Skip to main content
NCBI home page
European Journal of Medical Research logoLink to European Journal of Medical Research
. 2025 Dec 12;31:92. doi: 10.1186/s40001-025-03648-3

MYBL2 regulates the expression of CENPF in lung adenocarcinoma and promotes tumor development and metastasis through AKT pathway activation

Yan liu 1,✉, Feng Yu 1, Jiuyang Jiang 2, Hongmei Ma 3,✉
PMCID: PMC12817451  PMID: 41388437

Abstract

Objectives

Lung adenocarcinoma (LUAD) is a major global health burden with high mortality. Elevated expression of MYBL2 and CENPF is correlated with unfavorable clinical outcomes in LUAD. However, the relationship between MYBL2 and CENPF and the downstream signaling pathways of MYBL2 and CENPF in LUAD remains elusive.

Methods

We investigated MYBL2 and CENPF expression in TCGA data and clinical LUAD samples, identifying a significant correlation. Functional studies in A549 cells demonstrated that MYBL2 acts upstream of CENPF, promoting tumor proliferation and migration. This oncogenic effect was mediated through AKT signaling, as AKT inhibition phenocopied the suppressive effects of CENPF knockdown.

Results

Analysis of TCGA data and clinical specimens confirmed significant upregulation of MYBL2 and CENPF in LUAD compared to normal tissues. Their expression correlated positively with advanced disease stage and poorer prognosis across diverse patient subgroups. Functional studies demonstrated that MYBL2 acts upstream of CENPF, as its overexpression elevated CENPF levels, while its knockdown reduced them. CENPF depletion markedly attenuated LUAD cell proliferation and migration. Mechanistically, both MYBL2 overexpression and CENPF knockdown modulated AKT pathway activation, as evidenced by altered phosphorylation levels. Accordingly, pharmacological inhibition of AKT with GDC-0068 recapitulated the anti-tumor effects observed with CENPF knockdown.

Conclusions

The expression of MYBL2 and CENPF in lung adenocarcinoma increases with LUAD progression. MYBL2 regulates the expression of CENPF in LUAD, and the elevated CENPF promotes the proliferation and migration of LUAD cells. Both MYBL2 and CENPF regulate the proliferation and migration of LUAD through AKT pathway activation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s40001-025-03648-3.

Keywords: Lung adenocarcinoma, MYBL2, CENPF, p-AKT, Tumor metastasis

Highlights

  1. The expression of MYBL2 and CENPF increases as lung adenocarcinoma (LUAD) progresses.

  2. MYBL2 regulates CENPF in LUAD, and the increased CENPF promotes the proliferation and migration of LUAD.

  3. MYBL2 and CENPF regulate the proliferation and migration of LUAD through the AKT pathway.

  4. MYBL2 and CENPF contribute to the early metastasis of LUAD.

Supplementary Information

The online version contains supplementary material available at 10.1186/s40001-025-03648-3.

Introduction

Lung cancer imposes the greatest mortality burden, of which non-small cell lung cancer (NSCLC) represents the predominant histological classification [1–3]. This particular type of cancer presents a substantial hurdle for public health initiatives, given its frequent occurrence and the high death rates that accompany it. The primary histological subtypes of NSCLC collectively accounts for nearly 85% of all lung cancer cases. Among these, lung adenocarcinoma (LUAD) represents the predominant histological category [4, 5]. Even with the application of diverse therapeutic approaches including surgical intervention, chemotherapy, and targeted molecular therapy, the outlook for patients with lung adenocarcinoma continues to be poor [6, 7]. Therefore, the effective diagnosis and treatment of lung adenocarcinoma remain particularly challenging, underscoring the necessity for identifying novel therapeutic targets.

The MYB proto-oncogene like 2 (MYBL2), a conserved member of the Myb transcription factor family, plays a central role in orchestrating cell proliferation and survival [8]. Its overexpression significantly amplifies the transcriptional level, resulting in a substantial dysregulation of target gene expression across the genome [9].

The precise control of MYBL2 levels is essential for the formation of a competent complex and for the accurate modulation of gene expression [10]. In vitro studies have demonstrated that the overexpression of MYBL2 stimulates mitotic progression and cellular proliferation [7]. The ablation of MYBL2 leads to a failure in the formation of the inner cell mass and triggers early embryonic lethality [11, 12]. The dysregulation of MYBL2 is frequently observed across multiple human malignancies and is increasingly recognized as a candidate prognostic biomarker in breast cancer, colorectal carcinoma, and prostate cancer [13–19]. In lung adenocarcinoma, the levels of MYBL2 are elevated, and increased expression of MYBL2 is markedly linked to later stages of the disease and unfavorable prognosis.

Although it is well-established that MYBL2 overexpression supports tumor proliferation and survival in multiple cancer types, its downstream effector targets remain poorly characterized. The precise mechanisms through which MYBL2 dysregulation drives oncogenic processes and modulates malignant phenotypes remain incompletely elucidated.

The Centromere Protein F (CENPF) protein is a crucial constituent of the centromeric kinetochore complex, which plays a vital role in ensuring the accurate segregation of chromosomes during cell division. In addition, CENPF serves as an integral part of the nuclear matrix, particularly during the G2 phase of the cell cycle’s interphase, where it contributes to the structural integrity and function of the nucleus. The precise localization and function of CENPF underscore its significance in maintaining genomic stability and cellular order [20–22]. CENPF is closely linked to the prognosis following gene amplification [23]. Rattner et al. have shown that CENPF participates in the mitotic process and contributes to tumor growth [24]. CENPF demonstrates significant potential as a diagnostic biomarker for prostate cancer [25]. Tang discovered that silencing CENPF can impede the development of LUAD through the ERβ2/5 signaling pathway [26].

As a critical transcription factor, whether MYBL2 regulates the function of CENPF in lung adenocarcinoma and which signaling pathways might be affected are the focal points of our investigation. MYBL2 overexpression is a common occurrence in many types of cancers and may act as a prognostic indicator for several malignancies, including LUAD. In addition, the role of CENPF in facilitating the epithelial–mesenchymal transition (EMT) in NSCLC via the upregulation of ACKR3/CXCR7 has been emphasized. This implies that MYBL2 could potentially modulate CENPF’s activity in LUAD.

In this study, we explored the expression patterns of the transcription factor MYBL2 and CENPF in LUAD and their roles in the disease. By analyzing the TCGA database and clinical samples, we found that both MYBL2 and CENPF are highly expressed in LUAD and are closely associated with the malignant phenotype of the tumor. Further research indicates that MYBL2 and CENPF may regulate the biological functions of LUAD, including proliferation, migration, invasion, and apoptosis, through AKT pathway activation. In addition, we explored the role of MYBL2 and CENPF in the early metastasis of LUAD, which could provide potential molecular markers for future targeted therapies.

Methods

Lung adenocarcinoma transcriptome data analysis

Gene expression data from 460 LUAD specimens and 310 matched normal controls, sourced from the TCGA database, were analyzed utilizing the GEPIA2 platform. A standard analysis workflow was employed for this examination. Based on MYBL2/CENPF expression quartiles (upper and lower, n = 120 each), a comparison of survival outcomes was conducted via Kaplan–Meier and log-rank methods. Transcripts per million (TPM) was the metric used to ascertain expression levels, and for computational purposes, log (TPM + 1) was utilized.

Patients and clinical sample collection

All 28 patients diagnosed with lung adenocarcinoma (LUAD) in this study were recruited from First Affiliated Hospital of Harbin Medical University. We collect cancerous tissue and para-cancerous tissue. Disease stage was defined as Stages I, II, III, and IV, disease degree was defined as T1, T2, T3, and T4.

This study has been approved by the Ethics Committee of First Affiliated Hospital of Harbin Medical University Scientific Research/Ethical review NO.2024283. All 12 patients with metastatic LUAD in this study were enrolled from the First Affiliated Hospital of Harbin Medical University, and the analyzed samples were primary lung tumors. We collect metastatic lung adenocarcinoma tissues and corresponding non-metastatic lung adenocarcinoma tissues. All participants in this study provided voluntary informed consent in compliance with the Declaration of Helsinki.

Western blotting

Following collection, cells were lysed using RIPA buffer supplemented with protease and phosphatase inhibitors (Beyotime, China). Using a BCA assay (Beyotime, China) for quantification, 20 μg of total protein per lane was electrophoresed on a 10% SDS–PAGE gel (Bio-Rad) and subsequently electroblotted to a PVDF membrane. For western blotting, primary antibodies targeting MYBL2 (ab314862, 1:1000), CENPF (ab224813, 1:1000), and phosphorylated AKT (p-AKT) (ab133458, 1:1000)were obtained from Abcam (UK), while the GAPDH antibody (#2118, 1:1000) was sourced from Cell Signaling Technology (USA). We performed an overnight incubation of the membranes with primary antibodies at 4 °C. Protein bands were visualized using an enhanced chemiluminescence kit (Beyotime, China) after incubation with secondary antibodies. For phosphorylated protein analysis, the levels of p-AKT were normalized to the corresponding total AKT protein levels in the same sample.

RNA isolation and reverse transcription

Total RNA was isolated and clinical lung tissue specimens with TRIzol Reagent (Beyotime, China). Following RNA purification, complementary DNA (cDNA) synthesis was carried out using 1 μg of RNA template, oligo(dT) primers, and a 10 μL reverse transcription system.

RT–qPCR

The RT–qPCR was performed using the HiScript III RT SuperMix for qPCR (+ gDNA wiper) (Vazyme) on the AB (applied biosystems) ViiA 7 System. Finally, the relative levels of CENPF were determined using the 2−ΔΔCT method.

The primer sequences employed in RT–qPCR are detailed below:

Gene sequence orientation
GAPDH GTCTCCTCTGACTTCAACAGCG Forward
GAPDH ACCACCCTGTTGCTGTAGCCAA Reverse
MYBL2 CACCAGAAACGAGCCTGCCTTA Forward
MYBL2 CTCAGGTCACACCAAGCATCAG Reverse
CENPF AGCACGACTCCAGCTACAAGGT Forward
CENPF CATCATGCTTTGGTGTTCTTTCTG Reverse
Open in a new tab

Lentivirus-mediated MYBL2 shRNA and CENPF shRNA

MYBL2 shRNA targeting sequences is 5′-GAGGTGAAGAAGTCTTGCT-3′, CENPF shRNA targeting sequences is 5′-GGGUUCUCUUACCCUGAGAAUGA-3′; were constructed using pLKO.1 vector. For a control, we employed a non-targeting shRNA containing the scrambled sequence 5′-CCGGCAACAAGATGAAGAGCACCA-3′.Lentiviral particles encoding MYBL2–shRNA, CENPF–shRNA, or a non-targeting control shRNA were generated using a commercially available system. Target cells were transduced twice with viral supernatant collected at 36 and 72 h post-transfection, in the presence of 2 μg/ml polybrene (Sigma, USA).

Generation of plasmids and stable cell lines

The complete cDNA sequence for the MYBL2 was amplified via PCR and subsequently inserted into the pMSCV-puro-retro vector from Miaolingbio. The transfection of these plasmids into cells was executed using lipofectamine 3000 reagent by Invitrogen, following the guidelines provided by the manufacturer. To establish stable cell lines that express MYBL2, a retroviral infection method was employed, and the cells underwent selection with 0.5 μg/mL puromycin over a 2 week cultivation.

CCK8

To determine proliferative capacity, A549 monolayers were cultured in 96-well plates (4 × 103 cells/well) for 24 h. Metabolic activity was then determined spectrophotometrically at 450 nm using an MTT-based kit (Sigma-Aldrich).

Wound healing assay

A standardized wound healing assay was initiated in confluent A549 cultures by creating a denuded zone with a sterile pipette tip in 6-well plates. Cell migration into the wound gap was monitored at 0 and 24 h post-scratching using an inverted microscope, with images captured from 10 predetermined fields per group to ensure consistent location.

Transwell migration assay

To assess migratory capacity, we plated 3 × 105 A549 cells in serum-free medium into the upper chamber of 24-well transwell inserts. The lower chamber contained medium with 1% FBS as a chemoattractant. After 24 h, traversed cells on the membrane’s lower surface were fixed, stained with 0.1% crystal violet, and quantified by counting ten random microscopic fields per insert.

Apoptosis assay

Cell apoptosis was assessed utilizing the Annexin V-FITC/PI Apoptosis Detection Kit (Beyotime). In summary, around 2 million cells (2 × 106) were collected, and then dual-stained with both Annexin V-FITC and PI. The cells were subjected to analysis using a BD FACSLyric™ flow cytometer (BD Biosciences). Unstained cells and single-stained controls (Annexin V-FITC only and PI only) were used to establish the fluorescence compensation and set the quadrants. The gating strategy was as follows: cells were first gated on the FSC-A/SSC-A plot to exclude debris, and then the intact cell population was analyzed for Annexin V and PI staining to distinguish viable (Annexin V −/PI −), early apoptotic (Annexin V +/PI −), late apoptotic (Annexin V +/PI +), and necrotic (Annexin V −/PI +) cell populations.

Immunohistochemistry evaluation of MYBL2 and CENPF

Following deparaffinization, lung tissue sections were incubated with primary antibody of MYBL2 at 1:100 (Abcam, UK), CENPF at 1:100 (Abcam, UK), AKT at 1:100 (Abclonal, China), p-AKT at 1:100 (Abclonal, China) overnight at 4 ℃. The HRP-conjugated secondary antibody (Beyotime, China) at 1:50 was added for 1.5 h at room temperature on the next day. Ultimately, the positively stained cells were detected using DAB, and the tissue sections were subsequently counterstained with hematoxylin. Observations were made under a light microscope (Olympus BX53, Japan) at a magnification of × 20. For each sample, five sections were examined, with four random fields selected from each section for analysis.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 7 and ImageJ software. Data are presented as mean ± SD. Survival differences between patient subgroups were evaluated by Kaplan–Meier analysis with log-rank testing. Multivariate Cox proportional hazards regression was applied to assess independent prognostic factors. The prognostic value of the risk stratification was further examined using Kaplan–Meier curves to compare survival in high- and low-risk LUAD cohorts. The predictive performance of the gene signature was evaluated via time-dependent receiver operating characteristic (ROC) curve analysis, with AUC quantification. For comparisons between two groups, an unpaired two-tailed Student’s t test was used. For comparisons among more than two groups, one-way ANOVA followed by Tukey’s post-hoc test was applied. A p value < 0.05 was considered statistically significant.

Results

The expression of MYBL2 and CENPF increased in LUAD

We initially analyzed TCGA database and observed a significant upregulation of MYBL2 and CENPF in LUAD compared to adjacent normal tissues (Fig. 1A). Further analysis using paired box plots revealed that the expression levels of MYBL2 and CENPF were markedly higher in LUAD tissues than in normal tissues (Fig. 1B). To substantiate these findings, we performed RT–qPCR and western blot on clinical lung adenocarcinoma samples. Consistent results revealed a marked upregulation of MYBL2 and CENPF expression in lung adenocarcinoma tissues, showing an approximate threefold increase compared to normal adjacent tissues (Fig. 1C–F). These data suggest that MYBL2 and CENPF may be pivotal in the biology of LUAD, potentially influencing tumor initiation and progression.

Fig. 1.

Fig. 1

Open in a new tab

MYBL2 and CENPF exhibited elevated expression levels in lung adenocarcinoma. A TCGA database indicate that MYBL2 and CENPF exhibit markedly elevated expression in LUAD. B Comparative box plots highlight that MYBL2 and CENPF expression levels are significantly greater in LUAD.C RT–qPCR analysis indicates significantly higher MYBL2 mRNA expression in LUAD (n = 3). D RT–qPCR analysis indicates significantly higher CENPF mRNA expression in LUAD (n = 3). E Western blot analysis confirms significantly higher MYBL2 and CENPF protein expression in LUAD compared to normal tissues (n = 3). F Western blot analysis statistic (n = 3). Statistical analysis was performed using student’s t test. **, p < 0.01; ***, p < 0.001

Elevated MYBL2 and CENPF is associated with poor prognosis in patients with LUAD

To investigate the correlation of MYBL2 and CENPF with clinicopathological features in LUAD patients, we initially grouped patients by disease stage and grade. We then analyzed the expression levels of MYBL2 and CENPF across these groups using box plots. The results revealed the expression levels of MYBL2 and CENPF increasing correspondingly with higher disease stages (Fig. 2A, B) and grades (Fig. 2C, D). Furthermore, Kaplan–Meier analysis revealed that elevated MYBL2 and CENPF expression correlated with reduced survival in LUAD patients, highlighting their potential utility as prognostic biomarkers for lung adenocarcinoma (Fig. 2E, F). To determine their co-expression, we analyzed the TCGA–LUAD cohort and found a significant positive correlation between MYBL2 and CENPF mRNA levels (Supplementary Fig. 1).

Fig. 2.

Fig. 2

Open in a new tab

Clinical correlation of MYBL2 and CENPF with lung adenocarcinoma patients. A, B Levels of MYBL2 (A) and CENPF (B) in LUAD in different stages. C, D Levels of MYBL2 (C) and CENPF (D) in LUAD in different grades. E Kaplan–Meier survival curve analysis shows that MYBL2 (E) and CENPF (F) is associated with poor prognosis in LUAD. Statistical analysis was performed using student’s t test or one-way ANOVA followed by Tukey’s multiple comparisons test. *, p < 0.05; **, p < 0.01; ***, p < 0.001

MYBL2 regulates the expression of CENPF in A549

To explore the regulatory function of MYBL2 on CENPF in LUAD, we successfully established cell models with overexpression and knockdown of MYBL2 in the A549 cell line. RT–qPCR and western blot revealed that overexpression of MYBL2 increased the mRNA and protein expression of CENPF by twofold (Fig. 3A–C). Conversely, knockdown of MYBL2 significantly reduced CENPF expression by twofold (Fig. 3D–F). These data revealed a positive association between MYBL2 and CENPF in lung cancer.

Fig. 3.

Fig. 3

Open in a new tab

Overexpression of MYBL2 promotes the expression of CENPF, while the knockdown of MYBL2 inhibits CENPF. A, B mRNA of MYBL2 (A) and CENPF (B) in MYBL2 overexpressed cell line (n = 3). C MYBL2 and CENPF protein in MYBL2 overexpressed cell line (n = 3). D, E mRNA of MYBL2 (D) and CENPF (E) in MYBL2 knockdown cell line (n = 3). F Protein of MYBL2 and CENPF in MYBL2 knockdown cell line (n = 3). Statistical analysis was performed using student’s t test. **, p < 0.01; ***, p < 0.001

CENPF contributes to the enhancement of cell proliferation and migration in lung adenocarcinoma

To explore the impact of MYBL2 and CENPF in LUAD, we constructed CENPF knockdown cell lines in A549. The results revealed that knockdown of CENPF decreases the expression of CENPF by threefold (Fig. 4A, B). CCK-8 showed that the proliferation of A549 was enhanced by MYBL2 overexpression (Fig. 4C), while CENPF knockdown inhibited cell proliferation (Fig. 4D). Wound healing assays indicated that the migration ability of A549 was improved by MYBL2 overexpression (Fig. 4E) and decreased by CENPF knockdown (Fig. 4F).

Fig. 4.

Fig. 4

Open in a new tab

Expression of CENPF is associated with the enhancement of cell proliferation and the migratory capabilities in lung adenocarcinoma. A mRNA of CENPF in A549 after CENPF knockdown (n = 3). B Protein level of CENPF in A549 after CENPF knockdown (n = 3). C CCK8 indicates that the proliferation of A549 is enhanced after MYBL2 overexpression (n = 3). D CCK8 indicates that the proliferation of A549 is reduced after CENPF knockdown (n = 3). E Wound healing assay MYBL2 overexpression in A549 (n = 5). F Wound healing assay after CENPF knockdown in A549 (n = 5). Statistical analysis was performed using student’s t test. **, p < 0.01; ***, p < 0.001

MYBL2 and CENPF regulate the biological functions of lung adenocarcinoma via the PI3K/AKT signaling pathway

The PI3K/Akt pathway regulates critical cellular processes, such as proliferation, survival, and stress response, thereby influencing therapeutic outcome [27, 28]. Evidence suggests that PI3K/Akt signaling contributes to the invasiveness of various tumors and drives metastasis in lymphoma, lung, and head and neck cancers. Its activation is characterized by phosphorylation of AKT at key residues [29, 30]. Therefore, we investigated whether MYBL2 and CENPF promote the development of LUAD by promoting the phosphorylation level of AKT. Our results revealed that overexpression of MYBL2 in A549 increased the protein of p-AKT, and knockdown of MYBL2 significantly decreased p-AKT levels (Fig. 5A). CENPF knockdown led to a decrease in p-AKT (Fig. 5B). Ipatasertib (GDC-0068) is a selective small-molecule AKT phosphorylation inhibitor that has demonstrated efficacy in attenuating brain metastasis in PIK3CA-mutant breast cancer models [31, 32].

Fig. 5.

Fig. 5

Open in a new tab

Through the phosphorylation of AKT, MYBL2 and CENPF regulate the function of LUAD. A Western blot shows that p-AKT increase after MYBL2 overexpression, p-AKT decrease after MYBL2 knockdown in A549 (n = 3). B Western blot shows that p-AKT decrease after CENPF knockdown in A549 (n = 3). C CCK8 reveals that after MYBL2 overexpression and treating with GDC-0068, the proliferation capacity of A549 cells suppress (n = 3). D Wound healing assay indicates that after MYBL2 overexpression and treating with GDC-0068, the migratory capacity of A549 cells reduce (n = 5). E Transwell assay indicates that after MYBL2 overexpression and treatment with GDC-0068, the migratory capacity of A549 cells reduce (n = 5). F Apoptosis assay indicates that after MYBL2 overexpression and treatment with GDC-0068, the apoptosis levels in A549 cells increase (n = 3). Statistical analysis was performed using student’s t test or one-way ANOVA followed by Tukey’s multiple comparisons test. **, p < 0.01; ***, p < 0.001

We treated the A549 with GDC-0068 to assess its impact on the proliferation, migration, and apoptosis of A549. The results showed that treatment with inhibitors of the p-AKT significantly suppressed the proliferation and migration, and increased apoptosis levels (Fig. 5C–F).

By inhibiting AKT, we aimed to disrupt the signaling cascade that is often aberrantly active in A549. This strategy facilitates a deeper investigation into the functional contribution of AKT in LUAD pathogenesis and supports the evaluation of AKT-targeted inhibitors as a potential treatment modality.

The role of MYBL2 and CENPF in early metastasis of lung adenocarcinoma

Utilizing a cohort of clinical specimens from patients with LUAD, we systematically investigates the contributions of MYBL2 and CENPF to early metastatic progression in this malignancy. Initially, we collected metastatic LUAD tissues (M-LAC) and corresponding non-metastatic LUAD tissues (non-M-LAC). RT–qPCR, western blot, and immunohistochemistry (IHC) showed that MYBL2 and CENPF are increased in metastatic LUAD compared to non-metastatic lung adenocarcinoma (Fig. 6A–C).

Fig. 6.

Fig. 6

Open in a new tab

MYBL2 and CENPF promote early metastasis of lung adenocarcinoma. A mRNA of MYBL2 and CENPF in M-LAC are higher than in non-M-LAC (n = 3). B Protein of MYBL2 and CENPF in M-LAC are higher than in non-M-LAC (n = 3). C IHC results indicate MYBL2 and CENPF in M-LAC are higher than in non-M-LAC (n = 3). D Protein of p-AKT in M-LAC is higher than in non-M-LAC (n = 3). E IHC results indicate the p-AKT in M-LAC is higher than in non-M-LAC (n = 3). Statistical analysis was performed using student’s t test. **, p < 0.01; ***, p < 0.001

To further explore the mechanisms of MYBL2 and CENPF in LUAD, we detected the phosphorylated AKT (p-AKT) in metastatic LUAD tissues and corresponding non-metastatic LUAD tissues (Fig. 6D–F). Metastatic lung adenocarcinoma tissues exhibited markedly elevated p-AKT expression relative to non-metastatic counterparts, implying that MYBL2 and CENPF might facilitate early metastasis through activation of the PI3K/AKT pathway.

In lung adenocarcinoma, both MYBL2 and CENPF are upregulated. MYBL2 enhances CENPF expression and induces AKT phosphorylation. Suppression of AKT activation attenuates the proliferation of lung adenocarcinoma and impedes tumorigenesis (Fig. 7).

Fig. 7.

Fig. 7

Open in a new tab

MYBL2 regulates the expression of CENPF in LUAD through the p-AKT

Discussion

Lung carcinoma continues to rank among the most widespread oncologic disorders across the globe, constituting a major worldwide medical challenge [33, 34]. Targeted therapies against proliferation-related signaling pathways have emerged as key treatment strategies. In LUAD, frequent overexpression of MYBL2 is observed and demonstrates a strong correlation with disease progression and unfavorable prognosis. Similarly, CENPF has been implicated in EMT and tumor proliferation, and its knockdown suppresses tumor progression. The frequent dysregulation of the PI3K/Akt pathway in cancer promotes tumorigenesis via its modulation of vital cellular activities including proliferation and metastasis, as well as constituents of the tumor microenvironment. This study focuses on the transcriptional regulator MYBL2 and its regulatory target CENPF in LUAD. We demonstrate that MYBL2 upregulates CENPF expression and enhances AKT phosphorylation, highlighting its therapeutic potential.

Furthermore, it is important to acknowledge a limitation of this study. While our data demonstrate a clear regulatory relationship between MYBL2 and CENPF, the precise mechanistic nature of this regulation remains to be fully elucidated. More importantly, while we establish that the MYBL2–CENPF axis promotes AKT phosphorylation, the broader context within the complex PI3K/AKT/mTOR signaling network warrants further discussion. It remains to be further explored whether MYBL2 binds to the promoter region of CENPF to regulate its expression. Chromatin immunoprecipitation (ChIP) assays, for instance, could provide critical insights into whether MYBL2 indeed binds to the TSS of CENPF, similar to its interaction with the NCAPH gene, which has been previously demonstrated [35]. In addition, the PI3K/Akt pathway encompasses a multitude of proteins, with AKT regulating downstream proteins, such as mTOR. Whether the alteration of p-AKT in lung adenocarcinoma further affects the expression of proteins like mTOR is a question that warrants further investigation.

In this study, we selected GDC-0068 as an inhibitor of AKT and have observed promising results. While the observed anti-tumor effects strongly support the involvement of AKT signaling, this interpretation must be tempered by the inherent limitations of pharmacological inhibition. The potential for off-target effects, albeit limited for this well-characterized inhibitor, cannot be entirely ruled out. Nevertheless, given the broad range of AKT inhibitors available, it is essential to determine whether other inhibitors can also suppress the functions of lung adenocarcinoma. Moreover, it is imperative to determine whether GDC-0068 can demonstrate comparable therapeutic efficacy in mouse models of lung adenocarcinoma. Such studies will not only validate the potential of GDC-0068 as a therapeutic agent but also provide a broader understanding of the mechanisms by which AKT inhibitors can suppress lung adenocarcinoma. Furthermore, this study did not investigate the downstream effectors of AKT (e.g., mTOR), leaving the precise mechanistic cascade within this pathway an open question. These deserve future exploration and could potentially reveal new strategies for the treatment of LUAD.

Conclusion

During the progression of LUAD, the expression of MYBL2 and CENPF is significantly upregulated. The transcription factor MYBL2 directly modulates CENPF expression in tumor tissues. Furthermore, MYBL2 and CENPF promote cellular proliferation and migration in LUAD through activation of AKT phosphorylation, a mechanism critically involved in disease advancement.

Supplementary Information

40001_2025_3648_MOESM1_ESM.docx (2.2MB, docx)

Supplementary Material 1. Supplementary Fig. 1. MYBL2 expression is positively correlated with CENPF in LUAD

40001_2025_3648_MOESM2_ESM.docx (18.4KB, docx)

Supplementary Material 2. Supplementary Table 1. Clinical characteristics of the LUAD patient cohort

Author contributions

Contributions: (I) Conception and design: Yan liu;(II) Administrative support: Feng Yu, Hongmei Ma; (III) Provision of study materials or patients: Jiuyang Jiang; (IV) Collection and assembly of data: Yan liu; (V) Data analysis and interpretation: Yan liu; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

Data availability

The datasets, analysis scripts, and raw data (including full Western blot images) generated during this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent for participation

The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Yan liu, Email: 810437@hrbmu.edu.cn.

Hongmei Ma, Email: Mahm77lw@163.com.

References

  • 1.Jemal A, Bray F, Center MM, et al. Global cancer statistics. CA Cancer J Clin. 2011;61(2):69–90. [DOI] [PubMed] [Google Scholar]
  • 2.New M, Keith R. Early detection and chemoprevention of lung cancer. F1000Res. 2018;7:61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49. [DOI] [PubMed] [Google Scholar]
  • 4.Peng Y, Zhang W, Chen Y, et al. Engineering c-Met-CAR NK-92 cells as a promising therapeutic candidate for lung adenocarcinoma. Pharmacol Res. 2023;188:106656. [DOI] [PubMed] [Google Scholar]
  • 5.Cai Y, Sheng Z, Dong Z, et al. EGFR inhibitor CL-387785 suppresses the progression of lung adenocarcinoma. Curr Mol Pharmacol. 2023;16(2):211–6. [DOI] [PubMed] [Google Scholar]
  • 6.Schild SE, Tan AD, Wampfler JA, et al. A new scoring system for predicting survival in patients with non-small cell lung cancer. Cancer Med. 2015;4(9):1334–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Howington JA, Blum MG, Chang AC, et al. Treatment of stage I and II non-small cell lung cancer: diagnosis and management of lung cancer, 3rd ed: American College of Chest Physicians evidence-based clinical practice guidelines. Chest. 2013;143(5):e278S-e313S. [DOI] [PubMed] [Google Scholar]
  • 8.Sandberg ML, Sutton SE, Pletcher MT, et al. c-Myb and p300 regulate hematopoietic stem cell proliferation and differentiation. Dev Cell. 2005;8(2):153–66. [DOI] [PubMed] [Google Scholar]
  • 9.Heinrichs S, Conover LF, Bueso-Ramos CE, et al. MYBL2 is a sub-haploinsufficient tumor suppressor gene in myeloid malignancy. Elife. 2013;2:e825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yuan J, Zhang Y, Sheng Y, et al. MYBL2 guides autophagy suppressor VDAC2 in the developing ovary to inhibit autophagy through a complex of VDAC2-BECN1-BCL2L1 in mammals. Autophagy. 2015;11(7):1081–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ward C, Volpe G, Cauchy P, et al. Fine-tuning Mybl2 is required for proper mesenchymal-to-epithelial transition during somatic reprogramming. Cell Rep. 2018;24(6):1496–511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lorvellec M, Dumon S, Maya-Mendoza A, et al. B-Myb is critical for proper DNA duplication during an unperturbed S phase in mouse embryonic stem cells. Stem Cells. 2010;28(10):1751–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Shi H, Bevier M, Johansson R, et al. Prognostic impact of polymorphisms in the MYBL2 interacting genes in breast cancer. Breast Cancer Res Treat. 2012;131(3):1039–47. [DOI] [PubMed] [Google Scholar]
  • 14.Clarke M, Dumon S, Ward C, et al. MYBL2 haploinsufficiency increases susceptibility to age-related haematopoietic neoplasia. Leukemia. 2013;27(3):661–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fujii K, Murase T, Beppu S, et al. MYB, MYBL1, MYBL2 and NFIB gene alterations and MYC overexpression in salivary gland adenoid cystic carcinoma. Histopathology. 2017;71(5):823–34. [DOI] [PubMed] [Google Scholar]
  • 16.Liang HB, Cao Y, Ma Q, et al. MYBL2 is a potential prognostic marker that promotes cell proliferation in gallbladder cancer. Cell Physiol Biochem. 2017;41(5):2117–31. [DOI] [PubMed] [Google Scholar]
  • 17.Musa J, Aynaud MM, Mirabeau O, et al. MYBL2 (B-Myb): a central regulator of cell proliferation, cell survival and differentiation involved in tumorigenesis. Cell Death Dis. 2017;8(6):e2895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Shao M, Ren Z, Zhang R. MYBL2 protects against H9c2 injury induced by hypoxia via AKT and NF‑kappaB pathways. Mol Med Rep. 2018;17(3):4832–8. [DOI] [PubMed] [Google Scholar]
  • 19.Jia Y, Gao Y, Li J, et al. Prognostic implications of MYBL2 in resected Chinese gastric adenocarcinoma patients. Onco Targets Ther. 2019;12:1129–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bomont P, Maddox P, Shah JV, et al. Unstable microtubule capture at kinetochores depleted of the centromere-associated protein CENP-F. EMBO J. 2005;24(22):3927–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Varis A, Salmela AL, Kallio MJ. Cenp-F (mitosin) is more than a mitotic marker. Chromosoma. 2006;115(4):288–95. [DOI] [PubMed] [Google Scholar]
  • 22.Liao H, Winkfein RJ, Mack G, et al. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. J Cell Biol. 1995;130(3):507–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Margolin AA, Wang K, Lim WK, et al. Reverse engineering cellular networks. Nat Protoc. 2006;1(2):662–71. [DOI] [PubMed] [Google Scholar]
  • 24.Rattner JB, Rao A, Fritzler MJ, et al. CENP-F is a .ca 400 kDa kinetochore protein that exhibits a cell-cycle dependent localization. Cell Motil Cytoskeleton. 1993;26(3):214–26. [DOI] [PubMed] [Google Scholar]
  • 25.Aytes A, Mitrofanova A, Lefebvre C, et al. Cross-species regulatory network analysis identifies a synergistic interaction between FOXM1 and CENPF that drives prostate cancer malignancy. Cancer Cell. 2014;25(5):638–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hexiao T, Yuquan B, Lecai X, et al. Knockdown of CENPF inhibits the progression of lung adenocarcinoma mediated by ERbeta2/5 pathway. Aging (Albany NY). 2021;13(2):2604–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wu P, Hu YZ. PI3K/Akt/mTOR pathway inhibitors in cancer: a perspective on clinical progress. Curr Med Chem. 2010;17(35):4326–41. [DOI] [PubMed] [Google Scholar]
  • 28.Burris HR. Overcoming acquired resistance to anticancer therapy: focus on the PI3K/AKT/mTOR pathway. Cancer Chemother Pharmacol. 2013;71(4):829–42. [DOI] [PubMed] [Google Scholar]
  • 29.Fumarola C, Bonelli MA, Petronini PG, et al. Targeting PI3K/AKT/mTOR pathway in non small cell lung cancer. Biochem Pharmacol. 2014;90(3):197–207. [DOI] [PubMed] [Google Scholar]
  • 30.Vander BR, Mohan S, Eytan DF, et al. The PI3K/Akt/mTOR axis in head and neck cancer: functions, aberrations, cross-talk, and therapies. Oral Dis. 2015;21(7):815–25. [DOI] [PubMed] [Google Scholar]
  • 31.Ippen FM, Grosch JK, Subramanian M, et al. Targeting the PI3K/Akt/mTOR pathway with the pan-Akt inhibitor GDC-0068 in PIK3CA-mutant breast cancer brain metastases. Neuro Oncol. 2019;21(11):1401–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yu L, Wei J, Liu P. Attacking the PI3K/Akt/mTOR signaling pathway for targeted therapeutic treatment in human cancer. Semin Cancer Biol. 2022;85:69–94. [DOI] [PubMed] [Google Scholar]
  • 33.Liao H, Cao Y, Hu C, et al. Oxygen-producing and pH-responsive targeted DNA nanoflowers for enhanced chemo-sonodynamic therapy of lung cancer. Mater Today Bio. 2024;25:101005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Joshi AS, Bapat MV, Singh P, et al. Viridibacillus culture derived silver nanoparticles exert potent anticancer action in 2D and 3D models of lung cancer via mitochondrial depolarization-mediated apoptosis. Mater Today Bio. 2024;25:100997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Xiong YC, Wang J, Cheng Y, et al. Overexpression of MYBL2 promotes proliferation and migration of non-small-cell lung cancer via upregulating NCAPH. Mol Cell Biochem. 2020;468(1–2):185–93. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

40001_2025_3648_MOESM1_ESM.docx (2.2MB, docx)

Supplementary Material 1. Supplementary Fig. 1. MYBL2 expression is positively correlated with CENPF in LUAD

40001_2025_3648_MOESM2_ESM.docx (18.4KB, docx)

Supplementary Material 2. Supplementary Table 1. Clinical characteristics of the LUAD patient cohort

Data Availability Statement

The datasets, analysis scripts, and raw data (including full Western blot images) generated during this study are available from the corresponding author upon reasonable request.

Articles from European Journal of Medical Research are provided here courtesy of BMC

RESOURCES