF attenuates hypoxia/ischaemia-induced pyroptosis via the miR-185-5p/PAK2 axis in cardiomyocytes [J]. J. Cell. Mol. Med.26 (10), 2895–2907 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lu, Q. et al. LncRNA HOXB-AS3 protects doxorubicin-induced cardiotoxicity by targeting miRNA-875-3p [J]. Experimental Therapeutic Med.19 (2), 1388–1392 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhan, J., Hu, P. & Wang, Y. LncRNA PVT1 aggravates doxorubicin-induced cardiomyocyte apoptosis by targeting the miR-187-3p/AGO1 axis [J]. Mol. Cell Probes. 49, 101490 (2020). [DOI] [PubMed] [Google Scholar]
  • 17.Ponnusamy, M. et al. Long noncoding RNA CPR (Cardiomyocyte proliferation Regulator) regulates cardiomyocyte proliferation and cardiac repair [J]. Circulation139 (23), 2668–2684 (2019). [DOI] [PubMed] [Google Scholar]
  • 18.Shi, H. J. et al. A novel long noncoding RNA FAF inhibits apoptosis via upregulating FGF9 through PI3K/AKT signaling pathway in ischemia-hypoxia cardiomyocytes [J]. J. Cell. Physiol.234 (12), 21973–21987 (2019). [DOI] [PubMed] [Google Scholar]
  • 19.Hsieh, P. L. et al. Dapagliflozin mitigates Doxorubicin-Caused myocardium damage by regulating AKT-Mediated oxidative Stress, cardiac Remodeling, and inflammation [J]. Int. J. Mol. Sci., 23(17). 10146 (2022). [DOI] [PMC free article] [PubMed]
  • 20.Fu, F. et al. Direct evidence that myocardial insulin resistance following myocardial ischemia contributes to Post-Ischemic heart failure [J]. Sci. Rep.5, 17927 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Louch, W. E., Sheehan, K. A. & Wolska, B. M. Methods in cardiomyocyte isolation, culture, and gene transfer [J]. J. Mol. Cell. Cardiol.51 (3), 288–298 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang, P. et al. Circ-0006332 stimulates cardiomyocyte pyroptosis via the miR-143/TLR2 axis to promote doxorubicin-induced cardiac damage [J]. Epigenetics19 (1), 2380145 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Meng, L. et al. Doxorubicin induces cardiomyocyte pyroptosis via the TINCR-mediated posttranscriptional stabilization of NLR family Pyrin domain containing 3 [J]. J. Mol. Cell. Cardiol.136, 15–26 (2019). [DOI] [PubMed] [Google Scholar]
  • 24.Rawat, P. S. et al. Doxorubicin-induced Cardiotoxicity: an Update on the Molecular Mechanism and Novel Therapeutic Strategies for Effective Management [J] Vol. 139, 111708 (Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 2021). [DOI] [PubMed]
  • 25.Li, D. et al. Role of acetylation in doxorubicin-induced cardiotoxicity [J]. Redox Biol.46, 102089 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Héon, S. et al. Dexrazoxane does not protect against doxorubicin-induced damage in young rats [J]. Am. J. Physiol. Heart Circ. Physiol.285 (2), H499–506 (2003). [DOI] [PubMed] [Google Scholar]
  • 27.Ladas, E. J. et al. Antioxidants and cancer therapy: a systematic review [J]. J. Clin. Oncology: Official J. Am. Soc. Clin. Oncol.22 (3), 517–528 (2004). [DOI] [PubMed] [Google Scholar]
  • 28.Seif, A. E. et al. Dexrazoxane Exposure and Risk of Secondary Acute Myeloid Leukemia in Pediatric Oncology Patients [J] Vol. 62, 704–709 (Pediatric blood & cancer, 2015). 4. [DOI] [PMC free article] [PubMed]
  • 29.Lorenzen, J. M., Martino, F. & Thum, T. Epigenetic modifications in cardiovascular disease [J]. Basic Res. Cardiol.107 (2), 245 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wapinski, O. & Chang, H. Y. Long noncoding RNAs and human disease [J]. Trends Cell Biol.21 (6), 354–361 (2011). [DOI] [PubMed] [Google Scholar]
  • 31.Viereck, J. et al. Long noncoding RNA chast promotes cardiac remodeling [J]. Sci. Transl. Med.8 (326), 326ra22 (2016). [DOI] [PubMed] [Google Scholar]
  • 32.Wang, K. et al. CARL LncRNA inhibits anoxia-induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539-dependent PHB2 downregulation [J]. Nat. Commun.5, 3596 (2014). [DOI] [PubMed] [Google Scholar]
  • 33.Sun, S. et al. Puerarin inhibits NLRP3-Caspase-1-GSDMD-Mediated pyroptosis via P2X7 receptor in cardiomyocytes and macrophages [J]. Int. J. Mol. Sci., 24(17). 13169 (2023). [DOI] [PMC free article] [PubMed]
  • 34.Wu, X. et al. Nicotine Promotes Atherosclerosis Via ROS-NLRP3-mediated Endothelial Cell Pyroptosis [J] Vol. 9, 171 (Cell death & disease, 2018). 2. [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (641.8KB, zip)
Supplementary Material 2 (219.6KB, pdf)

Data Availability Statement

All data from this study are available upon request (Bing Zhang drzhangbing@xjmu.edu.cn).


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES