Skip to main content
Chinese Herbal Medicines logoLink to Chinese Herbal Medicines
. 2025 Mar 19;18(1):142–152. doi: 10.1016/j.chmed.2025.03.004

Design and synthesis of butyrolactone V derivatives and its anti-inflammatory activity analysis

Wen Liu a,1, Biqiong Zhang a,1, Zhengxi Hu a,1, Si Yao b, Yunpeng Zhao a, Fengqing Wang a, Yuanyuan Wang a, Xinxin Yang a, Jie Yin a, Weiguang Sun a, Qingyi Tong a, Lianghu Gu a,, Yonghui Zhang a,
PMCID: PMC12828155  PMID: 41584706

Abstract

Objective

To design and synthesize an amount of butyrolactone V derivatives, evaluate the anti-inflammatory effects of all the derivatives, look for potential drugs that inhibit inflammatory bowel disease (IBD), and determine the structure-activity relationship (SAR).

Methods

The butyrolactone V derivatives were synthesized with high yield by oxidation reaction, substitution reaction, and esterification reaction in sequence, and the production of nitric oxide was assessed in RAW264.7 cells treated with the lipopolysaccharide and the compounds. Then, the target compounds were studied for their activity in dextran sodium sulfate (DSS)-induced ulcerative colitis.

Results

A total of three series of compounds encompassing 60 derivatives of the natural product butyrolactone V were designed and synthesized. The results showed that compounds 5p and 7e could alleviate the symptoms of DSS-induced colitis in mice, including alleviating diarrhea, inhibiting the reduction of colon length, and reducing tissue damage. The preliminary mechanism exploration indicated that compounds 5p and 7e could improve the symptoms of IBD in mice mainly by reducing the expression of chemokines and exerting anti-inflammatory effects.

Conclusion

This study reports the synthesis and the derivatization of butyrolactone V and analysis on anti-inflammatory activity. The most effective compounds 5p and 7e have the potential to be further developed as drugs to treat IBD.

Keywords: anti-inflammatory activita, butyrolactone V, inflammatory bowel disease, natural product derivatives, structure-activity relationship

1. Introduction

Inflammation-related diseases have become the main cause of global healthcare problems and have a significant impact on medical costs (Cai et al., 2023). The inflammatory process is a complex biological response that can be triggered by a variety of adverse stimuli, including bacteria, fungi, viruses, toxic chemicals, and physical trauma. Inflammatory bowel disease (IBD) is a chronic inflammatory disorder caused by dysregulation of the gastrointestinal system and characterized by a steady increase in incidence and prevalence worldwide (Ramos & Papadakis, 2019). The principal subtypes of IBD encompass ulcerative colitis (UC) and Crohn’s Disease (Yang et al., 2023). These disorders are characteristically prevalent among young adults within the age bracket of 15 to 30 years. (Chen et al., 2023). The persistent chronic inflammation inherent in IBD is an important factor in tumor transformation and development and increases the risk of colorectal cancer (Yeshi et al., 2020). The main cause of UC is inflammation, so we believe that the treatment of inflammation can alleviate the symptoms of UC to effectively treat this disease.

Natural products and their semisynthetic derivatives have been important sources of new drugs due to their wide range of chemical structures and diverse bioactivities (Ge et al., 2022). Small molecules isolated and characterized from marine fungi are part of a potential natural product library for anti-inflammatory drug screening (Ge et al., 2022, Yeshi et al., 2020). Although natural products play a vital role in the development of new drugs, some natural products cannot be directly used for medicine due to their shortcomings such as insufficient activity, low specificity, unsatisfactory pharmacokinetic properties or large toxic and side effects, and further structural modification is needed (Golebiowski, Klopfenstein, & Portlock, 2001). The chemical method is to obtain a series of derivative compounds by modifying the active reaction sites in the lead compound to improve the activity of the compound (Newman, Cragg, & Kingston, 2015). In the synthesis process, a large number of novel chemical reactions have been effectively developed to promote the development of chemistry, and the natural products with the same skeleton and similar functional groups were obtained, which provided more choices for the study of the activity of natural product molecules (Majhi and Das, 2021, Zhu and Liu, 2021).

Butyrolactones, including butyrolactones I−IX (Fig. 1A) (He et al., 2013, Kiriyama et al., 1977, Lin et al., 2009, Ma et al., 2014, Nitta et al., 1983) isolated from Aspergillus terreus have garnered significant interest due to their diverse range of bioactivities (da Silva et al., 2017, Peng et al., 2022, Qi et al., 2018, Sun et al., 2018, Uras et al., 2022, Wu et al., 2019, Xie et al., 2024, Yan et al., 2021, Zhang et al., 2015). Butyrolactone V (2) first isolated from Aspergillus terreus exhibits various activities, such as antioxidant activity (An et al., 2016), α-glucosidase inhibitory activity, tumor necrosis factor-α (TNF-α) inhibitory activity (Wu et al., 2019), and anti-allergic activity (Uras et al., 2022). However, there are relatively few reports on butyrolactone V against lipopolysaccharide (LPS)-induced nitric oxide (NO) production. To further improve its anti-inflammatory activity and to investigate its structure–activity relationship (SAR) for providing a reference for subsequent studies, we decided to design and synthesize derivatives of butyrolactone V with various substituents. Furthermore, based on its structural characteristics, it can be speculated that the hydroxyl group of C-2 and C-4′ might be potential oxidation sites (Zhang et al., 2022), and the alcohol hydroxyl group of C-8″ may be good functional group for modification (Tambewagh et al., 2017). In this way, it may enhance the anti-inflammatory activity and improve the metabolic properties of butyrolactone V. However, the isolated amount of butyrolactone V was too limited to be used as a raw material for subsequent studies. Fortunately, a large amount of butyrolactone I (1) has been isolated in our previous work, and can be conveniently transformed into butyrolactone V in one pot. The methoxymethyl ether (MOM) group was selected as a protective group for the hydroxyl groups at the C-2 and C-4′ positions, mainly because it is easy to remove under acidic conditions to facilitate the synthesis of the target compounds. At the same time, the compounds substituted by the MOM group as intermediates can also provide us with powerful SAR data to guide next modification.

Fig. 1.

Fig. 1

(A) Structures of butyrolactones I−IX; (B) Structures of compounds A and B; (C) Design of butyrolactone V derivatives.

In addition, cinnamic acid (CA) and its analogs, naturally occurring phenylacrylic acids, are prevalent in plants. CA features a hydrophobic acrylic group and benzene rings with conjugated π electrons, facilitating effective interaction with hydrophobic pockets of target proteins (Li et al., 2023). Its distinctive structure and potent anti-inflammatory properties make CA a common component in both natural and synthetic compounds designed for anti-inflammatory drugs (Deng et al., 2023). For example, compound A (Fig. 1B), isolated from Lycium barbarum L., and containing a CA structure, significantly inhibited NO production (IC50 = 2.44 μmol/L), secretion, and proinflammatory cytokine induction [including interleukin-1β (IL-1β) and TNF-α] by down regulating nuclear factor-κB (NF-κB) expression in the NO synthase signaling cascade (Wang, Suh, Zheng, Wang, & Ho, 2017). Similarly, compound B (Fig. 1B), an aconitine derivative, selectively targeted the toll-like receptor4 (TLR4)/NF-κB pathway (EC50 values of 3.95 μmol/L) with minimal cytotoxicity (CC10 values > 10 μmol/L) (Pang, Liu, Gong, & Quan, 2020). Therefore, we incorporated a number of CA fragments into the design of butyrolactone V to enhance its anti-inflammatory activity. For a more systematic study of its SAR, butyrolactone V was also designed to be spliced with other fragments that might be beneficial in anti-inflammatory activities like: alkanoyl fragments, differently substituted benzoyl fragments and various heterocyclic acyl groups (Chopra and Dhingra, 2021, Guo, 2017).

Consequently, butyrolactone V and its derivatives were synthesized from compound 1, and the elementary SAR of their NO inhibitory activity was then assessed. Modification of the -OH of C-2, C-4′ and C-8″ in butyrolactone V effectively increased its anti-inflammatory activity. Furthermore, the in vivo anti-inflammatory efficacy in UC mice of most promising compounds 5p and 7e was investigated.

2. Materials and methods

2.1. Materials and instruments

The majority of chemicals, solvents, and reagents were sourced from Aladdin, Alfa Aesar, Sigma-Aldrich Chemical Co., Ltd. (Shanghai, China), and Merck (Shanghai, China), and were used without any further purification. 1H NMR spectra were obtained using NMR spectrometers (Bruker, Karlsruhe, Germany) operating at 400 MHz for 1H NMR and 101 MHz for 13C NMR. Chemical shifts (δH for 1H NMR and δC for 13C NMR) are reported in parts per million (× 10−6) downfield from trimethyl silane (TMS), while coupling constants (J) are given in Hertz (Hz). High-resolution electrospray ionization mass spectrometry (HRESIMS, Billerica, USA) data were collected in positive-ion mode using a Thermo Fisher LTQ XL LC/MS system (Thermo Fisher, Palo Alto, CA, USA). Column chromatography (CC) separations were carried out using silica gel (200–300 mesh; Qingdao Marine Chemical, Inc., Qingdao, China). Thin-layer chromatography (TLC) plates were visualized through UV absorption (Ketai experimental equipment Co., Ltd., Zhengzhou, China), vanillin or potassium permanganate solution treatment, followed by heating. All solvents employed in the synthesis of the derivatives were of reagent grade and commercially sourced. RAW 264.7 cells and dulbecco’s modified eagle medium (DMEM) were purchased from Wuhan Pricella Biotechnology Co., Ltd. (Wuhan, China). Nitric Oxide Assay Kit was purchased from Beyotime (Shanghai, China). Dextran sodium sulfate (DSS) was purchased from MeilunBio (Dalian, China). CCK-8 Cell Counting Kit was purchased from Topscience Co., Ltd. (Dalian, China).

2.2. Chemicals

2.2.1. Synthetic procedure for compound 2

Compound 1 (1.0 equiv) was dissolved in dichloromethane (CH2Cl2, DCM) (0.1−0.5 mol/L), and m-chloroperbenzoic acid (m-CPBA) (85% purity, 2.0 equiv) was added at 0 °C. The mixture was stirred for 1 h, then allowed to warm to room temperature (rt.) and stirred for an additional 2 h. The reaction progress was monitored by TLC. Subsequently, the reaction mixture was diluted with a saturated sodium sulfite (Na2SO3) solution and extracted with ethyl acetate (EtOAc) three times. The organic layer was washed with sodium bicarbonate (NaHCO3) solution and brine, dried over anhydrous sodium sulfate (Na2SO4), and filtered. The filtrate was concentrated under reduced pressure and the resulting crude product was purified by silica gel column chromatography to afford compound 2 (51% yield).

2.2.2. Synthetic procedure for compound 3

N, N-Diisopropylethylamine (DIPEA, 4.4 equiv) and bromomethyl methyl ether (MOMBr, 3.0 equiv) were added at 0 °C to a stirred solution of compound 2 (1.0 equiv) in CH2Cl2 (0.1−0.5 mol/L). The reaction mixture was stirred at 0 °C until completion, with progress monitored by TLC. Subsequently, the mixture was slowly quenched with ammonium chloride (NH4Cl) at 0 °C, extracted with CH2Cl2 three times, and the combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration and concentration in vacuo, the crude product was purified by silica gel column chromatography to obtain compound 3 (80% yield).

2.2.3. General procedure A for synthesis of compounds 4a4e from compound 3

A solution of compound 3 (1.0 equiv) and triethylamine (Et3N) (1.1 equiv) in CH2Cl2 (0.1−0.5 mol/L) was prepared, a suitably substituted acyl chloride (1.1 equiv) was added at 0 °C. The mixture was stirred for 25 min at 0 °C and then for 3 h at rt. It was quenched with saturated aqueous NaHCO3 and extracted with CH2Cl2 three times. The organic phase was dried over anhydrous Na2SO4, then the combined organic layer was filtered, the filtrate was concentrated in vacuo, and the crude product was purified by silica gel column chromatography to obtain compounds 4a4e in 83%−88% yield.

2.2.4. General procedure B for synthesis of compounds 4f4x from compound 3

1,3-Dicyclohexylcarbodiimide (DCC) (1.2 equiv) and 4-dimethylaminopyridine (DMAP) (0.2 equiv) were added to a solution of suitably substituted acids and compound 3 (1.0 equiv) in CH2Cl2 (0.1−0.5 mol/L). This mixture was stirred for 0.2 h. Upon completion, with progress monitored by TLC, the reaction was terminated with a saturated NaHCO3 solution. The mixture was subsequently washed with brine and extracted three times with EtOAc. The combined organic layers were dried using anhydrous Na2SO4, filtered, and the resultant filtrate was concentrated under reduced pressure. The resulting crude product was purified by silica gel column chromatography to obtain compounds 4f4x in 81%−89% yield.

2.2.5. General procedure C for synthesis of compounds 5a5ad

Trifluoroacetic acid (TFA) (2.2 equiv) was added to a solution of the corresponding intermediates (1 equiv) in CH2Cl2, and the mixture was initially stirred at 0 °C for 15 min, followed by stirring at rt.. for 1 h. The progress of the reaction was monitored by TLC. Upon completion, the reaction mixture was concentrated to dryness and purified by silica gel column chromatography to obtain compounds 5a5ad in 91%−95% yield.

2.2.6. Synthetic procedure for compound 6

Caesium carbonate (Cs2CO3, 2.2 equiv) was added to a solution of compound 2 (1 equiv) in dry acetone (0.1−0.5 mol/L). The mixture was stirred for 5 min, then methyl iodide (MeI, 2.2 equiv) was added dropwise at 0 °C. The reaction was allowed to proceed overnight at rt. under a N2 atmosphere with continuous stirring. The progress of the reaction was monitored by TLC. Upon completion, water was added to quench the reaction, and the aqueous phase was extracted with EtOAc. The combined organic phases were washed with brine and dried over Na2SO4. After filtration and solvent evaporation, the crude product was purified by silica gel column chromatography to obtain compound 6 in 90% yield.

2.2.7. General procedure d for synthesis of compounds 7a7c from compound 6

A solution of compound 6 (1.0 equiv) and Et3N (1.1 equiv) in CH2Cl2 (0.1−0.5 mol/L) was prepared, a suitably substituted acyl chloride (1.1 equiv) was added at 0 °C. The mixture was stirred for 25 min at 0 °C, followed by stirring for 3 h at room temperature. The reaction was quenched with saturated aqueous NaHCO3 and extracted with CH2Cl2. The organic phase was dried over anhydrous Na2SO4 and concentrated in vacuo. The filtrate was collected, concentrated in vacuo, and purified by silica gel column chromatography to obtain compounds 7a7c in 84%−89% yield.

2.2.8. General procedure E for synthesis of compounds 7d7e from compound 6

DCC (1.2 equiv) and DMAP (0.2 equiv) were added to a solution of suitably substituted acids and compound 6 (1.0 equiv) in CH2Cl2 (0.1−0.5 mol/L). The mixture was stirred for 0.2 h. The progress of the reaction was monitored by TLC. Upon completion, the reaction was terminated with a saturated NaHCO3 solution. The mixture was subsequently washed with brine and extracted three times with EtOAc. The combined organic layers were dried using anhydrous Na2SO4, filtered, and the resultant filtrate was concentrated under reduced pressure. Then purified by silica gel column chromatography to obtain 7d7e compounds in 80%−90% yield.

2.3. Biochemical studies

2.3.1. Cell culture

RAW 264.7 cells were cultured in high-glucose DMEM medium, containing 10% fetal bovine serum, 1% penicillin–streptomycin, and placed in an incubator at 37 °C with 5% CO2.

2.3.2. Cell viability assay

To evaluate the effect of compounds on the viability of RAW 264.7 cells, cells in logarithmic growth phase were spread into 96-well plates at a density of 1.0 × 104 and divided into control, LPS-induced, and LPS + compound groups, and the cells were treated for 24 h. After treatment, the cells were incubated with CCK-8 reagent at 37 °C for 2 h, and cell viability was calculated at 450 nm.

2.3.3. NO generation detection

First, the effects of 56 compounds on LPS-induced NO production were examined in RAW264.7 macrophages. The cells in logarithmic growth phase were plated in 96-well plates at a density of 1.0 × 104. The experiment was set up as control group (DMSO solvent control group), LPS group (0.5 mg/mL), compounds 5a5ad (40 μmol/L or 80 μmol/L) and compounds 4a4x group (40 μmol/L or 80 μmol/L). After 24 h of treatment, the culture supernatant was collected for detection.

Next, the effects of compounds 4a, 4b, 4d, 4t, 4u and 7a7e on LPS-induced NO production were compared in RAW264.7 macrophages. Cells were treated in the same way and plated in 96-well plates. They were divided into control group (DMSO solvent control group), LPS group (0.5 mg/mL), compounds 4a and 7a (2, 4, 8 μmol/L) and compounds 4b, 4d, 4t, 4u and 7b7e (10, 20, 40 μmol/L). Culture supernatants were collected 24 h after treatment and assayed.

Finally, the effects of compounds 5p and 7e on LPS-induced NO production were evaluated in RAW264.7 macrophages. The cells were treated with the same method and plates were prepared, and the experiments were divided into DMSO group, LPS group (0.5 mg/mL), compound 5p group (40 μmol/L or 60 μmol/L) and compound 7e group (20 μmol/L or 40 μmol/L). After 24 h of treatment, the culture supernatant was collected for detection.

2.3.4. Animals

Seven-week-old male C57BL/C mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (SCXY 2022–0030), and fed for one week in an SPF environment at the Animal Center of Tongji Medical College, Huazhong University of Science and Technology. Mice were housed in a room with constant temperature and a 12-h light/dark cycle, and were fed food and water normally. The whole experiment was ethical approved by the Formal Review of Experimental Animals Ethics of Huazhong University of Science and Technology (2023 IACUC number: 4424).

2.3.5. DSS-induced colitis

Mice were randomly divided into five groups: the control group, DSS model group, compound 5p group, compound 7e group and 5-aminosalicylic acid (5-ASA) group. DSS solution (300 mg/mL, gavage) was given for five consecutive days in all groups except the control group. Starting from day 6, the compound 5p group [100 mg/(kg·d)], compound 7d group [200 mg/(kg·d)] and 5-ASA group [150 mg/(kg·d)] were given the drug solution by gavage for six days, while the control and model groups received the same volume of carrier solvent. Mouse colitis was assessed as previously described. Briefly, body weight changes of mice during the test period were recorded and disease activity index (DAI) scores were calculated. The scoring method was shown in Table 1.

Table 1.

Disease activity index.

Score Weight loss (%) Stool consistency Fecal occult blood
0 None Normal No blood
1 1−5 Loose stool Presence
2 5−10 Loose stool Presence
3 10−15 Diarrhea Gross blood
4 > 16 Diarrhea Gross blood

2.3.6. Sample collection

On day 12, mouse blood was obtained by means of eyeball blood sampling and centrifuged to make a serum sample, which was stored at −20 °C. Then, the colon was collected and measured, and approximately 1.5 cm of the colon was fixed with 4% paraformaldehyde, and the remaining colon tissue was rinsed in cold saline until no contents remained and stored at −80 °C.

2.3.7. Histopathology of colon

For histopathological examination, fixed colon tissues were paraffin-embedded and sections were stained with hematoxylin-eosin (H&E) to observe changes in the colonic tissues.

2.3.8. RT-qPCR

Total RNA was extracted from colon tissues and RAW264.7 cells using TRIzol reagent, chloroform, isopropanol and 75% ethanol solution and then quantified using SYBR Green qPCR mix (Biosharp), all results were normalised with β-actin and the whole running procedure was followed as shown in Table 2. The primer sequences were listed below (Table 3).

Table 2.

qPCR procedure.

Cyclic step Temperature (°C) Times Cycle numbers
Pre-denaturation 95 10 min 1
Denaturation 95 10 s 38
Annealing 60 20 s 38
Extension 72 20 s 38
Table 3.

Primer sequences used for RT-qPCR.

Genes Forward primers (3′-5′) Reversed primers (3′-5′)
CCL12 GCTACCACCATCAGTCCTCAGG ACTGGCTGCTTGTGATTCTCCT
CXCL10 ATCATCCCTGCGAGCCTATCCT GTGCGTGGCTTCACTCCAGTTA
CXCL16 GCAGGCTCGTCTCCATCAGTGA AGGCAAAGGGTCAGCAGGTCAA
CX3CL1 GCACCACCATCACCATCAACAC GCCTTCACAGCACATCCAAGTC
CXCL11 ACAGGAAGGTCACAGCCATAGC TCAACTTTGTCGCAGCCGTTAC
Tyrobp TTCTTCCGTGAGCCCTGGTGTA GGCGACTCAGTCTCAGCAATGT
Duoxa-2 AGAAGTTCACACCGAGCAGTCC CGAAGGCGAAGACACCGAAGAG
AQP8 AGCAGGAGCAGGTGGCAGAA CAAAGGCACGAGCAGGGTTCAT
β-actin AGAAGGACTCCTATGTGGGTG TGAGCAGCACAGGGTGCTCCTC

2.3.9. Statistical analysis

All the data were evaluated using DraphPad Prime 9 software. One-way ANOVA was performed, and the data are expressed as the mean ± SEM, with P values < 0.05 considered statistically significant.

3. Results and discussion

3.1. Synthesis of compounds 2, 3, 4a4x and 5a5ad

The synthetic route is outlined in Fig. 2. Compound 1 was used as the starting material to obtain product compound 2 using m-CPBA as an oxidant (Sugamoto, Kurogi, Matsushita, & Matsui, 2008). MOMBr was added to modify the -OH of C-2 and C-4′ to generate compound 3 (Vo, Mitchell, & Bode, 2011), which was then coupled with a variety of substituted carboxylic acids or substituted acyl chloride in the presence of DCC and DMAP or Et3N to obtain compounds 4a4x (Samim Mondal et al., 2023, Thurow et al., 2019). Afterwards, the -MOM group was removed by TFA to give compounds 5a5ad (Davenport, Dickson, Johnson, & Chamberland, 2019). The actual structures of M1−M31 were showed in Fig. 2.

Fig. 2.

Fig. 2

Synthesis route of compounds 2, 3, 4a4x, 5a5ad and actual structures of M1−M31.

3.2. Synthesis of compounds 6, 7a7e

The synthetic route is outlined in Fig. 3. Using compound 2 as starting material, it reacted with iodomethane (MeI) with the aid of Cs2CO3 to obtain compound 6 (Hrast et al., 2013), which was then coupled with various substituted acids using DCC or the corresponding acyl chloride using Et3N to obtain 7a7e (Samim Mondal et al., 2023, Thurow et al., 2019). All the compounds described in this study were thoroughly characterized using physical and spectroscopic methods [1H and 13C NMR, as well as High-Resolution Mass Spectrometry (HRMS)]. Most of the novel compounds were subsequently evaluated for their in vitro biological activities, as detailed in the following sections.

Fig. 3.

Fig. 3

Synthesis route of compounds 6, 7a7e.

3.3. Effect of 56 compounds on NO production in LPS-induced RAW264.7 macrophages

To investigate the pharmacodynamics of the compounds, LPS-induced NO formation in RAW264.7 cells to assess the anti-inflammatory activity of the compounds was assayed. The RAW264.7 cells were treated simultaneously with LPS and varying concentrations (40 or 80 μmol/L) of the compounds for a duration of 24 h. LPS induction elevated NO production in the supernatant, whereas treatment with compounds 5p, 5u (Fig. 4A) and 4a, 4b, 4d, 4t, and 4u (Fig. 4B) significantly reduced NO production and thus exerted anti-inflammatory effects.

Fig. 4.

Fig. 4

Preliminary screening of compounds for anti-inflammatory activity (mean ± SEM, n = 3). (A−B) Production of NO in RAW264.7 cells treated with LPS and different concentrations of compounds for 24 h was detected. ***P < 0.001 vs control group; #P < 0.05, ##P < 0.01, ###P < 0.001 vs LPS group; ns: no significant.

3.4. SAR of compounds 4a4x and 5a5ad

As shown in Fig. 4, NO production after LPS treatment of RAW264.7 cells was measured to assess the anti-inflammatory activity of the above 56 compounds including compounds 2 and 3. Compared to compound 2, among the compounds 5a5ad (Fig. 4A) with alkanoyl fragments (M1−M5) did not contribute much to the improvement in biological activity. In comparison, differently substituted benzoyl fragments (M6−M13) and cinnamoyl groups bearing different substituents (M14−M26) could strongly improve the activity of compound 2. When substituted with M16 and M21 (5p and 5u), the activity was obviously enhanced, which was the best. Analysis of the structural characteristics of this series of compounds revealed compound 2 coupled with different substituted cinnamoyl groups showed better anti-inflammatory activity. Among them, the effect of F and Cl atoms on the activity of benzene ring was lower than that of Br atom; moreover, the activity enhancement of Br atom was greater at the para-position than at the ortho-position. Furthermore, compound 2 substituted with heterocyclic acyl groups only slightly improved the anti-inflammatory activity.

Furthermore, it was excited to find the activity of the intermediates (compounds 3 and 4a4x) was significantly improved when compared to compound 2. Among the compounds 4a4x (Fig. 4B), heterocyclic acyl groups contributed more to the improvement in activity than did the other groups, and alkanoyl fragments performed better than groups containing benzoyl fragments. When the group was propyl (R1 = M2), the activity of compound 4b was the best. Moreover, compared with compounds containing benzoyl fragments (4f4k), heterocyclic acyl groups can greatly increase the anti-inflammatory activity, such as 4t and 4u. Due to the results, O-containing heterocycles are more prominent than N-containing ones.

According to the preliminary test results of pharmacological activity, we found that the activities of 4a, 4b, 4d, 4t, and 4u were most prominent among 4a4x. To collect more information about the SAR of compound 2 and to avoid the fragile of -MOM under acidic conditions, which might influence the experiments in vivo, the -MOM group on the above five compounds was replaced by -CH3 instead.

3.5. Comparison of compounds 4a, 4b, 4d, 4t, 4u and 7a7e

Then, the anti-inflammatory activities of these five compounds (4a, 4b, 4d, 4t, and 4u) were compared with their methylated derivatives (7a7e). The data showed that the heterocyclic acyl groups still performed better than the alkanoyl fragments. However, there were some differences among 4a, 4b, 4d, 4t, 4u and 7a7e. The results showed that the inhibitory effects of modified compounds 7a and 7b on LPS-induced NO production were similar to those of premodified compounds 4a and 4b. The inhibitory effect of 7c was weaker than that of 4d, while the inhibitory effect of 7d was better than that of 4t. Compound 7e showed more significantly inhibitory effect than that of 4u (Fig. 5). Therefore, the change of the -MOM group to -CH3 has a positive effect on the activity of the compounds.

Fig. 5.

Fig. 5

Determination of activity of five compounds before and after modification (mean ± SEM, n = 3). (A−B) NO production in RAW264.7 cells was measured after treatment with LPS and different concentrations of compounds for 24 h. ***P < 0.001 vs control group; ###P < 0.001 vs LPS group.

3.6. Effect of compounds 5p and 7e on RAW264.7 macrophages

Based on the previous screening for the anti-inflammatory activity of all the compounds, compounds 5p and 7e were selected for subsequent experiments. The cell viability assays revealed that compounds 5p (40 or 60 μmol/L) and 7e (20 or 40 μmol/L) did not produce cytotoxic effects on RAW264.7 cells (Fig. 6A) and significantly reduced the production of NO induced by LPS in RAW264.7 cells (Fig. 6B). Meanwhile, the anti-inflammatory activity of compound 5p was dose-dependent. In addition, we investigated the effects of compounds 5p and 7e on gene expression in RAW264.7 cells. The results showed that compounds 5p (60 μmol/L) and 7e (40 μmol/L) significantly reversed the upregulation of gene expression induced by LPS (Fig. 6C).

Fig. 6.

Fig. 6

Effects of compounds 5p and 7e on RAW264.7cells (mean ± SEM, n = 3). (A) Cell viability of RAW264.7 cells was determined after 24 h of compounds treatment. (B) NO production in RAW264.7 cells was determined after 24 h treatment with LPS and various concentrations of the compounds. (C) RT-qPCR analysis of mRNA expression in RAW264.7 cells treated with LPS and different compounds for 24 h. **P < 0.01, ***P < 0.001 vs control group; ##P < 0.01, ###P < 0.001 vs LPS group; ns: no significant.

3.7. Compounds 5p and 7e ameliorate DSS-induced colitis

To further investigate the anti-inflammatory activity of the compounds in vivo, we chose DSS-induced UC mice for our studies (Fig. 7A). Mouse body weight, fecal viscosity and fecal bleeding were recorded daily. Compounds 5p and 7e were able to slow the DSS-induced decrease in body weight (Fig. 7B), increase in DAI score (Fig. 7C) and inhibit the shortening of colon length in mice (Fig. 7D and E). Histopathological examination was performed to further assess the extent of colonic injury and inflammation. The results showed that compounds 5p and 7e alleviated DSS-induced ulceration, epithelial damage, and inflammatory cell infiltration in the colon tissues of the mice (Fig. 7F). Histological scores also confirmed that compounds 5p and 7e attenuated DSS-induced inflammatory injury in the colon of mice (Fig. 7G). Subsequently we analyzed the transcript levels of several genes in colon tissues by RT-qPCR. The data showed that compounds 5p and 7e significantly inhibited the DSS-induced upregulation of CCL12, CXCL10, CXCL16, CX3CL1 and CXCL11, as well as the expression of Tyrobp and Duoxa-2 (Fig. 7H). AQPs are a family of proteins present in colonic epithelial cells, and AQP8 plays an important role in the process of intestinal water absorption. Compounds 5p and 7e significantly upregulated the DSS-induced decrease in AQP8 expression, alleviating intestinal barrier damage and impaired water absorption (Fig. 7H). These results suggest that compounds 5p and 7e are able to ameliorate colitis, which may be linked to the intestinal barrier and anti-inflammatory activity, and the related mechanism of action needs to be investigated in further studies.

Fig. 7.

Fig. 7

Effects of compounds 5p and 7e on DSS-induced UC (mean ± SEM, n = 5). (A) Experimental procedure. (B) Daily body weight changes in the mice. (C) Assessment of DAI in mice with colitis. (D−E) Mouse colon length measurements. (F−G) H&E staining and histological evaluation of mouse colon. (H) RT-qPCR analysis of mRNA expression. ***P < 0.001 vs control group; #P < 0.05, ##P < 0.01, ###P < 0.001 vs DSS group; ns: no significant.

4. Conclusion

In the recent study, reports on the anti-inflammatory activity of butyrolactones are scarce. To fully investigate the structural relationship of butyrolactone V, a total of 60 derivatives were synthesized. In this research, molecular splicing was adopted and the C-8″ position of butyrolactone V was thoroughly modified to improve its anti-inflammatory activity. A variety of alkanoyl fragments, differently substituted benzoyl fragments, cinnamoyl groups bearing different substituents and various heterocyclic acyl groups have been introduced. The results showed that compounds esterified with CA improved the anti-inflammatory activity of butyrolactone V. In addition, the effects of the substituents at C-2 and C-4′ on the anti-inflammatory activity were also investigated. SAR studies indicated that when -MOM was replaced with -CH3, the anti-inflammatory activity increased.

Overall, we designed, synthesized and tested the anti-inflammatory activities of 60 derivatives of butyrolactone V from the natural product butyrolactone I. Compounds 5p and 7e can inhibit NO production by LPS-induced RAW264.7 macrophages. Further in vivo and in vitro studies demonstrated that these compounds can attenuate DSS-induced clinical signs, reverse the shortening of colon length, reduce histological damage and decrease chemokine expression to alleviate DSS-induced UC in mice. In summary, these results suggested that the anti-inflammatory activities of compounds 5p and 7e have the potential to be promising new therapies for the alleviation of UC.

CRediT authorship contribution statement

Wen Liu: Conceptualization, Methodology, Writing – original draft, Project administration. Biqiong Zhang: Investigation, Data curation, Project administration. Zhengxi Hu: Conceptualization, Resources. Si Yao: Methodology, Formal analysis. Yunpeng Zhao: Methodology, Writing – review & editing. Fengqing Wang: Methodology, Writing – review & editing. Yuanyuan Wang: Methodology. Xinxin Yang: Methodology. Jie Yin: Methodology. Weiguang Sun: Methodology. Qingyi Tong: Resources, Supervision, Writing – review & editing, Project administration. Lianghu Gu: Resources, Supervision, Writing – review & editing, Project administration. Yonghui Zhang: Resources, Supervision, Writing – review & editing, Funding acquisition.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This research was funded by the National Natural Science Foundation of China (Nos. 81725021, 81903461, and 82173705), as well as the Natural Science Foundation of Hubei Province, China (No. ZRMS2023000340). We are grateful to the Medical Subcenter of HUST Analytical & Testing Center for their assistance in data acquisition.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.chmed.2025.03.004.

Contributor Information

Lianghu Gu, Email: gulianghu@hust.edu.cn.

Yonghui Zhang, Email: zhangyh@mails.tjmu.edu.cn.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Supplementary Data 1
mmc1.docx (32.9MB, docx)
Supplementary Data 2
mmc2.docx (57KB, docx)

References

  1. An X., Pei Y., Chen S., Li S., Hu X., Chen G., et al. Three new butenolides from the fungus Aspergillus sp. CBS-P-2. Molecules. 2016;21(10):1361. doi: 10.3390/molecules21101361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Cai X., Wang L., Yi Y., Deng D., Shi M., Tang M., et al. Discovery of pyrimidine-5-carboxamide derivatives as novel salt-inducible kinases (SIKs) inhibitors for inflammatory bowel disease (IBD) treatment. European Journal of Medicinal Chemistry. 2023;256 doi: 10.1016/j.ejmech.2023.115469. [DOI] [PubMed] [Google Scholar]
  3. Chen P., Yang J., Zhou Y., Li X., Zou Y., Zheng Z., et al. Design, synthesis, and bioactivity evaluation of novel amide/sulfonamide derivatives as potential anti-inflammatory agents against acute lung injury and ulcerative colitis. European Journal of Medicinal Chemistry. 2023;259 doi: 10.1016/j.ejmech.2023.115706. [DOI] [PubMed] [Google Scholar]
  4. Chopra B., Dhingra A.K. Natural products: A lead for drug discovery and development. Phytotherapy Research. 2021;35(9):4660–4702. doi: 10.1002/ptr.7099. [DOI] [PubMed] [Google Scholar]
  5. da Silva I.P., Brissow E., Kellner Filho L.C., Senabio J., de Siqueira K.A., Vandresen Filho S., et al. Bioactive compounds of Aspergillus terreus-F7, an endophytic fungus from Hyptis suaveolens (L.) Poit. World Journal of Microbiology & Biotechnology. 2017;33(3):62. doi: 10.1007/s11274-017-2228-3. [DOI] [PubMed] [Google Scholar]
  6. Davenport M.T., Dickson J.A., Johnson M.R., Chamberland S. Total synthesis of clavatadine B. Journal of Natural Products. 2019;82(11):3191–3195. doi: 10.1021/acs.jnatprod.9b00813. [DOI] [PubMed] [Google Scholar]
  7. Deng H., Xu Q., Guo H.Y., Huang X., Chen F., Jin L., et al. Application of cinnamic acid in the structural modification of natural products: A review. Phytochemistry. 2023;206 doi: 10.1016/j.phytochem.2022.113532. [DOI] [PubMed] [Google Scholar]
  8. Ge J., Liu Z., Zhong Z., Wang L., Zhuo X., Li J., et al. Natural terpenoids with anti-inflammatory activities: Potential leads for anti-inflammatory drug discovery. Bioorganic Chemistry. 2022;124 doi: 10.1016/j.bioorg.2022.105817. [DOI] [PubMed] [Google Scholar]
  9. Golebiowski A., Klopfenstein S.R., Portlock D.E. Lead compounds discovered from libraries. Current Opinion in Chemical Biology. 2001;5(3):273–284. doi: 10.1016/s1367-5931(00)00203-9. [DOI] [PubMed] [Google Scholar]
  10. Guo Z. The modification of natural products for medical use. Acta Pharmaceutica Sinica B. 2017;7(2):119–136. doi: 10.1016/j.apsb.2016.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. He F., Bao J., Zhang X.Y., Tu Z.C., Shi Y.M., Qi S.H. Asperterrestide A, a cytotoxic cyclic tetrapeptide from the marine-derived fungus Aspergillus terreus SCSGAF0162. Journal of Natural Products. 2013;76(6):1182–1186. doi: 10.1021/np300897v. [DOI] [PubMed] [Google Scholar]
  12. Hrast M., Turk S., Sosič I., Knez D., Randall C.P., Barreteau H., et al. Structure-activity relationships of new cyanothiophene inhibitors of the essential peptidoglycan biosynthesis enzyme MurF. European Journal of Medicinal Chemistry. 2013;66:32–45. doi: 10.1016/j.ejmech.2013.05.013. [DOI] [PubMed] [Google Scholar]
  13. Kiriyama N., Nitta K., Sakaguchi Y., Taguchi Y., Yamamoto Y. Studies on the metabolic products of Aspergillus terreus. III. Metabolites of the strain IFO 8835.1. Chemical and Pharmaceutical Bulletin. 1977;25(10):2593–2601. [Google Scholar]
  14. Li X., Hu Y., He B., Li L., Tian Y., Xiao Y., et al. Design, synthesis and evaluation of ursodeoxycholic acid-cinnamic acid hybrids as potential anti-inflammatory agents by inhibiting Akt/NF-κB and MAPK signaling pathways. European Journal of Medicinal Chemistry. 2023;260 doi: 10.1016/j.ejmech.2023.115785. [DOI] [PubMed] [Google Scholar]
  15. Lin T., Lu C., Shen Y. Secondary metabolites of Aspergillussp. F1, a commensal fungal strain of Trewia nudiflora. Natural Product Research. 2009;23(1):77–85. doi: 10.1080/14786410701852826. [DOI] [PubMed] [Google Scholar]
  16. Ma X., Zhu T., Gu Q., Xi R., Wang W., Li D. Structures and antiviral activities of butyrolactone derivatives isolated from Aspergillus terreus MXH-23. Journal of Ocean University of China. 2014;13(6):1067–1070. [Google Scholar]
  17. Majhi S., Das D. Chemical derivatization of natural products: Semisynthesis and pharmacological aspects- A decade update. Tetrahedron. 2021;78 [Google Scholar]
  18. Newman D.J., Cragg G.M., Kingston D.G.I. Chapter 5-natural products as pharmaceuticals and sources for lead structures*. The Practice of Medicinal Chemistry. 2015:101–139. [Google Scholar]
  19. Nitta K., Fujita N., Yoshimura T., Arai K., Yamamoto Y. Metabolic products of Aspergillus terreus. IX. Biosynthesis of butyrolactone derivatives isolated from strains IFO 8835 and 4100. Chemical and Pharmaceutical Bulletin. 1983;31(5):1528–1533. [Google Scholar]
  20. Pang L., Liu C.Y., Gong G.H., Quan Z.S. Synthesis, in vitro and in vivo biological evaluation of novel lappaconitine derivatives as potential anti-inflammatory agents. Acta Pharmaceutica Sinica B. 2020;10(4):628–645. doi: 10.1016/j.apsb.2019.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Peng Q., Chen W., Lin X., Xiao J., Liu Y., Zhou X. Butenolides from the coral-derived fungus Aspergillius terreus SCSIO41404. Marine Drugs. 2022;20(3):212. doi: 10.3390/md20030212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Qi C., Gao W., Guan D., Wang J., Liu M., Chen C., et al. Butenolides from a marine-derived fungus Aspergillus terreus with antitumor activities against pancreatic ductal adenocarcinoma cells. Bioorganic & Medicinal Chemistry. 2018;26(22):5903–5910. doi: 10.1016/j.bmc.2018.10.040. [DOI] [PubMed] [Google Scholar]
  23. Ramos G.P., Papadakis K.A. Mechanisms of disease: Inflammatory bowel diseases. Mayo Clinic Proceedings. 2019;94(1):155–165. doi: 10.1016/j.mayocp.2018.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Samim Mondal A.R., Ghorai B., Hari D.P. Photoinduced temperature-regulated selective carbene C-H insertion for the synthesis of functionalized spiro-β-lactones and -lactams. Organic Letters. 2023;25(27):4974–4979. doi: 10.1021/acs.orglett.3c01549. [DOI] [PubMed] [Google Scholar]
  25. Sugamoto K., Kurogi C., Matsushita Y.I., Matsui T. Synthesis of 4-hydroxyderricin and related derivatives. Tetrahedron Letters. 2008;49(47):6639–6641. [Google Scholar]
  26. Sun Y., Liu J., Li L., Gong C., Wang S., Yang F., et al. New butenolide derivatives from the marine sponge-derived fungus Aspergillus terreus. Bioorganic & Medicinal Chemistry Letters. 2018;28(3):315–318. doi: 10.1016/j.bmcl.2017.12.049. [DOI] [PubMed] [Google Scholar]
  27. Tambewagh U.U., Kandhare A.D., Honmore V.S., Kadam P.P., Khedkar V.M., Bodhankar S.L., et al. Anti-inflammatory and antioxidant potential of guaianolide isolated from Cyathocline purpurea: Role of COX-2 inhibition. International Immunopharmacology. 2017;52:110–118. doi: 10.1016/j.intimp.2017.09.001. [DOI] [PubMed] [Google Scholar]
  28. Thurow S., Fernandes A.A.G., Quevedo-Acosta Y., de Oliveira M.F., de Oliveira M.G., Jurberg I.D. Preparation of organic nitrates from aryldiazoacetates and Fe(NO3)3·9H2O. Organic Letters. 2019;21(17):6909–6913. doi: 10.1021/acs.orglett.9b02522. [DOI] [PubMed] [Google Scholar]
  29. Uras I.S., Korinek M., Albohy A., Abdulrazik B.S., Lin W., Ebada S.S., et al. Anti-inflammatory, antiallergic and COVID-19 main protease (Mpro) inhibitory activities of butenolides from a marine-derived fungus Aspergillus costaricaensis. ChemistrySelect. 2022;7(12) doi: 10.1002/slct.202200130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vo C.V.T., Mitchell T.A., Bode J.W. Expanded substrate scope and improved reactivity of ether-forming cross-coupling reactions of organotrifluoroborates and acetals. Journal of the American Chemical Society. 2011;133(35):14082–14089. doi: 10.1021/ja205174c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang S., Suh J.H., Zheng X., Wang Y., Ho C.T. Identification and quantification of potential anti-inflammatory hydroxycinnamic acid amides from wolfberry. Journal of Agricultural and Food Chemistry. 2017;65(2):364–372. doi: 10.1021/acs.jafc.6b05136. [DOI] [PubMed] [Google Scholar]
  32. Wu W., Liu L., Zhu H., Sun Y., Wu Y., Liao H., et al. Butyrolactone-I, an efficient α-glucosidase inhibitor, improves type 2 diabetes with potent TNF-α-lowering properties through modulating gut microbiota in db/db mice. The FASEB Journal. 2019;33(11):12616–12629. doi: 10.1096/fj.201901061R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Xie C.L., Xiao H.X., Song P.F., Liu Q.M., Wei H., Wu L., et al. Lead optimization of butyrolactone I as an orally bioavailable antiallergic agent targeting FcγRIIB. Journal of Medicinal Chemistry. 2024;67(9):7504–7515. doi: 10.1021/acs.jmedchem.4c00354. [DOI] [PubMed] [Google Scholar]
  34. Yan S., Qi C., Song W., Xu Q., Gu L., Sun W., et al. Discovery of GOT1 inhibitors from a marine-derived Aspergillus terreus that act against pancreatic ductal adenocarcinoma. Marine Drugs. 2021;19(11):588. doi: 10.3390/md19110588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yang Y., Wang Y., Zhao L., Wang F., Li M., Wang Q., et al. Chinese herbal medicines for treating ulcerative colitis via regulating gut microbiota-intestinal immunity axis. Chinese Herbal Medicines. 2023;15(2):181–200. doi: 10.1016/j.chmed.2023.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yeshi K., Ruscher R., Hunter L., Daly N.L., Loukas A., Wangchuk P. Revisiting inflammatory bowel disease: Pathology, treatments, challenges and emerging therapeutics including drug leads from natural products. Journal of Clinical Medicine. 2020;9(5):1273. doi: 10.3390/jcm9051273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang P., Li X.M., Wang J.N., Li X., Wang B.G. New butenolide derivatives from the marine-derived fungus Paecilomyces variotii with DPPH radical scavenging activity. Phytochemistry Letters. 2015;11:85–88. [Google Scholar]
  38. Zhang Y., Li H., Jin S., Lu Y., Peng Y., Zhao L., et al. Cannabidiol protects against Alzheimer’s disease in C. elegans via ROS scavenging activity of its phenolic hydroxyl groups. European Journal of Pharmacology. 2022;919 doi: 10.1016/j.ejphar.2022.174829. [DOI] [PubMed] [Google Scholar]
  39. Zhu Q., Liu C. The future directions of synthetic chemistry. Pure and Applied Chemistry. 2021;93(12):1463–1472. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data 1
mmc1.docx (32.9MB, docx)
Supplementary Data 2
mmc2.docx (57KB, docx)

Articles from Chinese Herbal Medicines are provided here courtesy of Elsevier

RESOURCES