Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jan 21.
Published in final edited form as: Insect Biochem Mol Biol. 2024 Nov 20;176:104216. doi: 10.1016/j.ibmb.2024.104216

Suppression of the H3K27me3 demethylase disrupts diapause formation in mosquito Culex pipiens

Xueyan Wei 1, Prabin Dhungana 1, Kaylah Callender 2, Berhanu Zewde 2, Fu Chen 3, Sung Joon Kim 2,4, Cheolho Sim 1,4
PMCID: PMC12818347  NIHMSID: NIHMS2126762  PMID: 39577709

Abstract

Diapause (D) is a hormonally controlled alternative developmental pathway that allows mosquitoes to survive harsh winter conditions. Key characteristics of mosquito diapause include elevated lipid storage, enhanced stress and cold endurance, and extended longevity. These phenotypic changes are often associated with dynamic alterations in the transcriptome and epigenome. In our previous study, we identified significantly lower H3K27me2 levels in the fat body (FB) of diapausing Culex pipiens. However, the specific roles of the repressive H3K27 methylation marks in mosquito diapause have not been investigated. In the present study, we employed the effective histone lysine demethylase inhibitor GSK-J4 to assess the functions of H3K27me3 levels in the fat body on diapause initiation and phenotypes in Cx. pipiens. Results from solid-state NMR (ssNMR), Fourier-transform infrared spectroscopy (FTIR), and biochemical assays suggest that elevated H3K27me3 levels via GSK-J4 inhibition led to disrupted accumulation of lipids and glycogen in diapausing mosquitoes. GSK-J4 treatment also increased the mortality rate, resulting in lower survivability in treated mosquitoes. Together, these findings propose a crucial role for H3K27me3 in diapause formation, particularly related to energy metabolism. Our results provide a potential target for novel vector control strategies for this species.

Keywords: H3K27me3, diapause, mosquitoes, solid-state NMR, ATR-FTIR, lipid

1. Introduction

Mosquito diapause in Culex pipiens is accompanied by various phenotypic and behavioral changes, including increased fat accumulation, enhanced stress and cold tolerance, halted reproduction, and extended lifespan. Changes in photoperiod are recognized as the primary environmental cue to induce diapause, and effector genes downstream of the circadian clock regulators have been identified (Chang, 2020; Dhungana et al., 2023). The fat body is one of the most vital organs during diapause formation and maintenance, playing crucial roles in energy metabolism and acting as the main storage depot of energy reserves, which aids in the survival of mosquitoes during the winter season (Arrese and Soulages, 2010). During diapause, mosquitoes accumulate extra fat reserves and suppress energy metabolism through the functions of the fat body (Hahn and Denlinger, 2011). Glycogen and triacylglyceride (TAG) serve as the most abundant carbohydrate and fat reserves in most diapausing insects, respectively. The fat body is the primary site for both glycogen and fatty acid synthesis, making it an essential organ in diapausing mosquitoes.

Epigenetic regulations, including DNA methylation, histone modification, and non-coding RNAs, have been extensively studied in many diapausing insects and are known to have regulatory functions during diapause (Pegoraro et al., 2016; Poupardin et al., 2015; Reynolds et al., 2013; Yocum et al., 2015). While some research on epigenetic regulation of diapause exists, few studies have explored its possible role in the mosquito Cx. pipiens. Through an immunoblot screening of various histone methylation marks, we identified that H3K27me2, a repressive histone mark, is significantly reduced in the fat body of diapausing Cx. pipiens (Wei et al., 2023). H3K27 methylations are associated with suppressed chromatin states and are deposited by the polycomb repressive complex 2 (PRC2) (Laugesen et al., 2019). Low levels of H3K27me3 have been linked to prolonged longevity in Drosophila and the cotton bollworm (Lu et al., 2013; Ma et al., 2018). H3K27 methylation levels are balanced by both histone methyltransferase PRC2 members and histone demethylases UTX and JMJD3. Elevated histone demethylase activity has also been connected to a healthy lifespan. In C. elegans, the histone demethylases PHF8, JMJD3, and UTX function as positive lifespan regulators, and overexpression of utx-1 extended the longevity of the worms (Guillermo et al., 2021; Merkwirth et al., 2016). Our transcriptomic study also found upregulated utx expression in the fat body of diapausing mosquitoes, suggesting a potential regulatory role of this histone demethylase in diapause formation (Wei et al., 2024).

To further investigate the epigenetic regulation of diapause initiation in Cx. pipiens, we first utilized dsi-RNA targeting utx gene to knockdown the expression of utx and identified any phenotypic impact of the knockdown. Then, GSK-J4, a potent histone lysine demethylase inhibitor specifically targeting H3K27 demethylases (Fig. 2A), to inhibit the demethylation function of UTX in diapausing mosquitoes and assessed its effects on diapause formation. GSK-J4, a histone demethylase inhibitor specific to KDM6A and KDM6B, has been extensively studied across various organisms and demonstrated roles in inflammation modulation, cancer treatment, and acute myeloid leukemia (Dalpatraj et al., 2023.; Kruidenier et al., 2012; Li et al., 2018). Our immunoblot results showed that GSK-J4 treatment elevated levels of H3K27me3 in the fat body. Following GSK-J4 injection, the total lipid and glycogen accumulations were determined. To monitor the effects of histone lysine demethylase inhibition on glucose metabolism and its accumulation during diapause, the GSK-J4-injected mosquitoes were fed exclusively with 10% D-[13C6]glucose (Fig. 3A). Lyophilized mosquitoes were then analyzed using 13C solid-state nuclear magnetic resonance (SSNMR) (Chang et al., 2016; Olademehin et al., 2020). The 13C isotope from the uniformly 13C-labeled D-[13C6]glucose is NMR active, allowing us to monitor 13C-labeled glycogen and lipids metabolized from the provisioned D-[13C6]glucose in diapause-programmed mosquitoes using SSNMR to provide a direct measure of the chemical composition. The total lipid and glycogen accumulations in the lyophilized mosquito samples, following the solid-state NMR measurements, were measured without further preparation using attenuated total reflection Fourier-transform infrared spectroscopy (ATR-FTIR) for rapid quantification of protein, lipids, and glycogen (King et al., 2020; Olademehin et al., 2020). Both biochemical and spectroscopy experiments showed that GSK-J4 injection interfered with lipid and glycogen accumulation. We also found that GSK-J4-induced H3K27me3 elevation possibly altered the saturation of fatty acids in the fat body, leading to a lower ratio of unsaturated fatty acids. Finally, GSK-J4 treatment caused a higher mortality rate in diapausing mosquitoes compared to non-diapause (ND) counterparts, suggesting its potential role in lifespan regulation. In summary, our data reveal an epigenetic mechanism that alters diapause phenotypes in Cx. pipiens.

Figure 2. GSK-J4 injection increased the abundance of H3K27me3 in the fat body of diapausing mosquitoes.

Figure 2.

(A) Chemical structure of GSK-J4 which is a potent histone lysine demethylase inhibitor. (B) qRT-PCR results showed that mRNA levels of utx were not affected by the GSK-J4 treatment 7 days post-injection. (C) Diapausing mosquitoes injected with GSK-J4 exhibited elevated abundance of H3K27me3 compared to control-injected 7 days post-injection (adjusted p = 0.0021). Standard errors are depicted by error bars.

Figure 3. 13C-isotope labeling of GSK-J4 injected Culex pipiens and analysis by solid-state NMR.

Figure 3.

(A) Solid-state NMR samples were prepared by injecting diapausing female Cx. pipiens, within 1 day after eclosion, with GSK-J4 into the thorax of cold-anesthetized mosquitoes. Mosquitoes were then fed with 13C-isotope labeled D-[13C6]glucose (1g/100mL), and after 7 days of feeding, the 13C-labeled mosquitoes were frozen and then lyophilized. 13C-CPMAS NMR measurements on lyophilized intact mosquitoes were performed to determine the impact of GSK-J4 inhibition of H3K27me3 on the utilization and storage of provisioned D-[13C6]glucose during the diapause. (B) 125 MHz 13C-CPMAS spectrum of Control-injected diapausing females fed for 7 days with 10% d-[13C6]glucose (bottom, blue) shown with 13C-natural abundance spectrum (bottom, gray). Both spectra are normalized to 175-ppm intensity of the peptidyl-carbonyl carbons. The difference spectrum (top, black) is spectral subtraction of the 13C-natural abundance from the 13C-labeled spectrum. (C) 13C-CPMAS spectrum of GSK-J4 injected diapausing females (bottom, red) is shown with 13C-natural abundance spectrum (bottom, gray). The difference spectrum is shown at the top. All spectra were the result of 1000 acquisitions. Magic-angle spinning was at 10 kHz and the proton-carbon matched cross-polarization ramp was at 50 kHz with a 2-ms contact time. (D) The enlarged 13C-CPMAS spectra for O-alkyl carbons of Control-injected (bottom, blue) and GSK-J4 injected diapausing female Cx. pipiens (bottom, red) following 7 days feeding with 10% d-[13C6]glucose. The difference spectrum is shown at the top of the figure (black). (E) The enlarged 13C-CPMAS spectra for aliphatic carbons with the difference spectrum is shown at the top. The injection of GSK-J4 affected the utilization of d-[13C6]glucose for the biosynthesis of glycogen and lipids in diapausing Cx. pipiens.

2. Material and methods

2.1. Insect rearing

The Cx. pipiens colony originated from larvae collected in Columbus, OH, supplemented with field-collected mosquitoes from Dr. Megan Meuti’s lab at Ohio State University in 2009 and 2022. The colony was maintained under a 15 h:9 h light:dark (L:D) photoperiod at 25°C and 75% relative humidity (RH), according to established protocols (Sim and Denlinger, 2008). Larvae hatched from blood-fed adult females were placed in plastic trays with distilled water (300 individuals per tray) and fed TetraMin® fish flakes. Pupae ready for eclosion were transferred to cages with a 10% sucrose solution. Diapause induction involved transferring second-instar larvae to an 18°C chamber with 75% RH and a 9 h:15 h L:D photoperiod. Non-diapause mosquitoes were obtained from our main colony and reared at 18°C with 75% RH and a 15h:9h L:D photoperiod. Diapause confirmation was carried out by measuring primary follicle and germarium lengths, and ovarian development stage assessment based on described techniques (Christophers, 1911).

2.2. Synthetic Dicer-Substrate siRNA treatment

To perform RNA interference (RNAi) against the utx gene, we utilized dicer-substrate short interfering RNAs (DsiRNAs) obtained from Integrated DNA Technologies (IDT, Coralville, IA). DsiRNA sequences were validated through BLAST analysis to ensure no significant homology to Cx. pipiens genes other than utx. The sequences used were as follows: dsi-utx: 5'- rGrCrGrUrCrGrArGrCrUrUrCrUrCrCrGrArUrArArGrArUCA; 3'- rUrGrArUrCrUrUrArUrCrGrGrArGrArArGrCrUrCrGrArCrGrCrCrU. For control experiments, we employed a scrambled negative control (dsi-control) lacking significant sequence homology to any Cx. pipiens genes: 5'- rGrArArGrArGrCrArCrUrGrArUrArGrArUrGrUrUrArGrCGT; 3'- rArCrGrCrUrArArCrArUrCrUrArUrCrArGrUrGrCrUrCrUrUrCrCrG. Control-injected mosquitoes did not exhibit significant differences from wild-type mosquitoes for any of the phenotypes measured in this study. Each mosquito was injected with 200-400 nl of dsiRNA using a microinjector.

2.3. GSK-J4 injection

A stock solution of GSK-J4 (Selleck Chemicals) at 50 mM was dissolved in dimethyl sulfoxide (DMSO) to preserve stability. Serial dilutions of GSK-J4 were tested in mosquitoes to determine the optimal working concentration (Fig. S1). The stock solution was then diluted with sufficient PBS to achieve a final concentration of 3.67 mM for treatment. Newly eclosed female mosquitoes, reared under diapause-inducing conditions, were subjected to intrathoracic injection with GSK-J4 at 3.67 mM. Control mosquitoes received injections of the same solvent used for the GSK-J4 solution (DMSO + PBS). Following injection, mosquitoes were maintained at 18°C with 75% RH and a 9 h:15 h L:D photoperiod, and subsequent analyses were conducted at 3- and 7-days post-injection.

2.4. Western blot

We followed the protocol described in our previous study (Wei et al., 2023). Briefly, protein extracts were prepared from the fat bodies of females at 2- and 7-days post dsi-RNA treatment or 7-days post-injection with GSK-J4 and control, as well as from mosquitoes reared under diapause-inducing and non-diapause-inducing conditions. The extraction was performed using a histone extraction kit in accordance with the manufacturer’s instructions (Abcam, MA, USA), and histone concentrations were measured using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific). Subsequently, 10 μg of protein samples were mixed with an equal volume of 2X loading buffer (200 mM Tris, 10% SDS, 50% glycerol, 400 mM dithiothreitol, 0.1% Coomassie Blue) and heated to 95°C for 5 min before loading onto a 10% SDS gel. The proteins were then transferred to a polyvinylidene fluoride membrane (Whatman, Florham Park, NJ, USA), which was subsequently blocked with 5% low-fat dried milk in tris-buffered saline (TBS) and 0.2% Tween 20 for 1 hour. Primary antibodies against H3K27me3 (Millipore, 07-449) were diluted in blocking buffers as per the manufacturer's recommendations and incubated overnight at 4°C. The membrane was then incubated with the anti-rabbit-HRP secondary antibody (Cell Signaling Technology, Beverly, MA, USA) at room temperature for 1 hour. Chemiluminescent detection was performed using LumiGLO chemiluminescent reagent (KPL; Gaithersburg, MD, USA) and a BioRad ChemiDoc MP Imager (BioRad). The experiments were repeated three times with biological replicates with each containing approximately 30 fat bodies. Changes in protein levels were analyzed using ImageJ, normalized to control immunoblots, and expressed as fold-change relative to controls. Anti-H3 (Abcam, ab1791) was used as the loading control.

2.5. Quantitative real-time PCR

For qRT-PCR gene expression validation, we extracted total RNAs from the fat bodies of both GSK-J4-injected and control-injected samples using TRIzol reagent (Life Technologies, Carlsbad, CA, USA). Each extraction comprised samples from approximately 30 mosquitoes that were 7 days post-injection. About 1 μg of RNA was reverse transcribed using SuperScript III RNase H- reverse transcriptase (Invitrogen, Carlsbad, CA, USA), following the manufacturer's protocol. To measure relative expression levels, synthesized cDNAs were utilized in qPCR validation on the Rotor-Gene Q real-time PCR detection system (QIAGEN, Germantown, MD, USA). Ct values from the qRT-PCR validations were analyzed using the delta-delta Ct method. Ribosomal protein L19 (RpL19) served as an endogenous housekeeping gene for internal control. The qRT-PCR primers used were for q-utx: CCTGCACAAATC-GATCGAGG and CGTCGTGGACCTTGTTGATC; and for q-rpl19: CGCTTTGTTTGATCGTGTGT and CCAATCCAGGAGTGCTTTTG. Three biological replicates were repeated for each gene.

2.6. 13C-isotope labeling of Cx. pipiens

GSK-J4 injected female Cx. pipiens after adult eclosion were fed for 7 days on sponges soaked with 10% glucose solution containing 1% 13C-labeled D-[13C6]glucose with an isotopic enrichment of 99%, purchased from Cambridge Isotope Laboratories, Inc. (Andover, MA). After the 7-day feeding, the mosquitoes were frozen at −80 °C then lyophilized for three days.

2.7. Solid-state NMR

Solid-state 13C cross-polarization magic-angle spinning (CPMAS) NMR was collected on 11.75-T (proton radio frequency of 500 MHz) Bruker Avance NEO with a double resonance HX probe. 13C-CPMAS NMR was performed as described earlier.1,2 Briefly, lyophilized mosquitoes were contained in a 3.2-mm outer diameter zirconia rotor with Kel-F endcap spinning at 10 kHz. The proton-carbon matched cross-polarization ramp was at 50 kHz with a 2-ms contact time. The proton dipolar decoupling was achieved by applying continuous-wave spinal64 on the 1H channel during acquisition. The π pulse length was 2.5 μs for 1H and the recycle delay was 5s. The line broadening for the spectrum was 50 Hz.

2.8. FTIR

FTIR spectra were obtained using PerkinElmer 100 Spectrometer with universal ATR sampling containing a diamond crystal, equipped with LiTaO3 detector with speed of 0,2 cm/s and working at room temperature. Source is MIR and Beam splitter of OptKBR. Spectra acquisition was performed in the 650–4000 cm−1 range with 4 cm−1 resolution with data spacing of 1 cm−1, after 100 scans. Fourier transform was performed with strong apodization. Powdered lyophilized mosquito samples, following the solid-state NMR measurements, were removed from the zirconia rotor, and then measured directly without any further preparation. Background measurement of air was taken and automatically subtracted from the sample measurements. Spectra were acquired from five randomly selected locations across the sample to minimize sampling bias. Between measurements, the ATR crystal was carefully cleaned using acetone (Sigma-Aldrich, analytical standard) and dried with light-duty tissue wipers.

2.9. Fat body staining

The fat bodies were extracted at 3 and 7 days after mosquitoes were injected with GSK-J4 and the control, as well as from non-injected mosquitoes under diapause (D) and non-diapause (ND) rearing conditions. Fixed fat body tissues were stained with BODIPY 493/503 (Invitrogen) diluted in 1x PBS to a final concentration of 1 mg/mL. Images of stained fat bodies were taken using a Zeiss Axioskop fluorescent microscope.

2.10. Lipid and glycogen measurement

Modified metabolic assays adapted from Van Handel (1985 and 1988) were used to measure lipid and glycogen levels in individual female adults following injections with GSK-J4 and the control. Each experimental group consisted of 10-15 mosquitoes. For lipid level measurement, each mosquito was homogenized in 0.2 ml of chloroform:methanol (1:1) mixture. After evaporation of solvents on a hot plate, 0.2 ml of sulfuric acid was added, followed by heating at 37°C for 10 mins. Subsequently, 2 ml of vanillin reagent (0.12% vanillin in 68% phosphoric acid) was added to each tube, allowing colors to develop for 5 minutes. The absorbance of each tube was then measured at 525 nm and plotted against a standard curve generated using sesame oil (Sigma, S3547). For glycogen level measurement, each mosquito was homogenized in 0.2 ml of 2% sodium sulfate, followed by the addition of 1 ml of methanol and centrifugation for 1 min. Supernatants were evaporated on a hot plate, and 2 ml of anthrone reagent (0.14% anthrone in 28% sulfuric acid) was added to each tube. After incubation for 15 mins at 37°C, the absorbance at 625 nm was recorded. Absorbance measurements were then plotted against a standard curve created using pure glycogen (Sigma, G0885).

2.11. Survival assay

To assess the phenotypic effects of GSK-J4 injection on the lifespan of diapausing mosquitoes, cohorts of ≥20 newly-eclosed female mosquitoes were intrathoracically injected with GSK-J4 and the control. The injected mosquitoes were then maintained at 18°C, 75% relative humidity, and a 9:15 L:D photoperiod, with access to 10% sucrose solutions for the initial 7 days post-injection. Survival activity was recorded every 5 days until 35 days post-injection. Cumulative survival probabilities were visualized using a Kaplan-Meier curve, and the significance of the difference in survivability was assessed through a log-rank (Mantel-Cox) test. This experiment was repeated three times with biological replicates.

2.12. Measurement of egg follicle length

Primary egg follicle lengths were measured following ovary dissection in 0.9% NaCl solution. Individual follicles were mechanically separated using fine needles and examined under a light microscope, with images captured via Motic X camera. For quantification, ten egg follicles from each of fifteen female mosquitoes were measured, and mean follicle lengths were calculated for each mosquito.

2.13. Statistical analyses

A one-way ANOVA, followed by Tukey’s HSD test, was performed to analyze the relative protein levels in the western blot analyses. A Student’s t-test was conducted to assess the significance of relative mRNA levels in the qRT-PCR experiments. For the quantification of lipid and glycogen levels, a one-way ANOVA followed by Tukey’s HSD test was used. Finally, a log-rank (Mantel-Cox) test was employed to evaluate the significance of differences in survivability in the survival assay. The threshold for statistical significance is set at p < 0.05.

3. Results

3.1. RNA interference against utx altered H3K27me3 levels and lipid and glycogen accumulation in diapausing mosquitoes

Previously, we identified significantly lower H3K27 methylation levels in the fat bodies of diapausing mosquitoes (Wei et al., 2023). To assess the functional importance of H3K27 methylations in diapause regulation, we targeted the H3K27 histone demethylase UTX for an RNAi knockdown study. Injection of dsi-utx resulted in significant reduction of utx mRNA levels both 2- and 7-days post-injection (Fig. 1A).

Figure 1. RNAi knockdown of utx elevated H3K27me3 levels and interfered with lipid and glycogen accumulation.

Figure 1.

(A) qRT-PCR showing mRNA levels of utx in dsi-utx injected mosquitoes compared to controls 2- and 7-days after injection. (B) Western blot images showing H3K27me3 levels in dsi-utx treated mosquitoes 7 days after injection. (C) Measurement of total lipid and glycogen contents of diapausing mosquitoes for 7-days post-injection using the Van Handel method. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Standard errors are depicted by error bars.

We then quantified H3K27me3 levels in dsi-utx injected mosquitoes. Our results demonstrated that dsi-utx treatment significantly elevated H3K27me3 abundance (Fig. 1B). Subsequently, we measured lipid and glycogen levels, the most prominent features of diapause, in the injected mosquitoes. As anticipated, both lipid and glycogen levels were reduced in dsi-utx injected individuals (Fig. 1C). Together, our data suggests that the knockdown of the histone demethylase gene utx significantly impacts H3K27me3 levels and key diapause-associated metabolic markers.

3.2. GSK-J4 injection elevated H3K27me3 levels in the fat body of diapausing Cx. pipiens

To assess the role of H3K27me3 in diapause, we administered the histone demethylase inhibitor GSK-J4 via intrathoracic injection to newly eclosed mosquitoes reared under diapause-inducing conditions, anticipating an increase in the abundance of H3K27me3 in the fat bodies. We first investigated whether GSK-J4 affects the transcription of the histone demethylase gene utx. qRT-PCR analysis indicated that utx mRNA levels remained unchanged 7 days post-injection (Fig. 2B), suggesting that GSK-J4 functions by inhibiting the enzymatic activity of UTX rather than its transcription in Cx. pipiens. We then evaluated its effect on H3K27me3 levels in diapausing mosquitoes. Western blot analyses conducted 7 days post-injection confirmed elevated H3K27me3 protein levels in the fat bodies, comparable to those in non-diapausing mosquitoes (Fig. 2C). GSK-J4 treatment was also administered to non-diapausing mosquitoes to evaluate the specificity of this drug in Cx. pipiens. The H3K27me3 levels in the fat body of GSK-J4-treated non-diapausing mosquitoes remained comparable to those of control mosquitoes (p>0.05) (Fig. S2).

3.3. 13C-labeled glucose is utilized for the biosynthesis of glycogen and lipid in diapausing Cx. pipiens.

SSNMR was used to determine the 13C-labeled glycogen and lipid accumulations in GSK-J4 injected diapausing mosquitoes that were fed exclusively with 10% d-[13C6]glucose for 7 days. Figure 2 shows the 13C-CPMAS spectra of diapause programmed female Culex pipiens that were Control-injected (Fig. 3B, bottom blue) or GSK-J4 injected (Fig. 3C, bottom red) and then fed with 10% d-[13C6]glucose for 7 days. The carbon chemical shift assignments for the glycogen, as shown in Fig 2B, are as follows: 62 ppm to C6; 73 ppm to C2, C3, and C5; 83 to C4; and peaks in 93-103 ppm are assigned to C1 of glucose. The difference spectrum is a result of spectral subtraction of the 13C-natural abundance from the 13C-labeled spectrum (Figure 2, top). The dominant appearance of O-alkyl carbon resonances indicates that the provisioned d-[13C6]glucose during diapause is primarily routed to glycogen biosynthesis. In addition, d-[13C6]glucose is also routed to lipid biosynthesis as evident by the i) increased CH2 aliphatic carbon intensities at 30 and 33 ppm, ii) a sharp ethylene carbon at 130 ppm, which is not observed in the natural abundance spectrum, corresponding to highly mobile olefin carbons of unsaturated lipids, and iii) a visible should at 180 ppm that corresponds to the carboxyl carbons of fatty acids in the spectrum of d-[13C6]glucose-fed mosquitoes.

3.4. GSK-J4 treatment interfered with the glycogen and lipid accumulations in diapausing Cx. pipiens.

The 13C-CPMAS spectrum of GSK-J4 injected mosquitoes (Figure 2C) shows a visible decrease in the 13C-labeled glycogen accumulation which indicated that the reduction in the H3K27me3 levels in the fat body by GSK-J4 interfered with glycogen biosynthesis in diapausing mosquitoes. This change is clearly visible in Figure 2 which shows the overlapping 13C-CPMAS spectra of Control (bottom, blue) and GSK-J4 injected mosquitoes (bottom, red). The difference spectrum of O-alkyl carbons (Fig. 3D, top), resonances at 61, 73, 93, and 97 ppm are consistent with the reduction in the accumulation of 13C-labeled glycogen accumulation as a result of GSK-J4 injection. Similarly, the difference spectrum of aliphatic carbons (Fig. 3E, top) shows resonances at 14 and 33 ppm corresponding to CH3 and CH2 carbons, respectively, are consistent with the diminished lipid accumulations in GSK-J4 injected diapausing Cx. pipiens.

3.5. FTIR absorption band assignments.

Total lipid, protein, and glycogen accumulation in control and GSK-J4 injected diapausing females of Cx. pipiens fed with 10% d-[13C6]glucose for 7 days post-adult eclosion were also monitored using ATR-FTIR (Fig. 4). FTIR spectra of powdered samples unpacked from the zirconium rotor following the solid-state NMR measurements are shown in Figure 4A, and the spectra of individual thorax of lyophilized intact mosquitos are shown in Figure 4B. The FTIR spectrum of the powdered sample, consisting of multiple individuals, was identical to the spectrum collected from the thorax of an intact individual mosquito.

Figure 4. ATR-FTIR spectra of Control and GSK-J4 injected diapausing female Cx. pipiens.

Figure 4.

(A) Average ATR-FTIR spectra of Control (black) and GSK-J4 (red) injected diapausing females of Cx. pipiens, fed with 10% d-[13C6]glucose for 7 days post-adult eclosion. The unpacked powdered samples were analyzed after solid-state NMR measurements. Each spectrum represents an average of four independent FTIR spectra, each resulting from 100 scans collected on multiple samples. The FTIR spectra were normalized to the amide I intensity at 1642 cm−1. Injection with GSK-4J resulted in a substantial decrease in the carbohydrate storage, indicated by a reduction in intensity at 1017 cm−1, corresponding to the absorption band for C-OH stretching. (B) Average ATR-FTIR spectra of four individual mosquitoes injected with Control (black) and GSK-J4 (red). The FTIR was collected on the thorax region of each individual insect. The FTIR spectra of powdered and intact thorax of mosquito are near identical, indicating that the injection of GSK-J4 prevents glycogen accumulation in diapausing females. (C) Difference spectrum obtained by subtracting the FTIR spectrum of the powdered GSK-J4 injected sample from the powdered Control-injected sample (black). The FTIR spectrum of glycogen is shown as a gray dotted line. (D) Difference spectrum obtained by subtracting the FTIR spectrum of the thorax of a GSK-J4 injected individual from the thorax of a Control-injected sample. The FTIR spectrum of glycogen is shown in gray dotted line. (E) Enlarged signature regions for proteins, lipids, and carbohydrates from spectra shown in a).

All spectra were normalized with respect to the fingerprint region of protein between 1600 to 1700 cm−1, specifically to amide I, which appears as a broad band centered at 1642 cm−1. The second-order derivative spectrum reveals two absorbances centered at 1651 and 1631 cm−1 assigned to peptide backbone stretching for C=O, C-C, and C-N. Amide II also appeared as a broadband consisting of 1510 and 1580 cm−1, which are assigned to in-plane N-H bending vibrations, and C-N and C-C stretching vibrations.

Lipids have characteristic absorption bands in the 3000 to 2800 cm−1 regions. The absorption band at 2956 cm−1 is assigned to antisymmetric stretching vibrations of CH3, which appears as a should to 2920 cm−1, assigned to CH2 antisymmetric stretch. The absorption band at 2850 cm−1 is assigned to symmetric stretching vibration of CH2. Additionally, lipids have characteristic absorption bands at 1745 cm−1, assigned to symmetric stretching vibration of C=O, and at 1468 cm−1, assigned to bending vibration CH2 scissoring (Tamm and Tatulian, 1997). These absorption bands are predominantly observed in the IR spectrum of vegetable oil.

The IR absorption bands for glycogens are found in the 950-1200 cm−1 regions. The absorbance at 3200 cm−1 is due to O-H stretching. The band at 1149 cm−1 is attributed to COC and CC stretching modes of glycosidic linkage and asymmetric ring stretching. The absorbances at 1017 cm−1 to COH stretching, and 1078 cm−1 to in-plane bending of COH. The absorbance at 991 cm−1 is due to in-plane bending for CH2, and COH, and CO and COC stretching of glycosidic linkage (Wiercigroch et al., 2017).

3.6. FTIR analysis shows GSK-J4 injected mosquitoes did not accumulate glycogen.

The difference spectrum by subtracting the FTIR spectrum of the powdered GSK-J4 injected sample from that of the powdered control injected sample is shown in Figure 4C. The corresponding difference spectrum for the FITR spectrum from the thorax of individual mosquito is shown in Figure 4D. Both difference spectra show a large significant reduction in carbohydrates, evident by the 1017 cm−1 absorption band corresponding to C-OH stretching. Additionally, a peak centered around 3200 cm−1 in the difference spectra corresponding to the O-H bond stretching is observed. The difference FTIR spectrum is similar to the glycogen spectrum shown as gray dotted line in Figures 4C and 4D. Thus, the FTIR spectra of GSK-J4 injected mosquitos show an overall reduction of glycogen in diapausing mosquitoes compared to the control-injected individuals.

3.7. Reduced fat body cells and diminished lipid accumulation in GSK-J4-injected mosquitoes

To further assess the effect of GSK-J4 treatment on mosquito fat accumulation, we compared the sizes of mosquito abdomens and lipid droplets in fat bodies using dissecting and fluorescence microscopes. Fluorescence images of BODIPY 493/503-stained fat body cells from the abdomen showed reductions in both total lipid amounts and lipid droplet sizes in injected mosquito fat bodies compared to controls at both day 3 and day 7 post-injection (Fig. 5 A&B). The size and total amount of fat body cells in GSK-J4-injected mosquitoes were comparable to those in ND mosquitoes. Besides using SSNMR to evaluate glucose utilization for glycogen and lipid synthesis, we also performed well-established biochemical assays (Van Handel, 1985a) to measure total lipid and glycogen levels. At days 3 and 7 post-injection, GSK-J4-treated mosquitoes showed significantly reduced lipid storage (p<0.05) compared to controls (Fig. 6A & B). While altered glycogen levels were not observed on day 3, significantly lower glycogen levels were detected on day 7 post-GSK-J4 injection (Fig. 6C & D). Together, these findings suggest that GSK-J4 treatment reduces fat body lipid droplet sizes, as well as glycogen and lipid accumulation in diapausing mosquitoes.

Figure 5. Fluorescence microscope images showed differences in lipid droplet and body sizes between D, ND, Control-injected, and GSKJ4-injected fat bodies.

Figure 5.

at (A) 3 days and (B) 7 days post-injection. All mosquitoes were fed a 10% sucrose solution. Lipid droplets were stained with BODIPY 493/503 (green). Black scale bars represent 2 mm, and white scale bars indicate 100 μm.

Figure 6. GSK-J4 treatment inhibited lipid and glycogen accumulation in diapausing mosquitoes.

Figure 6.

Measurement of total lipid (A-B) and glycogen (C-D) contents of individual diapausing mosquitoes fed on 10% sucrose for 3- and 7-days post-injection using the Van Handel method. N=15 for all groups. The significance levels were denoted as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Standard errors are depicted by error bars.

3.8. GSK-J4 injection disturbed mosquito survival during diapause and promoted reproductive development

Diapausing mosquitoes can survive up to five months, significantly longer than their non-diapausing counterparts (Mitchell and Briegel, 1989). To determine if GSK-J4 treatment affects this extended lifespan, we monitored the survival of GSK-J4-injected mosquitoes. GSK-J4-injected mosquitoes and control mosquitoes were placed in separate cages with access to 10% sucrose solutions for 7 days post-injection. All mosquitoes were maintained under diapause-inducing conditions. Mortality rates in each cage were recorded up to 35 days post-injection. The GSK-J4-injected mosquitoes displayed an increased mortality rate compared to controls, with the elevated mortality persisting until day 35 post-injection, resulting in a significantly reduced survival rate (Fig. 7A) (Table S1). Our survival assay results suggest that the increase in H3K27me3 levels caused by GSK-J4 treatment directly impacts the extended longevity of early diapausing mosquitoes. To evaluate GSK-J4's effect on reproductive development, another key indicator of diapause, we measured primary egg follicle lengths 7 days post-treatment. GSK-J4-treated mosquitoes exhibited significantly larger egg follicles compared to controls, indicating enhanced follicular development following GSK-J4 treatment (Fig. 7B).

Figure 7. GSK-J4 injection reduced the survivability of diapausing mosquitoes and promoted egg follicles development.

Figure 7.

(A) survival rate post-injection for GSK-J4 (N=64) and control (N=71). A Kaplan-Meier curve was used to visualize the cumulative survival probabilities. A log-rank (Mantel-Cox) test was conducted to test the significance of the difference in survivability (p<0.0001). (B) Measurement of primary egg follicle cell lengths in GSK-J4-treated and control diapausing mosquitoes 7 days post-injection. The significance levels were denoted as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Standard errors are depicted by error bars.

4. Discussion

Epigenetic regulations, including DNA methylation, histone modification, and small RNA regulation, play a crucial role in all phases of diapause in insect species (Reynolds, 2017). Changes in histone modifications, such as histone methylation and acetylation, have been associated with the formation and maintenance of diapause in many insects (Hickner et al., 2015; Poupardin et al., 2015; Reynolds et al., 2016). H3K27me3 is a repressive histone mark typically associated with inactive promoters and silenced gene transcription, regulated by the Polycomb repressive complex 2 (PRC2) and histone demethylase UTX. Although H3K27me3 has been studied in other diapausing insect species, its specific role in mosquito diapause has not been elucidated. In this study, we examined the effect of H3K27me3 demethylase knockdown on mosquito diapause through the administration of dsi-utx and GSK-J4, an inhibitor of histone demethylase UTX. Our results revealed that H3K27me3 contributes to the accumulation of energy storage and extended lifespan in diapausing Cx. pipiens, likely through the inhibition of related gene expression.

To elucidate the functions of UTX and its effects on H3K27me3 and diapause phenotypes, we administered dsi-RNA targeting the utx gene and assessed its impact on distinctive diapause features, including lipid and glycogen accumulation. Our results demonstrated that dsi-utx reduced utx transcription, leading to decreased H3K27me3 abundance in the fat bodies of diapausing mosquitoes. This reduction in H3K27me3 abundance was coupled with disrupted lipid and glycogen accumulation. Together, these data suggest that UTX mediates H3K27me3 demethylation, and alteration of utx expression significantly impacts the metabolic hallmarks of diapause in mosquitoes.GSK-J4 is a histone demethylase inhibitor specific to KDM6A and KDM6B. It has been studied in various organisms and demonstrated roles in inflammation modulation, cancer treatment, and acute myeloid leukemia (Dalpatraj et al., n.d.; Kruidenier et al., 2012; Li et al., 2018). However, GSK-J4 has not been used to characterize insect diapause. In our previous study, we identified significantly lower levels of H3K27me2 in the fat body of diapausing mosquitoes (Wei et al., 2023). To elucidate the functional roles of this repressive histone mark, we used GSK-J4 to study the effect of altered H3K27me3 abundance in the fat body on diapause phenotypes in Cx. pipiens. Western blot analysis showed that H3K27me3 levels significantly increased in the fat body of diapausing mosquitoes post-GSK-J4 treatment, reverting to levels comparable to those in non-diapausing fat bodies. We also measured the mRNA level of utx in the fat body to confirm the mechanism of GSK-J4 and observed no significant differences in expression levels. This indicates that GSK-J4 exerts its inhibitory effect by interfering with the enzymatic activity of UTX, rather than through mRNA degradation, aligning with previous studies in human hepatic cells (Pediconi et al., 2019).

SSNMR is a powerful technique for studying the composition, dynamics, and structure of biomolecules including carbohydrates, proteins, and lipids. We used this analytical technique to investigate the utilization of 13C-labeled glucose during the diapause for the biosyntheses of glycogen and lipids, and their accumulations in GSK-J4-injected mosquitoes. The 13C-CPMAS spectrum of GSK-J4-injected mosquitoes exhibited a conspicuous decrease in the accumulation of glycogen and lipids. In addition to spectroscopy analyses, we quantified the total lipid and glycogen levels in individuals using the Van Handel biochemical assay. The biochemical assays revealed that the total lipid levels were significantly lower in GSK-J4-injected mosquitoes, which contrasted the 13C-CPMAS spectrum of GSK-J4-injected mosquitoes showing only a slight reduction in the accumulations of 13C-labeled lipids resulting from d-[13C6]glucose utilization. Furthermore, FTIR analysis of GSK-J4-injected mosquitoes, both powdered samples used for SSNMR measurements and the thorax of intact individuals, showed no visible reduction in lipid, monitored by absorption band intensities at 2956, 2920 cm−1, and 1745 cm−1. While SSNMR data was in reasonable agreement with FTIR, it contrasted the significant reduction in total lipid in GSK-J4-injected mosquitoes, comparable to non-diapausing insects, quantified using modified methods described by Van Handel.

One potential explanation for the discrepancy in lipid quantification by spectroscopic and biochemical analysis is that the Van Handel assay, a vanillin-based lipid detection method that relies on the reaction of phospho-vanillin with unsaturated aliphatic carbons of lipids, is insensitive to saturated lipids. Therefore, the reduction in total lipids observed with the Van Handel assay, despite no changes detected by SSNMR and FTIR, suggests that GSK-J4 injection may have altered the lipid chemical composition accompanied by an increase in lipid saturation. Furthermore, an increase in the abundance of free fatty acids, as observed in diapausing face flies, can potentially reduce the apparent total lipid content measured using vanillin-based lipid detection but without affecting the chemical composition of lipids measured by NMR or FTIR. An upsurge in the percentage of unsaturated fatty acids during diapause has been documented in many organisms (Valder et al., 1969; Vukašinović et al., 2015). The desaturation of fatty acids during mosquito diapause has been reported in the Asian tiger mosquito, Aedes albopictus. Transcriptomic studies in this species identified genes responsible for the synthesis of unsaturated fatty acids in diapause-destined mosquitoes (Huang et al., 2015; Reynolds et al., 2012). The increased ratio of unsaturated fatty acids during mosquito diapause is thought to enhance membrane fluidity in response to low temperatures and desiccation resistance (Reynolds et al., 2012; Sushchik et al., 2013). Therefore, the results of our analyses suggest that diapausing Cx. pipiens accumulate more unsaturated fatty acids to elevate membrane fluidity and improve cold tolerance. The increased H3K27me3 levels caused by GSK-J4 treatment likely induced fat hydrogenation, converting unsaturated fatty acids into saturated fatty acids, leading to decreased stress resistance in diapausing mosquitoes.

FTIR analysis demonstrated a visible decrease in glycogen accumulation in the fat bodies of GSK-J4-injected mosquitoes. Glycogen levels measured by the anthrone assay also showed a statistically significant reduction 7 days after GSK-J4 injection in diapausing mosquitoes. Fluorescence microscopy images of the mosquito fat body, stained with BODIPY 493/503, revealed that GSK-J4 treatment reduced fat body lipid droplet sizes in diapausing mosquitoes. While BODIPY staining effectively visualizes triacylglycerol (TAG) accumulations in lipid droplets found in fat bodies, it is not effective for staining free fatty acids, which do not form lipid droplets but are dispersed throughout the cells. Therefore, the reduced lipid droplets in BODIPY-stained GSK-J4-injected mosquitoes indicate a reduction of TAG but not free fatty acids. TAG serves as a critical energy reserve stored in the fat body, providing the required energy to maintain metabolism during diapause and enhancing mosquito survival (Pinch et al., 2021). Our results indicate that GSK-J4 interferes with lipid droplet sizes and TAG accumulation in the fat body.

Lastly, a survival assay was conducted to evaluate the effect of GSK-J4 on the lifespan of diapausing mosquitoes. A significant increase in mortality rate was observed in the GSK-J4-injected mosquitoes 35 days post-injection. We also examined GSK-J4's influence on reproductive development, another critical marker of diapause, by measuring primary egg follicle dimensions. The analysis revealed significantly enlarged egg follicles in GSK-J4-treated mosquitoes. Thus, these findings demonstrate that modulation of H3K27me3 levels affects not only fat body physiology but also broadly influences multiple diapause-associated phenotypes. We propose a model for the modulation of H3K27me3 abundance in the fat body and its effects on diapause phenotypes in Cx. pipiens (Fig. 8). Diapausing mosquitoes exhibit lower levels of H3K27me3 in the fat body, which allows for enhanced transcription factor (TF) accessibility, resulting in elevated gene expression and diapause phenotypes, including increased fat reserves, elevated glycogen accumulation, and extended longevity. Conversely, the elevation of H3K27me3 levels due to the inhibition of histone demethylase triggers the formation of heterochromatin, restricting TF accessibility. This leads to diminished fat and glycogen levels and shortened longevity, a state comparable to non-diapause mosquitoes.

Figure 8. Schematic model of the regulation of H3K27me3 abundance in the fat body and its effects on diapause phenotypes in Cx. pipiens.

Figure 8.

Diapause-destined mosquitoes exhibit lower levels of the repressive histone mark H3K27me3, leading to more open chromatin with increased transcription, which contributes to diapause phenotypes. When mosquitoes are injected with the histone demethylase inhibitor GSK-J4, histone demethylase activity is reduced, resulting in tightened chromatin and restricted access to transcription factors. This change leads to decreased transcription of genes associated with diapause, shifting the phenotypes towards a non-diapause state.

Conclusion

In this study, we evaluated the effect of the histone demethylase inhibitor GSK-J4 on diapause formation in the mosquito Cx. pipiens. Our results demonstrated a profound influence of H3K27me3 abundance on diapause phenotypes. Administration of GSK-J4 inhibited histone demethylase activity in the fat body, significantly reduced lipid and glycogen levels, altered the saturation of fatty acids, and decreased the lifespan of diapausing mosquitoes, making them comparable to non-diapause mosquitoes. Our study provides novel insights into the epigenetic regulation during mosquito diapause. Future studies exploring the gene targets of H3K27me3 could unveil the specific regulatory network behind this complex process.

Supplementary Material

Supplementary Table
Supplementary Figures

Highlight.

  • GSK-J4 treatment elevated H3K27me3 levels in the fat body of diapausing mosquito Cx. pipiens.

  • Increased H3K27me3 levels disrupted lipid and glycogen accumulation in diapausing mosquitoes.

  • The extended lifespan in diapausing mosquitoes was interrupted by GSK-J4 treatment.

Acknowledgement

This work was supported in part by the National Institutes of Health under grant number R15AI139861 National Science Foundation under grant number IOS-1944214.

Abbreviation:

ATR-FTIR

Attenuated total reflection Fourier-transform infrared spectroscopy

CPMAS

cross-polarization magic-angle spinning

Glc

glucose

FOXO

forkhead of transcription factors

SSNMR

solid-state nuclear magnetic resonance

TAG

triacylglyceride

5. References

  1. Arrese EL, Soulages JL, 2010. Insect Fat Body: Energy, Metabolism, and Regulation. Annu. Rev. Entomol 55, 207–225. 10.1146/annurev-ento-112408-085356 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chang J, Singh J, Kim S, Hockaday WC, Sim C, Kim SJ, 2016. Solid-state NMR reveals differential carbohydrate utilization in diapausing Culex pipiens. Sci. Rep 6, 37350. 10.1038/srep37350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chang V., 2020. Circadian transcription factors differentially regulate features of the adult overwintering diapause in the Northern house mosquito, Culex pipiens. Insect Biochem. Mol. Biol 10. [DOI] [PubMed] [Google Scholar]
  4. Dalpatraj N, Naik A, Thakur N, n.d. GSK-J4: An H3K27 histone demethylase inhibitor, as a potential anti-cancer agent. Int. J. Cancer 2023. 10.1002/ijc.34559 [DOI] [PubMed] [Google Scholar]
  5. Dhungana P, Wei X, Meuti M, Sim C, 2023. Identification of CYCLE targets that contribute diverse features of circadian rhythms in the mosquito Culex pipiens. Comp. Biochem. Physiol. Part D Genomics Proteomics 48, 101140. 10.1016/j.cbd.2023.101140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Guillermo ARR, Chocian K, Gavriilidis G, Vandamme J, Salcini AE, Mellor J, Woollard A, 2021. H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner. BMC Biol. 19, 59. 10.1186/s12915-021-00984-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hahn DA, Denlinger DL, 2011. Energetics of Insect Diapause. Annu. Rev. Entomol 56, 103–121. 10.1146/annurev-ento-112408-085436 [DOI] [PubMed] [Google Scholar]
  8. Hickner PV, Mori A, Zeng E, Tan JC, Severson DW, 2015. Whole transcriptome responses among females of the filariasis and arbovirus vector mosquito Culex pipiens implicate TGF-β signaling and chromatin modification as key drivers of diapause induction. Funct. Integr. Genomics 15, 439–447. 10.1007/s10142-015-0432-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Huang X, Poelchau MF, Armbruster PA, 2015. Global Transcriptional Dynamics of Diapause Induction in Non-Blood-Fed and Blood-Fed Aedes albopictus. PLoS Negl. Trop. Dis 9, e0003724. 10.1371/journal.pntd.0003724 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. King B, Li S, Liu C, Kim SJ, Sim C, 2020. Suppression of glycogen synthase expression reduces glycogen and lipid storage during mosquito overwintering diapause. J. Insect Physiol 120, 103971. 10.1016/j.jinsphys.2019.103971 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kruidenier L, Chung C, Cheng Z, Liddle J, Che K, Joberty G, Bantscheff M, Bountra C, Bridges A, Diallo H, Eberhard D, Hutchinson S, Jones E, Katso R, Leveridge M, Mander PK, Mosley J, Ramirez-Molina C, Rowland P, Schofield CJ, Sheppard RJ, Smith JE, Swales C, Tanner R, Thomas P, Tumber A, Drewes G, Oppermann U, Patel DJ, Lee K, Wilson DM, 2012. A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response. Nature 488, 404–408. 10.1038/nature11262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Laugesen A, Højfeldt JW, Helin K, 2019. Molecular Mechanisms Directing PRC2 Recruitment and H3K27 Methylation. Mol. Cell 74, 8–18. 10.1016/j.molcel.2019.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Li Y, Zhang M, Sheng M, Zhang P, Chen Z, Xing W, Bai J, Cheng T, Yang F-C, Zhou Y, 2018. Therapeutic potential of GSK-J4, a histone demethylase KDM6B/JMJD3 inhibitor, for acute myeloid leukemia. J. Cancer Res. Clin. Oncol 144, 1065–1077. 10.1007/s00432-018-2631-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lu Y-X, 吕宇轩, Denlinger DL, Xu W-H, 徐卫华, 2013. Polycomb Repressive Complex 2 (PRC2) Protein ESC Regulates Insect Developmental Timing by Mediating H3K27me3 and Activating Prothoracicotropic Hormone Gene Expression. J. Biol. Chem 288, 23554–23564. 10.1074/jbc.M113.482497 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ma Z, Wang Hui, Cai Y, Wang Han, Niu K, Wu X, Ma H, Yang Y, Tong W, Liu F, Liu Z, Zhang Y, Liu R, Zhu Z-J, Liu N, 2018. Epigenetic drift of H3K27me3 in aging links glycolysis to healthy longevity in Drosophila. eLife 7, e35368. 10.7554/eLife.35368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Merkwirth C, Jovaisaite V, Durieux J, Matilainen O, Jordan SD, Quiros PM, Steffen KK, Williams EG, Mouchiroud L, Uhlein SN, Murillo V, Wolff SC, Shaw RJ, Auwerx J, Dillin A, 2016. Two Conserved Histone Demethylases Regulate Mitochondrial Stress-Induced Longevity. Cell 165, 1209–1223. 10.1016/j.cell.2016.04.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Mitchell CJ, Briegel H, 1989. Inability of Diapausing Culex pipiens (Diptera: Culicidae) to Use Blood for Producing Lipid Reserves for Overwinter Survival. J. Med. Entomol 26, 318–326. 10.1093/jmedent/26.4.318 [DOI] [PubMed] [Google Scholar]
  18. Olademehin OP, Liu C, Rimal B, Adegboyega NF, Chen F, Sim C, Kim SJ, 2020. Dsi-RNA knockdown of genes regulated by Foxo reduces glycogen and lipid accumulations in diapausing Culex pipiens. Sci. Rep 10, 17201. 10.1038/s41598-020-74292-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pediconi N, Salerno D, Lupacchini L, Angrisani A, Peruzzi G, De Smaele E, Levrero M, Belloni L, 2019. EZH2, JMJD3, and UTX epigenetically regulate hepatic plasticity inducing retro-differentiation and proliferation of liver cells. Cell Death Dis. 10, 518. 10.1038/s41419-019-1755-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Pegoraro M, Bafna A, Davies NJ, Shuker DM, Tauber E, 2016. DNA methylation changes induced by long and short photoperiods in Nasonia. Genome Res. 26, 203–210. 10.1101/gr.196204.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Pinch M, Mitra S, Rodriguez SD, Li Y, Kandel Y, Dungan B, Holguin FO, Attardo GM, Hansen IA, 2021. Fat and Happy: Profiling Mosquito Fat Body Lipid Storage and Composition Post-blood Meal. Front. Insect Sci 1. 10.3389/finsc.2021.693168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Poupardin R, Schöttner K, Korbelová J, Provazník J, Doležel D, Pavlinic D, Beneš V, Koštál V, 2015. Early transcriptional events linked to induction of diapause revealed by RNAseq in larvae of drosophilid fly, Chymomyza costata. BMC Genomics 16, 720. 10.1186/s12864-015-1907-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. R, C.S., 1911. The development of the egg follicle in anophelines. Paludism 2, 73–88. [Google Scholar]
  24. Reynolds JA, 2017. Epigenetic Influences on Diapause, in: Advances in Insect Physiology. Elsevier, pp. 115–144. 10.1016/bs.aiip.2017.03.003 [DOI] [Google Scholar]
  25. Reynolds JA, Bautista-Jimenez R, Denlinger DL, 2016. Changes in histone acetylation as potential mediators of pupal diapause in the flesh fly, Sarcophaga bullata. Insect Biochem. Mol. Biol 76, 29–37. 10.1016/j.ibmb.2016.06.012 [DOI] [PubMed] [Google Scholar]
  26. Reynolds JA, Clark J, Diakoff SJ, Denlinger DL, 2013. Transcriptional evidence for small RNA regulation of pupal diapause in the flesh fly, Sarcophaga bullata. Insect Biochem. Mol. Biol 43, 982–989. 10.1016/j.ibmb.2013.07.005 [DOI] [PubMed] [Google Scholar]
  27. Reynolds JA, Poelchau MF, Rahman Z, Armbruster PA, Denlinger DL, 2012. Transcript profiling reveals mechanisms for lipid conservation during diapause in the mosquito, Aedes albopictus. J. Insect Physiol 58, 966–973. 10.1016/j.jinsphys.2012.04.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sim C, Denlinger DL, 2008. Insulin signaling and FOXO regulate the overwintering diapause of the mosquito Culex pipiens. Proc. Natl. Acad. Sci 105, 6777. 10.1073/pnas.0802067105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sushchik NN, Yurchenko YA, Gladyshev MI, Belevich OE, Kalachova GS, Kolmakova AA, 2013. Comparison of fatty acid contents and composition in major lipid classes of larvae and adults of mosquitoes (Diptera: Culicidae) from a steppe region. Insect Sci. 20, 585–600. 10.1111/j.1744-7917.2012.01582.x [DOI] [PubMed] [Google Scholar]
  30. Tamm LK, Tatulian SA, 1997. Infrared spectroscopy of proteins and peptides in lipid bilayers. Q. Rev. Biophys 30, 365–429. 10.1017/s0033583597003375 [DOI] [PubMed] [Google Scholar]
  31. Valder SM, Hopkins TL, Valder SA, 1969. Diapause induction and changes in lipid composition in diapausing and reproducing faceflies, Musca autumnalis. J. Insect Physiol 15, 1199–1214. 10.1016/0022-1910(69)90230-3 [DOI] [Google Scholar]
  32. Van Handel E., 1985a. Rapid determination of total lipids in mosquitoes. J. Am. Mosq. Control Assoc 1, 302–304. [PubMed] [Google Scholar]
  33. Van Handel E., 1985b. Rapid determination of glycogen and sugars in mosquitoes. J. Am. Mosq. Control Assoc 1, 299–301. [PubMed] [Google Scholar]
  34. Vukašinović EL, Pond DW, Worland MR, Kojić D, Purać J, Popović ŽD, Grubor-Lajšić G, 2015. Diapause induces remodeling of the fatty acid composition of membrane and storage lipids in overwintering larvae of Ostrinia nubilalis, Hubn. (Lepidoptera: Crambidae). Comp. Biochem. Physiol. B Biochem. Mol. Biol 184, 36–43. 10.1016/j.cbpb.2015.02.003 [DOI] [PubMed] [Google Scholar]
  35. Wei X, Dhungana P, Sim C, n.d. The diapausing mosquito Culex pipiens exhibits reduced levels of H3K27me2 in the fat body. Insect Mol. Biol n/a. 10.1111/imb.12871 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wei X, Lee K, Mullassery N, Dhungana P, Kang DS, Sim C, 2024. Transcription profiling reveals tissue-specific metabolic pathways in the fat body and ovary of the diapausing mosquito Culex pipiens. Comp. Biochem. Physiol. Part D Genomics Proteomics 51, 101260. 10.1016/j.cbd.2024.101260 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wiercigroch E, Szafraniec E, Czamara K, Pacia MZ, Majzner K, Kochan K, Kaczor A, Baranska M, Malek K, 2017. Raman and infrared spectroscopy of carbohydrates: A review. Spectrochim. Acta. A. Mol. Biomol. Spectrosc 185, 317–335. 10.1016/j.saa.2017.05.045 [DOI] [PubMed] [Google Scholar]
  38. Yocum GD, Rinehart JP, Horvath DP, Kemp WP, Bosch J, Alroobi R, Salem S, 2015. Key molecular processes of the diapause to post-diapause quiescence transition in the alfalfa leafcutting bee Megachile rotundata identified by comparative transcriptome analysis. Physiol. Entomol 40, 103–112. 10.1111/phen.12093 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table
Supplementary Figures

RESOURCES