Inflammation-induced LncRNA SNHG1 orchestrates spermatogonium development in non-obstructive azoospermia via IL-17 A signaling pathway

Abstract

Non-obstructive azoospermia (NOA) is a critical subtype of male infertility associated with inflammation. However, the molecular mechanisms underlying this phenomenon remain poorly understood. This study investigated the role of the inflammation-activated long non-coding RNA SNHG1 in NOA pathogenesis. Using lipopolysaccharide (LPS)-induced orchitis mouse models and spermatogonium cell lines (GC-1 spg and TCAM-2), we observed that both SNHG1 and the transcription factor SP1 were significantly upregulated, correlating with spermatogonium proliferation and loss of stemness. Mechanistically, SP1 directly binds to and transcriptionally activates the SNHG1 promoter, whereas SNHG1 knockdown rescued LPS-induced spermatogonium dysfunction without affecting SP1 expression. RNA-seq revealed that SNHG1 overexpression activated the IL-17 A signaling pathway. Notably, IL-17 A receptor blockade (Brodalumab) reversed the SNHG1-mediated proliferation arrest and stemness. Our findings demonstrated that the SP1-SNHG1-IL-17 A axis drives inflammatory spermatogenic failure, suggesting IL-17 A inhibition as a potential therapeutic direction.

Graphical Abstract

In lipopolysaccharide-induced orchitis mouse models and spermatogonial cell lines, SP1 directly binds to and transcriptionally activates the SNHG1 promoter, whereas SNHG1 regulates spermatogonial development via the IL-17 A signaling pathway.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00018-025-06055-3.

Introduction

Non-obstructive azoospermia (NOA) is a severe subtype of male infertility characterized by azoospermia resulting from spermatogenic dysfunction rather than physical obstruction of the reproductive tract. NOA, which accounts for 10%–15% of male infertility cases and has a global prevalence of approximately 1% among men, poses significant challenges to fertility interventions, as conventional approaches such as surgical sperm retrieval (for instance, micro-TESE) yield viable sperm in only 30%–50% of cases [1]. Current therapeutic strategies remain limited by an incomplete understanding of their molecular etiology.

Emerging evidence indicates that chronic inflammation is a critical risk factor for NOA. To mechanistically investigate the role of inflammation in spermatogenic failure, the lipopolysaccharide (LPS)-induced murine orchitis model was used in this study. This model is a well-established, robust standard for inducing testicular inflammation [2–4], and its widespread use enables direct comparison with the vast body of literature on inflammatory mechanisms. Previous studies show LPS can cause systemic inflammation, impairing testicular lipid metabolism, testosterone biosynthesis, and spermatogenesis, and inducing epididymitis and oxidative stress [5–8]. In addition, elevated expression of inflammasome components, including AIM-2 and NLRC-4/IPAF, has been observed in both blood and testicular tissues of patients with NOA compared with obstructive azoospermia (OA) controls, suggesting both localized and systemic inflammatory activation. Furthermore, pro-inflammatory cytokines, such as IL-1β and IL-18, were significantly higher in seminal plasma from patients with NOA. Intriguingly, transcriptomic profiling has identified these inflammatory mediators as potential diagnostic biomarkers, with receiver operating characteristic curve analyses demonstrating robust discriminatory power for distinguishing NOA from normospermic (NS) individuals or patients with OA [9]. Inflammatory processes induce localized tissue damage and functional decline, particularly in the testes, where they disrupt the delicate microenvironment required for the maintenance and differentiation of spermatogonial stem cells (SSCs) [10]. A recent study by Ling et al.. suggested that abnormal expression of genes related to inflammation may play an important role in NOA [11]. In NOA testes, abnormalities are observed not only in somatic cells but also in germ cells, encompassing mechanisms like somatic cell immaturity, disrupted growth factor signalling, heightened inflammation, elevated apoptosis, and irregular extracellular matrix regulation [1]. Pro-inflammatory cytokines and immune cell infiltration directly damage spermatogonia, impairing their ability to undergo meiosis and produce mature sperm. Furthermore, inflammation-triggered immune responses exacerbate testicular injury by promoting oxidative stress and the autoimmune targeting of spermatogonium antigens. Moreover, systemic inflammation can dysregulate the hypothalamic-pituitary-gonadal axis, leading to hormonal imbalances such as reduced testosterone and increased follicle-stimulating hormone levels, which further impede spermatogenesis and sperm transport. These multifaceted mechanisms underscore the pivotal role of inflammation in NOA pathogenesis, underscoring the need for a deeper exploration of the molecular mediators linking inflammatory signals to spermatogonial dysfunction.Long non-coding RNAs (lncRNAs), generally classified as transcripts exceeding 500 nucleotides in length, exhibit structural parallels to mRNAs and demonstrate dynamic expression patterns across tissues, cell types, and developmental stages. They play important roles in various diseases and have the potential to be used as therapeutic targets and diagnostic biomarkers [12]. lncRNAs have been widely implicated in inflammation, including vascular inflammatory responses that exacerbate atherosclerotic progression [13], cancer [14], Parkinson’s disease [15], and psoriasis [16]. Evidence also implicates dysregulated lncRNAs in the progression of NOA. lncRNA CASC7 modulates human SSCs proliferation and apoptosis by competitively binding miRNA-122-5p, thereby alleviating its suppression of the proto-oncogene, underscoring lncRNA-mediated ceRNA networks as critical epigenetic regulators in NOA [17]. lncRNA MEG3 was upregulated in NOA testicular tissues and functions as a key player in the suppression of spermatogonial proliferation while promoting autophagy and apoptosis [18].

Our previous study revealed that lncRNA small nucleolar RNA host gene 1 (SNHG1) was significantly upregulated in patients with NOA compared with fertile controls via RNA-seq. Furthermore, SNHG1 expression was upregulated in the human seminoma cell line TCAM-2 and murine spermatogonial cell line GC-1 spg following LPS treatment [19]. These findings suggest that SNHG1 may be associated with NOA-induced inflammation. SNHG1 expression was reported to be regulated by SP1 in several diseases. SP1 directly regulates SNHG1 expression, establishing a molecular pathway involved in epileptogenesis [20]. SP1 directly binds to and transcriptionally activates the SNHG1 promoter, forming the self-reinforcing regulatory circuit observed in malignancies [21, 22]. SP1-mediated induction of SNHG1 in bone marrow mesenchymal stem cells was demonstrated to suppress osteogenic differentiation and angiogenic potential, while simultaneously enhancing osteoclastogenesis [23]. However, whether SP1 regulates SNHG1 and whether it coordinates inflammatory and spermatogenic dysfunction in NOA remains unexplored.

In this study, we demonstrated the expression patterns of SNHG1 and SP1 in orchitis models in vivo and in vitro, and clarified the transcriptional regulation of SNHG1 by SP1, as well as the function and mechanism of SNHG1 in spermatogonial dysfunction. After elucidating the role of inflammation-activated SP1 and SNHG1 in orchitis, we investigated the downstream mechanisms by which this pathway disrupts spermatogonial proliferation and stemness maintenance in NOA pathogenesis.

Materials and methods

Animal model of orchitis

Twelve healthy and cryptorchidism-free C57BL/6 mice (male, 8 weeks old, body weight 20–25 g) were randomly divided into two groups with 6 mice in each group: a control group (n = 6 mice; intra-testicular injection of 0.03 mL sterile saline) and an acute infectious orchitis group (n = 6 mice; intra-testicular injection of 0.03 mL LPS (100 µg/mL; Sigma, Germany). Under diethyl ether anesthesia, the mice were fixed in a supine position, and a sterile midline abdominal incision (1–1.5 cm) was made to expose the left testis. LPS or saline was injected into the left testicular parenchyma using a 30-gauge needle. The testis was repositioned, and the abdominal wall was sutured with absorbable sutures. Postoperatively, the animals were maintained under controlled environmental conditions (22 °C, 12-h photoperiod) with free access to food and water. The health status was assessed daily. One week post-surgery, the mice were euthanized by cervical dislocation under anesthesia. The left testes were harvested, weighed, and photographed for gross morphological evaluation. Tissue samples were divided into two portions: one was fixed in 4% paraformaldehyde (PFA) for histopathology, and the other was snap-frozen in liquid nitrogen for molecular analysis. All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanfang Hospital, Southern Medical University (Protocol No. LACUC-LAC-20250421-002) and conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals.

Hematoxylin and eosin staining (H&E)

H&E staining was performed to confirm the successful induction of orchitis. Briefly, the fixed testis tissues were dehydrated using a graded ethanol series and embedded in paraffin. Section (4 μm thick) were stained with H&E (Beyotime, China) according to standard protocols. The histopathological evaluation was performed using a light microscope (Nikon, Japan). The following criteria were used to corroborate the successful induction of orchitis: (1) degenerative changes, such as disorganized germinal epithelium and reduced cellular layers; (2) centripetal progression of lesions, characterized by peripheral-to-central disruption of the tubular architecture; (3) loss of spermatogenic cells despite preservation of the tubular structure.

Quantitative real-time PCR

RNA isolation and quantification procedures were performed as follows: Testicular and cellular RNA were purified using TRIzol reagent (Invitrogen, USA), followed by DNase I (Thermo Fisher Scientific) treatment to remove genomic DNA. For cDNA synthesis, 1 µg of purified RNA was reverse-transcribed using PrimeScript™ RT Master Mix (Takara, Japan). Quantitative analysis was performed on a CFX96 Touch™ platform (Bio-Rad) using SYBR Green Premix Ex Taq™ II (Takara). Primer sequences for lncRNA SNHG1, transcription factor SP1, and the internal control GAPDH were designed using Primer Premier (version 6). The thermal cycling protocol consisted of 95 °C for 30 s, followed by 40 cycles of 95 °C (5 s) and 60 °C (30 s). Relative quantification was performed using the 2^−ΔΔCt method, with GAPDH as the normalization control. The primer sequences are listed in Table 1.

Table 1.

Primers for quantitative real-time PCR

Gene	Forward (5’ − 3’)	Reverse (5’ − 3’)
Human
GAPDH	TGTTGCCATCAATGACCCCTT	CTCCACGACGTACTCAGCG
SNHG1	CTCGTGGATTTACGCGCAC	AAGCTCTTGTGGGCTGAACA
SP1	ATGGACAGGTCAGTTGGCAG	CTGCATTGGGGCTAAGGTGA
SNHG1	ACACTGCCTATCAGGCAAACTG	GAAACTGGCTTTCCTCTCATGC
Mice
GAPDH	GTGTTCCTACCCCCAATGTGT	ATTGTCATACCAGGAAATGAGCTT
SNHG1	GGATGGGTGTACGCTCTCTTT	TCATGTTGTCACAGCACCCT
SP1	TCAGCGTCCGCGTTTTTCC	CCGCTACCCCCATTATTGCC
SNHG1	GCAGTGAGTAAGAACCGCCT	TAAGGTAAGCGGTGTGCGAG

Western blot

Testicular tissues or cultured cells were lysed in RIPA buffer (Thermo Fisher Scientific, USA). Protein concentrations were quantified using the BCA Protein Assay Kit (Beyotime, China). Following protein quantification using the BCA assay (Beyotime, China), samples were electrophoresed on SDS-PAGE gels and subsequently transferred to PVDF membranes (Millipore, USA). Membranes were successively incubated with 5% non-fat milk, primary antibodies, including anti-SP1 (cat # ab157123, 1:1000), anti-p-SP1 (cat# ab59257, 1:500), anti-p-ERK (cat# ab201015, 1:1000), anti-p-p38 (cat# ab178867,1:1000), anti-p-NF-κB (cat # ab76302, 1:1000), anti- NF-κB (cat# ab207297, 1:1000), anti-p-STAT3(cat# ab76315, 1:10000), anti-STAT3 (cat# ab119352, 1:5000), anti- TRAF6 (cat# ab40675, 1:5000), anti- ACT1 (cat# ab5973, 1:2000), anti- Histone H3 (cat# ab1791, 1:3000) or anti-GAPDH (cat # ab181603, 1:10000); all primary antibodies were purchased from Abcam, UK. Subsequently, the membranes were incubated with HRP-conjugated secondary antibodies (cat # GB23404, 1:15000, Servicebio, China) for 1 h at each step. Signal detection was performed using ECL reagent (Beyotime, China), and band intensities were quantified using ImageJ. Normalized SP1 expression with GAPDH.

Immunohistochemistry

Testicular tissue Sect. (4 μm) embedded in paraffin were dewaxed and rehydrated. 3% hydrogen peroxide (H₂O₂) was used to quench the endogenous peroxidase activity. Sections were incubated with 5% bovine serum albumin (BSA), followed by incubation with anti-C-kit (cat # GB113799, 1:500, Servicebio, China), anti-Oct4 (cat # ab181557, 1:1000, Abcam, UK), anti-IL-17 A (cat# ab79056, 1:500, Abcam, UK) or anti-ZO-1 (cat# ab221547, 1:500, Abcam, UK). After treatment with HRP-conjugated secondary antibodies (cat # GB23404, 1:500, Servicebio, China), immunoreactivity was detected using diaminobenzidine (DAB; Beyotime, China), and nuclei were counterstained with hematoxylin.

TdT-mediated dUTP nick end labeling (TUNEL) assay

Testicular paraffin Sect. (4 μm) were deparaffinized, rehydrated, and treated with proteinase K (20 µg/mL; Roche) for 15 min at 37 °C. Apoptotic DNA fragmentation was detected using an in situ cell death detection kit (Roche). Briefly, the sections were incubated with TdT enzyme and biotin-labeled dUTP in a humidified chamber at 37 °C for 1 h. H₂O₂ (3%) was used to quench the endogenous peroxidase activity. Streptavidin-HRP (cat # 31491, 1:200; Thermo Fisher Scientific, USA) was used, followed by chromogenic detection with DAB (Beyotime, China). Hematoxylin was used to counterstain the nuclei.

For cell lines, the one-step TUNEL apoptosis assay kit with Cy3 (Beyotime, China) was used according to the manufacturer’s instructions. Briefly, treated GC-1 spg and TCAM-2 cells were fixed with 4% PFA (15 min), permeabilized with 0.25% Triton X-100 (10 min), and incubated with TUNEL reaction mixture for 60 min at 37 °C in the dark. DAPI (1 µg/mL; Sigma) was used to counterstain the nuclei.

Cell culture and inflammatory stimulation

GC-1 spg (Pricella, China) and TCAM-2 (YaJi Biological, China) cells were cultured in complete Dulbecco’s Modified Eagle Medium (Gibco, US) at 37 °C in a 5% CO₂ humidified atmosphere. Subculturing was performed at 80%–90% confluence.

Cells were plated in 6-well plates (2 × 10⁶ cells/well) and divided into two groups: (1) the control group (culture medium only) and (2) the LPS-treated group (10 µg/mL LPS; Sigma) for 24 h to simulate an inflammatory microenvironment.

EdU staining

A BeyoClick™ EdU cell proliferation kit with AF594 (Beyotime, China) was used to assess cell proliferation. Briefly, following a 2-h incubation with 10 µM EdU at 37 °C, cells were fixed with 4% PFA and permeabilized with 0.5% Triton X-100. Click chemistry with AF594-conjugated azide was performed for 30 min (light-protected), followed by nuclear counterstaining with Hoechst 33,342 (Sigma). Images were obtained using a Leica inverted fluorescence microscope.

Flow cytometry

After 24-h treatment with 10 µg/mL LPS or control medium, GC-1 spg and TCAM-2 cells were collected, washed, and adjusted to 1 × 10⁶ cells/mL in binding buffer. Cell suspensions were stained with 5 µL each of Annexin V-FITC and PI (cat # C1062L, Beyotime, China) for 15 min under light-protected conditions, followed by immediate acquisition using a Beckman flow cytometer to assess cell apoptosis.

Immunofluorescence (IF)

Following fixation with 4% PFA (15 min and permeabilization with 0.1% Triton X-100 (10 min), samples were incubated with 5% BSA, primary antibodies, including rabbit anti-SP1 (cat # ab157123, 1:100, Abcam, UK), rabbit anti-C-kit (cat # ab231780, 1:150, Abcam, UK), or rabbit anti-Oct4 (cat # ab181557, 1:250, Abcam, UK), and Alexa Fluor^®-conjugated secondary antibodies (cat # ab150085, 1:400, goat anti-rabbit 488; cat # ab150091,1:400, goat anti-rabbit 647; Abcam, UK) in the dark. Nuclei were stained with DAPI (cat # F6057, Sigma, USA).

Chromatin immunoprecipitation (ChIP)

This assay was performed using a Magna ChIP™ Kit (Millipore, US). The cells were crosslinked with 1% formaldehyde for 10 min, which was terminated using glycine. Cells were lysed in SDS lysis buffer, and chromatin was fragmented using sonication to produce 200–500 bp DNA fragments. Immunoprecipitation with anti-SP1 antibody (5 µg/sample; Abcam, UK) or normal rabbit IgG (negative control; Abcam, UK) was performed overnight at 4 °C, followed by the capture of protein-DNA complexes with protein A/G magnetic beads and sequential washes. After crosslink reversal at 65 °C for 4 h, DNA was purified using spin columns. qPCR was performed to quantify SP1-bound DNA enrichment.

Electrophoretic mobility shift assay (EMSA)

GC-1 spg cells were exposed to 10 µg/mL LPS or control medium for 24 h, after which the nuclear fractions were isolated using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Fisher, USA). The protein levels were determined using the BCA method. A biotin-labeled double-stranded DNA probe corresponding to the predicted SP1-binding site in the SNHG1 promoter was synthesized (RIBO Bio, China). The mutant probe served as the specificity control.

For EMSA, nuclear protein (10 µg) was incubated with 20 fmol of biotinylated probe in binding buffer for 30 min. Competition assays were performed by adding a 100-fold excess of unlabeled wild-type or mutant probe. For supershift analysis, anti-SP1 antibody (Abcam, UK) or control IgG was pre-incubated with the nuclear extract for 30 min before probe addition. DNA-protein complexes were resolved on a non-denaturing polyacrylamide gel and transferred onto a nylon membrane (Amersham, UK). Biotinylated DNA was visualized using a chemiluminescent nucleic acid detection module (Thermo Fisher, USA). Band intensities were quantified using ImageJ software.

RNA-seq

Total RNA was isolated from SNHG1-overexpressing and control GC-1 spg cells (n = 3) using the TRIzol method. RNA libraries were constructed using a NEBNext^® Ultra™ RNA library prep kit (Illumina) and sequenced on an Illumina NovaSeq 6000 platform. Raw data were processed using FastQC for quality control, and adapters/low-quality reads were trimmed using Trimmomatic (version 0.39). The clean reads were mapped to the mouse reference genome using STAR (version 2.7.10a). Transcript abundance was estimated as transcripts per million with StringTie (version 2.2.1).

Differentially expressed genes (DEGs) were screened using DESeq2 (version 1.34.0) with thresholds of |log2(fold-change)| ≥ 2 and adjusted P < 0.05. Functional annotation was performed using gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway analyses using clusterProfiler (version 4.2.2), retaining terms with P < 0.05 and gene counts ≥ 5. Heatmaps and volcano plots were generated with ggplot2 (version 3.4.0).

Gene overexpression and knockdown

To elucidate the biological function of SNHG1 and SP1, GC-1 spg and TCAM-2 cells were transfected with a pcDNA3.1 vector encoding full-length human SNHG1 or an empty pcDNA3.1 vector (negative control). The SNHG1 and SP1 sequences was GenScript Biotech Corporation (Nanjing, China) and subsequently inserted into the pcDNA3.1(+) plasmid (Guangzhou IGE Biotechnology, China). Cells (2 × 10⁵ cells/well) were seeded in 6-well plates. Following 24-h incubation, transfection was performed using plasmid DNA complexed with Lipofectamine 3000 (cat # L3000150, Invitrogen, Thermo Fisher, USA). The shRNA sequences, including the negative control shRNA (shNC; Merck, cat# SHC016-1EA), were synthesized by Merck and cloned into the pLKO.1 plasmid vector. Transfection was performed according to the manufacturer’s protocol, and all shRNA sequences are listed in Table S1.

Statistical analysis

All statistical analyses were conducted using GraphPad Prism software (version 9.0; GraphPad Software, USA), with results reported as the mean ± standard deviation (SD). Comparisons between two experimental groups were analyzed using an unpaired Student’s t-test, while comparisons among multiple groups were performed using one-way analysis of variance (ANOVA) followed by Tukey’s test. To enhance methodological reliability, all experimental procedures included at least three biologically independent replicates conducted under identical conditions. Statistical significance was set at P < 0.05.

Results

LncRNA SNHG1 and SP1 were upregulated in orchitis models and associated with inflammatory damage

LPS was used to develop an orchitis animal model (saline injection was used as the control). LPS-treated testes exhibited significant weight loss (Fig. 1A). Histopathological analysis revealed degenerative changes in the seminiferous tubules, characterized by centripetal progression of disorganized germinal epithelium, reduced cellular layers, and preserved tubular architecture, indicating the successful development of orchitis (Fig. 1D). TUNEL staining revealed a significant increase in apoptotic cells in LPS-treated testes (Fig. 1E). IHC assay demonstrated significant downregulation of C-kit (SSC marker; Fig. 1F) and Oct4 (pluripotency marker; Fig. 1G), upregulation of IL-17 A (Fig. 1H), and disrupted expression of ZO-1 (manifesting as a fragmented, irregular, and clumped pattern in response to LPS-induced orchitis, indicating compromised blood-testis barrier integrity; Fig. 1I), implying inflammation-induced loss of spermatogonial stemness. Furthermore, LPS treatment increased SNHG1 expression. Concurrently, SP1 mRNA and protein levels were upregulated (Figs. 1B, C). These results indicate a positive correlation between SNHG1 and SP1 expression.

Fig. 1.

Effect of inflammation on spermatogonia in LPS-induced mouse testes. (A) Testes from LPS-induced mice (Orchitis) and the Sham group. n = 6 mice per group (B) Expression levels of SNHG1 and SP1 at the transcriptional level were detected using qPCR. n = 6 mice per group (C) Expression of SP1 at the protein level as detected by Western blot. n = 6 mice per group (D) H&E staining was used to analyze the histopathology of the testes. n = 3 mice per group (E) Apoptosis in testes was analyzed using TUNEL staining. n = 3 mice per group (F-I) Expression levels of Oct4, C-kit, IL-17 A and ZO-1 as detected by IHC assay. n = 3 mice per group. Statistical comparisons between the two groups were performed using an unpaired two-tailed Student’s t-test. ***P < 0.001

In vitro LPS stimulation of spermatogonial cell lines was performed to demonstrate further the relationship between SNHG1, SP1, and spermatogonial dysfunction. In GC-1 spg and TCAM-2 cells, LPS (10 µg/mL, 24 h) significantly suppressed proliferation (Fig. 2A) and increased apoptosis (Figs. 2B, C). LPS upregulated SNHG1 expression and SP1 levels (Figs. 2D, E). IF confirmed increased SP1 (Fig. 2F), reduced C-kit (Fig. 2G), and Oct4 (Fig. 2H) expression, consistent with the in vivo findings.

Fig. 2.

Effects of LPS-induced inflammation on spermatogonia in vitro. (A) Cell proliferation was detected by EdU staining. (B-C) Apoptosis was detected using flow cytometry and the TUNEL assay. (D) SP1 expression at the protein level was detected using a Western blot. (E) Expression levels of SNHG1 and SP1 at the transcriptional level were detected using qPCR. (F–H) IF analysis of SP1, C-kit, and Oct4 expression. All experiments were performed in at least triplicate. Statistical comparisons between the two groups were performed using an unpaired two-tailed Student’s t-test. **P < 0.01, ***P < 0.001

SP1 transcriptionally regulates SNHG1 to modulate spermatogonium dysfunction under inflammation

In GC-1 spg and TCAM-2 cells, SP1 overexpression robustly induced SNHG1 expression (Figs. 3A–C). ChIP-qPCR demonstrated SP1 enrichment in the SNHG1 promoter (Fig. 3D). The wild-type and mutant SNHG1 promoter sequences were recombined into the pGL3 Basic plasmid vector and then transfected into cells for dual-luciferase reporter assay. The results revealed that overexpression of SP1 could significantly increase the fluorescence ratio in the group with the wild-type SNHG1 promoter sequence, whereas no significant difference was observed in the mutant group (Fig. 3E). This interaction was further validated by EMSA, as nuclear extracts from SP1-overexpressing cells formed specific DNA-protein complexes with the SNHG1 promoter probe, which were abolished by competition with unlabeled wild-type probes or an anti-SP1 antibody supershift (Fig. 3F). Concurrently, SP1 overexpression suppressed C-kit and Oct4 expression (Figs. 3G, H), indicating inflammation-associated loss of spermatogonial stemness. In addition, the WB detection results following stimulation with LPS at a concentration of 10 µg/ml for different durations revealed that LPS activated the phosphorylation levels of ERK1/2 and p38 (Figure S1). In GC-1 spg and TCAM-2 cell lines, inhibitors of ERK1/2 and p38 both suppressed the LPS-induced upregulation of SP1 expression (Figure S2), which may be one of the reasons for the upregulation of SP1 expression.

Fig. 3.

SP1 transcriptionally regulates SNHG1 in spermatogonia. (A) Expression levels of SNHG1 and SP1 at the transcriptional level were detected using qPCR. (B) SP1 expression at the protein level was detected using a Western blot. (C) SP1 was detected using IF. (D-F) Interaction between SP1 protein and SNHG1 promoter confirmed by ChIP-qPCR, dual-luciferase reporter assay and EMSA. (G-H) C-kit and Oct4 were detected using IF. All experiments were performed in at least triplicate. Statistical comparisons between the two groups were performed using an unpaired two-tailed Student’s t-test. **P < 0.01, ***P < 0.001

Furthermore, SP1 knockdown was performed in LPS-treated cells. These results demonstrated that SP1 knockdown significantly mitigated LPS-induced SNHG1 upregulation (Figs. 4D-E and 5A) and reversed LPS-mediated pathological effects. EdU assay revealed a significant increase in EdU⁺ cells in LPS + shSP1 versus LPS + shNC (Fig. 4A). Flow cytometry and TUNEL staining revealed a significant reduction in cell apoptosis (Figs. 4B, C). IF demonstrated partial recovery of C-kit and Oct4 (Figs. 5B, C). These results suggested that SP1 transcriptionally regulates SNHG1 to modulate g spermatogonia dysfunction in NOA.

Fig. 4.

SP1 knockdown reduces the LPS-induced spermatogonia dysfunction. (A) Cell proliferation was detected using EdU staining. (B-C) Cell apoptosis was detected using flow cytometry and the TUNEL assay. (D) Expression levels of SNHG1 and SP1 at the transcriptional level were detected using qPCR. (E) SP1 expression at the protein level was detected by Western blot. All experiments were performed in at least triplicate. Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. ns: not significant, *P < 0.05, **P < 0.01, ***P < 0.001

Fig. 5.

Immunofluorescence analysis. (A–C) IF analyzing the expression of SP1, C-kit, and Oct4. All experiments were performed in at least triplicate

SNHG1 knockdown rescues LPS-induced spermatogonia dysfunction

In GC-1 spg and TCAM-2 cells, SNHG1 knockdown (LPS + shSNHG1) significantly reversed the detrimental effects of LPS treatment compared with LPS + shNC controls. EdU staining demonstrated that LPS + shSNHG1 cells exhibited a significantly increased proliferation (Fig. 6A). Concurrently, flow cytometry and TUNEL assays revealed a reduction in apoptotic cells (Figs. 6B, C), indicating a partial rescue of cell apoptosis. SNHG1 knockdown effectively suppressed LPS-induced SNHG1 upregulation (Fig. 6D) but did not alter SP1 expression at either the mRNA or protein level (Figs. 6D, E). Furthermore, IF revealed the restored expression of C-kit and Oct4 (Figs. 6G, H), implying that SNHG1 knockdown mitigated the inflammation-induced loss of spermatogonia self-renewal capacity. Collectively, these findings establish SNHG1 as a critical mediator of LPS-induced spermatogonia dysfunction in NOA pathogenesis.

Fig. 6.

SNHG1 knockdown reduces LPS-induced spermatogonial dysfunction. (A) Cell proliferation was detected by EdU staining. (B-C) Cell apoptosis was detected by flow cytometry and TUNEL assay. (D) Expression levels of SNHG1 and SP1 at the transcriptional level were detected by qPCR. (E) SP1 expression at the protein level was detected by Western blot. (F–H) IF analysis of SP1, C-kit, and Oct4 expression. All experiments were performed in at least triplicate. Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. ns: not significant, *P < 0.05, **P < 0.01, ***P < 0.001

SNHG1 induced spermatogonia dysfunction via IL-17A signaling pathway

The potential pathway was revealed by performing RNA-seq of SNHG1-overexpressing GC-1 spg cells (versus control) to demonstrate how SNHG1 regulates spermatogonial dysfunction. SNHG1 overexpression was associated with 83 DEGs (Figs. 7 A, B, Table S1-S3). GO and KEGG analyses demonstrated significant enrichment for the “IL-17A signaling pathway,” ranking among the top 30 GO and KEGG pathway enrichments (Figs. 7C, D). In addition, WB analysis showed that the downstream targets of the IL-17 A pathway—NF-κB, STAT3, and ERK1/2—the phosphorylation levels of these proteins were upregulated in the SNHG1-overexpressing group (Figure S3A). Co-IP experiments also confirmed that SNHG1 overexpression promoted the interaction between ACT1 and TRAF6 proteins (Figure S3A, S3B). Consequently, we hypothesized that IL-17 A signaling is a downstream effector of SNHG1 in inflammatory injury to spermatogonia.

Fig. 7.

RNA-seq revealed the potential pathways regulated by SNHG1. (A-B) The volcano plot and hot map demonstrated the DGEs between the SNHG1-overexpressing and control groups. (C) GO. (D) KEGG enrichment analysis

To test this hypothesis, SNHG1-overexpressing GC-1 spg and TCAM-2 cells were treated with Brodalumab (10 µg/mL, Figure S4A, B), an IL-17 A receptor antagonist. SNHG1 expression was not significantly affected by the IL-17 A inhibition (Fig. 8D). However, IL-17 A inhibition reversed the SNHG1-induced proliferation arrest (Fig. 8A) and apoptosis (Figs. 8B, C). Furthermore, IF demonstrated partial restoration of C-kit and Oct4 (Figs. 8E, F), indicating that IL-17 A pathway blockade alleviated SNHG1-mediated spermatogonium damage. In addition, overexpression of SNHG1 was performed in SP1-knockdown cells, and results showed that overexpression of SNHG1 significantly increased the mRNA and protein expression levels of IL-17 A without altering the expression level of SP1 (Fig. 9A-D). Meanwhile, the increase in proliferation and decrease in apoptosis induced by knocking down SP1 were reversed by overexpression of SNHG1 (Fig. 9E, F). These results collectively establish SNHG1 as a regulator of IL-17 A signaling, driving inflammation and apoptosis in NOA.

Fig. 8.

IL-17A signaling pathway blockade rescued the SNHG1-induced cell dysfunction. (A) Cell proliferation was detected using EdU staining. (B-C) Cell apoptosis detected by flow cytometry and TUNEL assay. (D) Expression levels of SNHG1 and SP1 at the transcriptional level were detected by qPCR. (E) SP1 expression at the protein level was detected using a Western blot. (F–H) IF analysis of SP1, C-kit, and Oct4 expression. All experiments were performed in at least triplicate. Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. ns: not significant, **P < 0.01, ***P < 0.001

Fig. 9.

Re-expressing SNHGI in SP1-knock-down cells protect cells from inflammatory damage. (A-C) Expression levels of SP1, SNHG1, and IL-17 A were detected by QPCR assay. (D) The WB method was employed to assess the protein expression levels of SP1 and IL-17 A. (E) EdU staining was utilized to evaluate cell proliferation. (F) Flow cytometry was applied to detect cell apoptosis. All experiments were performed in at least triplicate. Statistical significance was determined by one-way ANOVA with Tukey’s post hoc test. ns: not significant, **P < 0.01, ***P < 0.001

Discussion

Spermatogenesis is a fundamental biological process essential to male fertility and the cornerstone of reproductive capacity in mammals. However, spermatogonia dysfunction, characterized by impaired self-renewal capacity or disrupted differentiation potential, critically compromises this vital reproductive function. This study elucidates a novel SP1-SNHG1-IL-17 A signaling axis that drives spermatogonial dysfunction in an inflammatory environment. We demonstrated that SP1, a transcription factor upregulated in orchitis, directly activates the lncRNA SNHG1, which subsequently amplifies IL-17 A signaling, thereby impairing spermatogonial proliferation and stemness. Notably, IL-17 A inhibition with Brodalumab reverses SNHG1-mediated spermatogonial damage, implying a potential therapeutic strategy for inflammation-associated NOA.

Transcriptional regulation is a pivotal mechanism for regulating gene expression. SP1, an early-characterized transcription factor in the SP/KLF family, features three conserved Cys2-His2 zinc finger domains that mediate DNA binding and transcriptional activation. This molecular architecture enables SP1 to regulate target gene expression through sequence-specific interactions with the promoter. SP1 dysregulation is associated with numerous diseases, including cancer [24], cardiovascular diseases [25], renal fibrosis [26], and atopic dermatitis [27]. SP1 is a critical regulator orchestrating multiple fundamental biological processes, including cellular proliferation, differentiation, programmed cell death, immune regulation, chromatin organization, and DNA repair [28].

Emerging evidence has revealed its regulatory role in cell proliferation and stemness. In bone homeostasis, SP1 acts as a downstream effector of m6A methylation, and its mRNA stability and transcriptional activity directly influence osteoblast differentiation and senescence by regulating BMP2 [29]. During myogenic differentiation, hypoxia-induced SP1 upregulation, mediated by miR-92a suppression, drives MyoD expression and promotes myogenic differentiation and muscle regeneration [30]. SP1 regulated both proliferative capacity and osteogenic differentiation potential in dental pulp stem cells (DPSCs) [31]. In neuronal development, SP1 expression is significantly suppressed by neuron-enriched miR-124, demonstrating how SP1 regulates neuronal differentiation of mesenchymal stem cells [32]. These studies collectively emphasize SP1 as a nodal point that integrates numerous signaling inputs to determine cellular fate. This is consistent with emerging evidence that functional outcomes of SP1 are highly context-dependent and capable of either promoting or suppressing stemness, depending on the cellular milieu and interacting partners.

SP1 affects the self-renewal and proliferation of spermatogonia via the NF-κB signaling pathway [33]. Furthermore, infertile males exhibited altered SP1 binding affinity to polymorphic CGG repeat regions in the UBE2B gene promoter. Although these UBE2B promoter polymorphisms alone may not cause infertility, their association with increased SP1 binding affinity implies that SP1 may function as a molecular nexus integrating multiple genetic and epigenetic factors in spermatogenic failure [34]. In the context of NOA, our findings revealed that SP1 was upregulated in testicular tissue from the orchitis model and LPS-treated spermatogonia (GC-1 spg and TCAM-2). Moreover, SP1 knockdown enhanced cellular proliferation while inhibiting cell apoptosis and the expression of C-kit and Oct4 via SNHG1, indicating the inhibition of cell proliferation and stemness. Mechanistically, SP1 binds directly to the SNHG1 promoter, thereby promoting SNHG1 expression.

The lncRNA SNHG1, traditionally studied in oncogenic contexts, has been identified as playing a multifaceted role in cellular homeostasis, extending beyond oncogenesis to regulate inflammation and differentiation. SNHG1 has emerged as a critical regulator of cell differentiation across various tissues. In human DPSCs, SNHG1 promotes odontogenic differentiation by inhibiting the miR-328-3p/Wnt/β-catenin pathway, thereby facilitating tooth development and repair [35]. In bone marrow mesenchymal stem cells, SNHG1 demonstrates dual regulatory roles. It promotes adipogenic differentiation by interacting with PTBP1 to upregulate DNMT1 expression, leading to Opg promoter hypermethylation and subsequent transcriptional silencing, a mechanism that contributes to osteoporosis pathogenesis [36]. However, SNHG1 inhibits hepatocyte-like cell differentiation from BMSCs by regulating the miR-15a/SMURF1/UVRAG axis, thereby exacerbating cirrhosis progression [37]. Furthermore, SNHG1 suppresses osteogenic differentiation in periodontal ligament stem cells through EZH2-mediated H3K27me3 methylation of the KLF2 promoter, highlighting its role in the epigenetic regulation of bone formation [38]. These diverse functions underscore the importance of SNHG1 as a master regulator of cellular differentiation, with its effects precisely controlled depending on the cellular microenvironment and specific molecular interactions.

SNHG1 also participates in regulating the inflammatory response. In diabetic nephropathy, SNHG1 exacerbates inflammation by competitively binding to miR-27b, thereby regulating KDM6B expression and promoting mesangial cell proliferation under hyperglycemic conditions [39]. Similarly, in periodontal inflammation, SNHG1 formed a ceRNA network with miR-9-5p to stabilize NFKB1 expression, establishing a pro-inflammatory feedback loop, which is disrupted by cryotherapy [40]. SNHG1 was upregulated in myocardial tissue and exacerbated myocardial injury in sepsis through DNMT1-mediated epigenetic silencing of Bcl-2. SNHG1 knockdown reduced the inflammation and apoptosis of cardiac muscle cells [41]. SNHG1 silencing attenuates neuroinflammation in Parkinson’s disease by regulating miR-125b-5p/MAPK1 [42] and miR-7/NLRP3 pathways [43].

This study reported that SNHG1 expression was associated with spermatogonium homeostasis during inflammation. SNHG1 was upregulated in orchitis models both in vivo and in vitro. SNHG1 knockdown significantly protected spermatogonial proliferation and stemness from inflammation. Furthermore, RNA-seq analysis revealed that SNHG1 expression was associated with the IL-17 A signaling pathway. These findings highlight that SNHG1 regulates both inflammation and spermatogonial stemness in NOA, providing novel insights into the mechanisms of male infertility.

The IL-17 A signaling pathway, a hallmark of inflammatory and autoimmune disorders, orchestrates critical biological processes, including immune protection, wound healing, chronic inflammation, and malignant development. This dichotomy underscores its intricate role in human health and disease [44]. IL-17 plays a dual role in regulating stemness. In psoriasis (an inflammatory skin disorder), IL-17 increased keratinocyte stemness. IL-17 treatment recapitulated the characteristic stem-like phenotypes in normal keratinocytes, including increased expression of stemness markers, enhanced colony-forming ability, and sustained proliferative potential. These findings establish an association between inflammatory signaling and the acquisition of stem cell properties [45]. Besides, IL-17 improved the proliferative capacity, clonogenic potential, cell cycle activity, pluripotency marker expression, and differentiation of DPSCs [46]. Conversely, in neural stem cells, IL-17 impairs proliferation and neurogenesis by regulating the PI3K/Akt pathway, contributing to post-ischemic cognitive deficits [47]. These contrasting effects highlight the context-dependent nature of IL-17 signaling in stem cell regulation.

Enrichment analysis revealed that IL-17 was involved in azoospermia [48]. Plasma IL-17 levels in the azoospermia group were significantly higher than in the control group [49]. In this study, we observed that blockade of the IL-17 A signaling pathway with Brodalumab relieved the inhibition of cell proliferation and stemness caused by SNHG1. This study demonstrated that the IL-17 A signaling pathway negatively affects the proliferation and stemness of spermatogonia, thereby playing an important role in NOA development.

Although our findings support the role of the SP1-SNHG1-IL-17 A axis in spermatogonia development, this study has several limitations. First, we did not evaluate the therapeutic efficacy of IL-17 A inhibitors in animal models of orchitis; thus, our data highlight IL-17 A blockade as a potential therapeutic direction but lack crucial preclinical evidence for near-term clinical translation. Second, the sample sizes in our animal experiments (6 mice per group for sham and LPS treatments) were relatively modest, which may have limited the statistical power of the in vivo findings. Third, the histopathological evaluation in this study was not performed in a blinded manner, which is a potential source of observer bias. Future studies should address these gaps to strengthen the biological and potential clinical relevance of our findings.Another consideration involves the cellular models used in this study. The GC-1 spg cell line originates from type B spermatogonia, while TCAM-2 is a well-established seminoma-derived model. It is important to note that although TCAM-2 cells retain key spermatogonial markers and have provided invaluable insights into germ cell biology, their tumor origin implies that certain signaling pathways may not fully represent those in non-transformed spermatogonia. Therefore, while our findings robustly delineate the SP1-SNHG1-IL-17 A axis within these models, further validation in primary spermatogonial stem cells or iPSC-derived models will be important to fully extrapolate these mechanisms to a normal physiological context. Such future studies would strengthen the translational relevance of targeting this axis.

Conclusion

In conclusion, this study identifies the SP1-SNHG1-IL-17 A axis as a key driver of inflammation-induced spermatogenic failure. SP1 upregulation transcriptionally activates SNHG1, which amplifies IL-17 A signaling, thereby disrupting spermatogonial proliferation and stemness. IL-17 A blockade reverses these effects, suggesting its therapeutic potential. Our findings revealed a novel lncRNA-mediated inflammatory cascade in male infertility, providing new insights for targeted interventions.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

NOA

Non-obstructive azoospermia

OA

Obstructive azoospermia

SSCs

Spermatogonial stem cells

lncRNAs

Long non-coding RNAs

LPS

Lipopolysaccharide

SNHG1

Small nucleolar RNA host gene 1

H&E

Hematoxylin and eosin

PFA

Paraformaldehyde

Author contributions

Conceptualization: Yongtong Zhu and Maocai Li.

Data curation and Formal analysis: Cairong Chen, Yao Zhou and Maocai Li.

Funding acquisition: Yongtong Zhu, Yao Zhou, Cairong Chen, Pei He and Rui Hua.

Investigation and Methodology: Yongtong Zhu, Maocai Li and Li Liu.

Validation: Yongtong Zhu, Xiaomin Zhan, Li Liu, Cairong Chen, Yao Zhou and Maocai Li.

Visualization: Yongtong Zhu, Xiaomin Zhan and Xiaomin Zhan.

Project administration: Yongtong Zhu and Pei He.

Writing – original draft: Yongtong Zhu, Maocai Li and Xiaomin Zhan.

Resources, Supervision and Writing –review & editing: Pei He and Rui Hua.

Funding

This study is funded by the following funds:

1. National Key Research and Development Program of China (No.2022YFA0806303);

2. National Natural Science Foundation of China (No.82101739);

3. Natural Science Foundation of Guangdong Province (No.2022A1515011732);

4. Regional Joint Fund for Basic and Applied Basic Research of Guangdong Province (No.2021A1515111091);

5. Science and Technology Projects in Guangzhou(No.2023A04J2295);

6. President Foundation of Nanfang Hospital, Southern Medical University (No.2023A045, No.2021C016);

7. Open Research Funds from the Sixth Affiliated Hospital of Guang zhou Medical University, Qingyuan People’s Hospital (No.202301-104).

Data availability

All data needed to evaluate the conclusions in this article are available in the methods and/or the supplementary material of this article. RNA-seq data can be found in the GEO database with the accession number (GSE313132). Any additional information on the findings of this study is available on request from the corresponding author.

Declarations

Ethics approval

All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanfang Hospital, Southern Medical University (Protocol No. LACUC-LAC-20250421-002) and conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals.

Consent to participate

Not applicable.

Consent to publish

Not applicable.

Competing interests

The authors have no relevant financial or non-financial interests to disclose.