Enhancing Wound Healing with a Novel Alginate/Eggshell Membrane‐Based Hydrogel Enriched with Red Ginseng Roots and Centella Asiatica

ABSTRACT

Background

Bridging ancient herbal wisdom with modern biomaterial innovation, this study pioneers a smart hydrogel infused with Red Ginseng (RG) (angiogenesis‐boosting ginsenosides) and Centella asiatica (collagen‐stimulating asiaticoside), synergized with alginate and upcycled eggshell membrane for unrivaled wound adhesion and eco‐conscious design. Unlike conventional hydrogels, this bioactive synergy accelerates tissue regeneration while fighting antibiotic‐resistant infections, thus opening up a new era of wound care inspired by nature.

Methods & Materials

Initially, seven distinct hydrogel formulations were generated by blending sodium alginate and eggshell membrane with RG roots and centella asiatica at optimal concentrations. Subsequently, the hydrogels' structural characteristics were assessed using scanning electron microscope (SEM) and Fourier Transforms Infrared Spectroscopy (FTIR) techniques. Following structural validation, the study comprehensively evaluated the physical attributes of the hydrogels, encompassing swelling behavior, stability, weight loss, porosity, and antibacterial properties. Biocompatibility of the prepared hydrogels was assessed through hemolytic activity and cell viability analyses. Moreover, the therapeutic efficacy of the hydrogels was examined using a rat model, encompassing RNA expression and histological assessments to elucidate their potential wound‐healing attributes.

Results

The developed hydrogel exhibited a porous architecture with interconnected cavities conducive to facilitating cell migration. Additionally, the hydrogels demonstrated antibacterial properties, as confirmed by antibacterial assays. MTT analysis revealed a positive impact on cell proliferation, with no observed cellular toxicity. Furthermore, in vivo experiments demonstrated that the hydrogels outperformed the control group, treated with gauze, in accelerating wound closure. Notably, the alginate/eggshell membrane/RG roots/Centella asiatica group exhibited the highest percentages of wound closure, re‐epithelialization, and gene expression.

Conclusion

This hydrogel transcends conventional wound care, harnessing RG's angiogenic magic and centella's collagen‐boosting power within a sustainable alginate‐eggshell matrix to forge a bioactive bridge between lab bench and bedside. Its triple potential (rapid closure, infection defense, and scar suppression) makes it a promising dressing.

1. Introduction

The human body relies on the skin as a vital defense mechanism against harmful influences [1]. An injury, whether it be a disruption in anatomical structure or function, can result in significant clinical and economic hardships and, in severe cases, may even be fatal to humans [2]. The use of wound dressings is considered a critical component in both the treatment and healing of wounds, whether they are acute or chronic. A wound dressing is primarily employed to furnish a provisional safeguard against external contaminants, absorb exudate emanating from the wound, and maintain optimal moisture levels to facilitate the process of re‐epithelialization [3].

Various mechanisms regulate the complex biological phenomenon of wound healing. Among these mechanisms, growth factors such as transforming growth factor Transforming Growth Factor‐beta 1 (TGF)‐β and vascular endothelial growth factor (VEGF), as well as inflammatory cells, play key roles in the wound repair process [4, 5]. Matrix metalloproteinases (MMPs), which are enzymes, have an important function in playing an essential role in degrading and modifying the extracellular matrix (ECM) during tissue remodeling and wound healing processes. MMP‐1, which originates from fibroblasts, initiates the breakdown of fibrillar collagen. MMP‐1, in conjunction with MMP‐9, plays a critical part in the wound repair process by performing various functions such as instigating inflammation, reorganizing the ECM, encouraging the formation of new blood vessels, and aiding in the restoration of epithelial tissue. Tissue Inhibitor of Metalloproteinase‐1 (TIMPs), on the other hand, are endogenous inhibitors of MMPs. They regulate MMP activity and prevent excessive ECM degradation, thus promoting tissue repair and preventing tissue damage [6, 7]. TIMPs also play a role in regulating cell migration and proliferation, as well as in promoting cell survival and inhibiting apoptosis. Together, MMPs and TIMPs play a crucial role in balancing ECM degradation and remodeling during the wound repair process. A proper balance between MMPs and TIMPs is essential for optimal wound repair, and any disruption in this balance can result in delayed or impaired wound healing [8].

Past research has documented the utilization of aquatic plant materials and organisms as wound dressings [9]. The evolution of wound dressing technology has brought about significant transformations. Besides, the inclusion of natural and chemical drugs in dressings to develop the process of wound healing has become increasingly prevalent. The research conducted by scientists has enabled them to embed drugs and materials that promote the healing of wounds into polymer scaffolds [10]. Aside from their biocompatibility, these polymers also extend the duration of drug release. Numerous studies have shown that using natural polymers in either their composite or simple form is an effective strategy in decreasing the duration of wound healing [11].

The development and production of hydrogels serve as an instance of how polymers can be employed in the creation of wound dressings [9]. Hydrogels are a type of polymer material characterized by a network architecture that is cross‐linked through chemical or physical reactions, providing them with exceptional water‐absorption and swelling capabilities as a result of their hydrophilic groups [12, 13]. Hydrogels are differentiated from other types of polymeric structures through this unique characteristic [14]. Consequently, hydrogels have a closer resemblance to natural body tissues when compared to other synthetic polymeric structures. Advances have recently promoted the creation of functionalized hydrogels with improved properties, including self‐healing, injectability, and environmental sensitivity. As an example, a work by Zhou et al. described a multifunctional hydrogel system consisting of hyaluronic acid methacrylate, tannic acid, and okra extract with antibacterial, antioxidant, and hemostatic activity that considerably promoted infected wound healing in models [15]. A systematic review has demonstrated that hydrogel dressings facilitate more rapid healing of chronic wounds such as diabetic foot ulcers and pressure ulcers than with standard dressings [16]. The presence of bioactive ingredients in hydrogels has been proven to augment the therapeutic activity. For instance, plant‐extract‐loaded hydrogels with polyphenols and terpenoids were demonstrated to show better anti‐inflammatory and angiogenic activity, thereby yielding better wound healing results [17]. Researchers have investigated a variety of water‐soluble polymers for use in hydrogel wound dressings. Hydrogels employed in the process of wound healing are commonly obtained from natural and synthetic polymeric origins, each possessing advantages of use in the clinic. Of the natural origins, alginate derived from brown seaweed is among the most prevalent due to its outstanding biocompatibility, good absorption, and capability of offering a moist healing environment to the healing wound. Chitosan, which is derived from the deacetylation of chitin from crustacean shells, has been of particular interest because it has natural hemostatic and antimicrobial activity as well as promoting cell proliferation. Collagen and gelatin, derived from connective tissues, closely mimic the extracellular matrix and promote cell migration, thereby promoting tissue regeneration. Furthermore, hyaluronic acid, a glycosaminoglycan naturally occurring, is also important for the induction of angiogenesis and re‐epithelialization because it is hydrophilic and viscoelastic [18, 19, 20]. Synthetic polymers such as PEG, PVA, and PAAm are also employed due to their tunable mechanical properties and drug release. The blend of natural and synthetic elements allows for the preparation of multipurpose hydrogel dressings that can effectively impart both structural strength as well as biological healing support in acute and chronic wounds [21, 22].

Alginate, a biopolymer sourced from brown seaweed, is biocompatible and biodegradable, rendering it a perfect material for utilization in wound dressings. Alginate dressings possess high absorbency and can effectively absorb significant volumes of exudate from wounds, which helps to create a moist environment that is conducive to wound healing [14]. According to reports, the use of alginate has been shown to enhance wound contraction and tensile strength by expanding the levels of hydroxyproline and collagens [23].

The eggshell membrane (ESM) consists of two layers and is a fibrous structure made up of biopolymers that protect the forming egg and provide a platform for nucleation of the calcific eggshell [24]. Hyaluronic acid, chondroitin sulfate, and proteins are among the bioactive compounds present in the ESM [25]. ESM has been proposed as a viable option for wound repair owing to its biological compatibility and its capacity to create a robust connection with the wound surface. ESM has also been reported to be a cost‐effective and reliable biomaterial for wound healing [26]. As an example, a study has demonstrated the efficacy of processed ESM powder (PEP) in enhancing wound recovery in a rat model of surgical wounds treated with binding. In mice, the local administration of PEP has been shown to expedite wound suturing, enhance granulation tissue remodeling, and boost collagen formation, as evidenced by recent studies. These findings have paved the way for medical research studies of an advanced wound care product called DermaRep, which incorporates PEP as an active ingredient [27].

Plant‐derived bioactive compounds, such as polyphenols, terpenoids, and polysaccharides, exhibit significant therapeutic efficacy in wound healing by modulating inflammation, enhancing angiogenesis, and promoting extracellular matrix remodeling. Their integration into advanced biomaterials offers a sustainable, multifunctional alternative to synthetic therapies, bridging traditional ethnopharmacology with modern regenerative medicine [28, 29].

Red Ginseng (RG) roots are among the most extensively utilized medicinal plants in traditional oriental medicine [30]. The extracts derived from the root of RG have been employed topically as a medication for treating skin wounds, atopic dermatitis, and inflammation of the skin [31]. Ginseng has been widely studied and has numerous pharmacological effects, including regulating cholesterol, dilating blood vessels, and exhibiting anti‐cancer and anti‐aging properties. It also benefits the dermatological systems and promotes protein synthesis, neovascularization, and angiogenesis. Recent studies have demonstrated that ginseng is also anti‐inflammatory and antimicrobial [32]. The pharmacological effects of ginseng are largely attributed to its primary active constituents, known as ginsenosides. These compounds are widely recognized for their role in mediating the various therapeutic properties of ginseng [33]. While the direct contribution of ginseng to wound healing has not been confirmed, its diverse properties imply that it could have a substantial influence on the process. As a whole, these characteristics suggest that ginseng can play a vital role in facilitating wound healing.

Centella Asiatica, commonly known as CA, is a highly valued medicinal herb with a long history of use in the East [34]. The main bioactive compounds found in CA are saponins, also called triterpenoids. These saponins consist of asiaticosides, which are composed of asiatic acid aglycone attached to a trisaccharide component, as well as madecassoside and madasiatic acid [35]. For many years, CA extracts (CAE) have been utilized for wound healing, and recent research has provided growing evidence to support these assertions [36].

In a study, Goodarzi et al. designed a wound dressing for full‐thickness wound healing by incorporating alginate into an alginate hydrogel. This wound dressing was porous, biocompatible, hemocompatible, and resulted in re‐epithelialization. However, the lack of a water‐soluble herbal compound resulted in reduced structural uniformity and irregular release [37]. In another study, the alginate hydrogel loaded with Lilium candidum (white lily) extract demonstrated cytotoxicity in endothelial cells at higher extract concentrations and relied on in vitro models, which may not fully replicate the chronic wound microenvironment or long‐term biocompatibility. Additionally, the study did not assess scalability, stability under clinical conditions, or potential allergic responses to plant‐derived components [38].

While there have been examinations in the literature that utilized RG roots and centella asiatica in polymer composites, the incorporation of these organic compounds into a combination of alginate and eggshell membranes has not been explored. This evaluation aimed to design an advanced wound care product by incorporating RG roots and centella asiatica into a composite of alginate and eggshell membrane to capitalize on the potential properties of these compounds to achieve a notable improvement in the wound healing process.

2. Materials and Methods

2.1. Materials

Calcium chloride (CaCl₂), fetal bovine serum (FBS), phosphate‐buffered saline (PBS), sodium alginate (medium molecular weight), 3‐(4, 5‐dimethylthiazol‐2‐yl2, 5‐diphenyltetrazolium bromide) (MTT), penicillin‐streptomycin solution (pen‐strep solution), Dulbecco's modified eagle medium (DMEM‐F12) and Trypsin‐ethylene diamine tetra acetic acid (trypsin‐EDTA) were purchased from Merck and Sigma‐Aldrich. Beremer Pharma, Germany, provided Ketamine 10% and Xylazine 2% for the experiment, while the cDNA synthesis kit and RNA extraction kit were obtained from Gene‐All in South Korea. The RT‐PCR primers used in the experiment were obtained from Bionic in South Korea [39].

2.1.1. Extraction of Centella asiatica

First, the plant, after being dried, damaged, and sieved, was soaked in 95% ethanol at a ratio of 1 part plant to 3 parts solvent by weight, a process known as maceration. After three days, the liquid portion was separated from the solid residue and collected. The residue was then subjected to the same extraction process two more times to ensure maximum extraction of the desired compounds. The collected liquid fractions were combined, and the solvent was removed using a Rotavapor (2L Laboratory Rotary Evaporator 110 V), a laboratory device used for gentle and efficient evaporation of solvents, for 2 h at 50°C, resulting in the final concentrated crude extract without any solvent [40].

2.1.2. Extraction of Red Ginseng Roots

We extracted RG roots using the conventional heat reflux method. Initially, the dried RG root was then finely ground using an electric mill and refluxed with 70% ethanol at 80°C for 6 h to extract the plant material. After that, the extract was separated from the residue using a rotary evaporator (2L Laboratory Rotary Evaporator 110 V) under vacuum for 2 h to remove ethanol. The evaporator was set at 50°C. The compressed extract was then stored in a freeze dryer (Terrace, Spain). Finally, the dried extract was reconstituted using distilled water to prepare a water‐soluble extract and stored in a freezer until needed for further use [41].

2.1.3. Extraction & Preparation of ESM Powder

The fresh eggs were initially washed using deionized (DI) water, followed by puncturing a small hole at the tip of each egg and removing their contents. Subsequently, the interior of the eggs was cleaned three times with DI water. Once the albumin had been extracted from the eggs, the emptied eggshells were soaked in a diluted 0.5 M HCl solution for 24 h to remove their eggshell membranes (ES). The eggshell membranes (ESM) were then extracted and neutralized with 0.1 M NaOH for 1 h. Finally, the membranes were washed with deionized water.

2.1.4. Hydrogels Fabrication

To create a sodium alginate solution, a 1.5% (W/V) concentration of sodium alginate was dissolved in deionized water and mixed thoroughly using a magnetic stirrer for 4 h. A mixture of 10% (W/V) ESM powder with separate portions of the herbal extracts of Centella asiatica and RG roots was then added to the alginate solution. Table 1 displays the categorization of the resulting samples into seven groups. These groups comprise a basic hydrogel and six variations of hydrogels, each containing distinct additional substances such as Centella asiatica and RG roots. The optimum concentration of Centella asiatica and RG roots was selected for further analysis. To initiate gelation, 75 mM calcium chloride (CaCl₂) was added to the solution as a source of calcium to crosslink the alginate. After 1 h, the gelation step was performed [42]. In order to preserve the porosity structure of the hydrogel, the samples underwent a two‐step process. First, they were frozen at a temperature of ‐80°C for a duration of 24 h. Subsequently, a Telstar freeze dryer from Terrassa, Spain, was used to completely dry the samples for 48 h at a temperature of ‐54°C.

TABLE 1.

Variable hydrogel groups with a blend of polymeric and natural substance.

Sample	Groups
Alg	Alginate
AE	Alginate & Eggshell membrane
AC	Alginate& Centella asiatica
AR	Alginate & Red ginseng roots
AER	Alginate & Eggshell membrane & Red ginseng roots
AEC	Alginate & Eggshell membrane & Centella asiatica
AECR	Alginate & Eggshell membrane & Centella asiatica & Red ginseng roots

2.2. Scaffolds Characterization

2.2.1. Morphological Properties

The microstructure, surface morphology, and porous structure of the hydrogels were examined using a scanning electron microscope (SEM, VEGA II‐ TESCAN) with an accelerating voltage of 20 kV. Prior to imaging, the hydrogel samples were freeze‐dried and then cut into 7 mm diameter discs. To enhance the quality of the images, the samples were sputter‐coated with gold for 280 s using a sputter coater (Sigma 300‐ HV, Zeiss, Germany). To determine the average diameter of the pores, 20 random points per image were analyzed using Digimizer v5.4.9 and Image J 1.52 v software. The results were statistically analyzed to calculate the average pore diameter. The distribution of elements in scaffold was analyzed using energy dispersive X‐ray(EDX) to assess its elemental distribution [43].

2.2.2. Functional Group Identification

Functional groups of eggshell membrane, centella asiatica, RG, and hydrogels were identified using a Fourier Transforms Infrared Spectroscopy (FTIR) spectrophotometer. The study was conducted in 400–4000 cm⁻¹ using a Bruker Tensor 27‐Equinox 55 instrument from Germany [44].

2.2.3. The Swelling Ratio of Hydrogel

To evaluate the water absorption capacity of the hydrogel, the swelling index was employed. Initially, hydrogel specimens were prepared, and their dry weight was calculated using a digital scale. Next, the specimens were immersed in a phosphate buffer solution (PBS). Subsequently, at varying time intervals, the samples were taken out from the solution, and any excess liquid was eliminated using water‐absorbent paper. After that, their weight was promptly measured. Ultimately, the swelling index was computed using the equation 1:

$$SW\%=\frac{\left(W1-W0\right)}{W0}\times 100$$ (1)

Here, SW denotes the percentage of water absorption by the hydrogel, W₀ represents the weight of the samples in the dry state, and W₁ signifies their weight after being placed in PBS.

2.2.4. In Vitro Degradation Analysis

The mass loss of the hydrogel was utilized to assess its degradation rate. To achieve this objective, individual dried hydrogel disks were weighed, and samples of the same size were submerged in a Falcon tube filled with PBS at a temperature of 37°C. The measurement of weight loss was taken at specific time intervals, namely days 1, 3, 7, and 14. At varying time intervals, three replicate specimens from each group were extracted from the solution and dried. The degree of degradation was determined by calculating the mass of the samples using the equation 2 [45]:

$$\mathrm{Weight}\mathrm{loss}\%=\frac{\left(\mathrm{W}1-\mathrm{W}0\right)}{\mathrm{W}0}\times 100$$ (2)

Here, W₀ denotes the initial dry weight of the hydrogels, and W₁ denotes the dry weight after removal from the water.

2.2.5. In Vitro Hemocompatibility Assays

Hemolysis measurement is indicative of the hemocompatibility of the hydrogel. Samples of the hydrogel with uniform weights were initially chosen and sterilized. For this experiment, 2 mL of freshly collected anticoagulated human blood was diluted with 2.5 mL of normal saline. Subsequently, 0.2 mL of the blood‐dilution solution was added to the hydrogel vials.

The samples were kept at a temperature of 37°C for 1 h before being centrifuged at a rate of 1500 rpm for 10 min. The surface liquid solution was separated, furthermore, the optical densities were calculated at 545 nm using a microplate reader. Then the average of the three readings was calculated. Distilled water was utilized as a positive control, while normal saline 0.9% was employed as a negative control (NC). The degree of hemolysis was calculated by equation 3:

$$\mathrm{Hemolysis}\left(\%\right)=\frac{\mathrm{Ds}-\mathrm{Dnc}}{\mathrm{Dpc}-\mathrm{Dnc}}\times 100$$ (3)

where Dnc represents the NC absorbance, Ds represents the sample's absorbance the absorbance of the positive control (Dpc).

2.2.6. Blood Coagulation Index (BCI)

To conduct the experiment, samples were placed into a beaker inside a thermostatic water bath. Subsequently, 100 µl of anticoagulated human blood was added to them. All the specimens were then incubated at a temperature of 37°C for a duration of 5 min. Furthermore, 20 µL of a 0.2 mol/L CaCl₂ solution was added to the samples. After a duration of 5 min had elapsed, 25 mL of distilled water was added. The sample was thoroughly mixed at 37°C, and subsequently, the absorbance of the solutions was calculated at 545 nm. The control group did not include any samples, and the average of three specimens from every group was measured concurrently.

$$\mathrm{BCI}=\frac{\mathrm{A}\mathrm{sample}}{Acontrol}\times 100\%$$ (4)

Each experimental sample has an absorbance value, denoted by A sample, and in the absence of the sample, the control group's absorbance is denoted by A control.

2.2.7. Cell Viability Study

To assess the physiological compatibility of the hydrogel, the MTT analysis was employed. This test is based on a colorimetric method that involves the conversion of yellow tetrazolium by the succinate dehydrogenase enzyme to form insoluble purple formazan crystals [46].

In brief, the 3T3 murine fibroblast cell line was cultured at a density of 1 × 10⁴ cells on 150 µl hydrogels, which were incubated with DMEM containing 10% FBS as well as 1% (v/v) penicillin‐streptomycin (pen‐strep) solution. Following 24 and 72 h of incubation, an MTT analysis was conducted for every group. To begin the process, 100 µL of MTT solution (0.5 mg/mL) was added to the adherent cells in a 96‐well microplate. The cells were then incubated for 4 h in a humidified incubator at a temperature of 37°C with 5% CO₂. Subsequently, the MTT solution was eliminated from the wells, and 100 µL dimethyl sulfoxide (DMSO) was added to dissolve the precipitated formazan crystals formed from the reaction. Next after blending for 10 min, the optical density (OD) was instantly calculated at a wavelength of 570 nm with a reference of 680 nm. In the later stages the outcomes were analyzed separately for the 24‐h and 72‐h groups and compared with the control sample. The wells in a tissue culture plate without cells were labeled as “blank,” while the wells with cells without hydrogel extract were labeled as “control.” The proportion of viable cells in each sample was calculated using the following formula (Equation 5):

$$\mathrm{Cell}\mathrm{Viability}\%=\frac{\mathrm{Sample}\mathrm{Absorbance}\mathrm{Value}}{\mathrm{Control}\mathrm{Absorbance}}\times 100$$ (5)

2.2.8. In Vitro Wound‐healing Test

To assess the migration of 3T3 cells, a wound‐healing test was conducted by creating a scratch on the confluent culture, following a method described by Liang CC et al. [47]. The 3T3 cells were seeded into a 12‐well plate at a concentration of 5 × 10³ cells/cm² in fibroblast media, with medium changes every 2 days. The culture was prolonged until the cells reached about 80% confluency. Following the medium was eliminated, moreover a scratch was created utilizing a 1000 µL micropipette tip. The cells were then washed with PBS to take away any cell debris resulting from the scratching. Afterward the cultures were treated with hydrogel extracts containing additional substances, while cells without any supplements were used as the control. Next images of the damaged region were detained on day 0 (the day of scratching) and day 2 utilizing an inverted microscope. To determine the average migration rate of the 3T3 cells, an image analyzer was utilized. This involved estimating the distance traveled by individual cells or the gap‐filling percentage.

2.2.9. Antibacterial Properties of Hydrogels

The antibacterial aspects of the scaffolds in conflict with Staphylococcus aureus (gram‐positive) as well as Pseudomonas aeruginosa (gram‐negative) were assessed using the disk diffusion method (Kirby‐Bauer) [48]. In brief, the bacteria were mixed with distilled water, and the concentration was adjusted to 1.5 × 10^{^8} CFU/ml, which is equivalent to a turbidity of 0.5 McFarland standard. (Pseudomonas aeruginosa: ATCC 27853 and Staphylococcus: ATCC 33591). As a result, the bacterial suspension was inoculated onto Müller‐Hinton agar medium (Merck Millipore, Germany) using a swab. The scaffolds were fabricated into disc‐shaped samples with a diameter of 6 mm and subsequently positioned on Petri dishes. Subsequently, the samples were incubated at a temperature of 37°C for a duration of 24 h. After this period, the inhibition of bacterial growth was studied. Triplicate experiments were conducted to assess bacterial growth.

2.2.10. In Vitro Release Study

The release of Centella Asiatica and RG from the AE hydrogel was analyzed using a specific methodology. To determine the quantity of drug released from the hydrogel, a standard curve for Centella Asiatica and RG was constructed, utilizing 20 concentration values ranging from 0.001 to 10 mg/mL in simulated body fluid (SBF). Subsequently, 1 mL of AEC and AER hydrogels was immersed in 5 mL of SBF within a shaker incubator set at room temperature, operating at a rotational speed of 45 rpm. The release of Centella Asiatica and RG was assessed by measuring the absorbance of the supernatants at 299 and 284 nm using UV‐visible spectroscopy at various time intervals (2, 4, 6, 24, 48, and 72 h) [49, 50]. Finally, the spectroscopic data were converted into quantitative values through analysis of the standard curve [51].

2.3. In Vivo Animal Experiment

The animal studies conducted in this project regarding full‐thickness wound recovery utilizing the above‐mentioned scaffolds were permitted by the Ethical Committee of Shahroud University of Medical Sciences (Ethics board approval number: IR.SHMU.REC.1400.089). For the study involving the hydrogels mentioned above, a total of 48 male Wistar rats weighing approximately 250 gr each were used. The rats were housed in a controlled environment with a temperature range of 22 ± 2°C, relative humidity maintained at 50 ± 10%, and a consistent 12‐h photoperiod from 06:00 h to 18:00 h. They were maintained in a pathogen‐free atmosphere. The prepared hydrogels were evaluated for their wound healing ability in vivo, in comparison to bare hydrogels. The study involved the random allocation of six‐week‐old Wistar rats into eight distinct groups for conducting the experiments. Subsequently, the rats were administered an intraperitoneal injection of ketamine hydrochloride (90 mg/kg) and xylazine hydrochloride (10 mg/kg) to induce anesthesia, and then the dorsolateral area was shaved using an electric razor [52]. A full‐thickness wound with dimensions of 1.50×1.50 cm² was then excised on the dorsolateral region of each animal using a scalpel. The rats were divided into 8 groups, with wounds being treated with the hydrogel as described above and sterile gauze as the NC. Every group consisted of 6 rats, in order for investigations at every time points (i.e., 7 and 14 days) could be performed in triplicate. Next, the progress of wound healing was noted by measuring the reduction in wound size using a digital camera at 7 and 14 days after remedy. Afterward, the injury site was calculated using an image‐analyzing program. The wound closure was measured using the equation 6:

$$\mathrm{Wound}\mathrm{closure}\left(\%\right)=\left(1-\frac{\mathrm{open}\mathrm{wound}\mathrm{area}}{\mathrm{initial}\mathrm{wound}\mathrm{area}}\right)\times 100$$ (6)

After 7 and 14 days, the Wistar rats were euthanized via injection of ketamine (200 mg/kg) and xylazine (20 mg/kg), next skin tissue samples were gathered. The samples were chosen randomly for RNA extraction, qRT‐PCR, and histopathological examination.

2.3.1. Histological Analysis

To investigate the skin samples of the rats, Verhoeff Van Gieson (VVG) staining and hematoxylin and eosin (H&E) staining were carried out. The collected skin tissues were fixed in 10% neutral buffered formalin (pH. 7.26) for 48 h and Subsequently, the samples underwent processing and were embedded in paraffin. The samples that were embedded in paraffin were cut and prepared into sections, and the samples were stained with H&E and VVG. A neutral evaluator employed light microscopy to examine the histology slides. Distinct groups were assessed regarding their epithelialization, angiogenesis, fibroplasia, and development of granulation tissue [53].

For the purpose of quantitative analysis, three primary parameters were evaluated on day 14 following treatment: the infiltration of polymorphonuclear (PMN) cells and the thickness of granulation tissue.

PMN cell Infiltration was also quantitated by determining neutrophils in five randomly chosen high‐power fields (HPFs, 400× magnification) per section in a light microscope. For each sample, the average number of PMNs per HPF was determined. The technique is semi‐quantitative and is an adaptation from the report of Ferguson et al., where the grading of neutrophils in inflammatory tissues has been described to determine the resolution of inflammation during healing [53].

Thickness of granulation tissue was assessed by ImageJ software (NIH, Bethesda, MD, USA). The measurement was from the wound bed's bottom toward the superficial edge of the granulation tissue at five equally spaced points along the wound field under 100×. Mean value was calculated and contrasted between groups [54].

2.3.2. Histomorphometric Analysis

Histomorphometric analysis was conducted to evaluate the processes of epithelialization and vascularization. In this investigation, the assessment of Re‐Epithelialization on day 14 was carried out using a semi‐quantitative 5‐point scale: 0 indicating no new epithelialization or PMNs, 1 representing a few, 2 denoting a moderate presence, 3 indicating many, and 4 signifying complete (100%) epithelialization. The consistency of the parameters was confirmed by a single independent observer who was blinded to all treatment groups during the evaluation [55].

2.3.3. Gene Expression Analysis

In order to understand the changes in the appearance of skin cells when they are exposed to chemical or biological substances, it is crucial to employ molecular markers. In this particular research, we delved into the examination of the gene expression patterns of VEGF, TGF‐β₁, TIMP‐1, Matrix Metalloproteinase‐9 (MMP‐9), while Glyceraldehyde‐3‐Phosphate Dehydrogenase (GAPDH) was used as a control.

2.3.3.1. RNA Extraction

In this particular research, skin samples were collected from Wistar rats at seventh and 14^th days post‐treatment. TRIzol (Tous, Mashhad, Iran) was employed to extract total RNA from the tissue. The lysed cells were mixed with 0.2 mL of chloroform, and the RNA‐containing supernatant was collected by centrifugation. The RNA was subsequently precipitated with isopropanol and washed with ethanol. The RNA pellet was dissolved in RNase‐free distilled water to prepare an RNA solution, and the yield and purity of the isolated RNA were evaluated utilizing a spectrophotometer. Samples with a purity value between 1.8 and 2.0 were deemed suitable for gene expression assessment. The extracted total RNA was stored at ‐80°C until further use.

2.3.3.2. RT‐PCR

To investigate gene expression in the extracted RNA samples, complementary DNA (cDNA) was synthesized utilizing a kit from Applied Biosystems U.S.A. Using a high‐capacity Parstous cDNA synthesis kit (Tous, Mashhad, Iran), two micrograms of RNA were subjected to reverse transcription after extraction. Subsequently, the synthesized cDNA served as a template for amplification through polymerase chain reaction (PCR). The gene expression data that was acquired underwent analysis using Prism 9 software, as well as the difference in gene expression was determined using the 2^−(ΔΔct) method. A list of all primers employed is presented in Table 2 below.

TABLE 2.

The primer sequences employed for QRT‐PCR.

Gene	Forward primer	Reverse primer
GAPDH	AGTGCCAGCCTCGTCTCATA	TGAACTTGCCGTGGGTAGAG
MMP9	GCCCCTACAGAGTCTTCGAC	ACTTCCAATACCGACCGTCC
TIMP1	TAAAGCCTGTAGCTGTGCCC	AGCGTCGAATCCTTTGAGCA
VEGF	TGCGGATCAAACCTCACCAA	TCTGGCTTTGTTCTATCTTTCTTTG
TGF‐β1	CGTCAGACATTCGGGAAGCA	GTATCAGTGGGGGTCAGCAG

2.4. Statistical Analysis

Statistical analysis was conducted utilizing GraphPad Prism 9.5.0 software (La Jolla, San Diego County, CA, USA). The results are presented as mean ± standard deviation (SD). To compare several experimental groups at one time point, we used one‐way ANOVA, leaving out the normalized control group since it didn't show much variability. The “ALG” group was our reference point for post‐hoc comparisons. For experiments that looked at two time points and different treatment groups, we applied two‐way ANOVA to assess both time and treatment effects, along with their interaction. We indicated statistical significance with the following markers: *p < .05, **p < .01, ***p < .001, and ****p < .0001; any values above these thresholds were considered not significant (ns).

3. Results

3.1. Scanning Electron Microscopy (SEM) Analysis

The morphology of Alginate (Alg) and Alginate/ Eggshell membrane/ Centella asiatica/ RG roots (AECR) freeze‐dried hydrogels were examined using Scanning Electron Microscopy (SEM). The SEM image (Figures 1A‐D) revealed that the inner structure of the hydrogels consisted of highly porous structures with interconnected pores, which were formed by phase separation during lyophilization. It has been suggested that pore sizes of 20–120 µm are an appropriate range for facilitating wound healing and cell migration [56]. The mean size of pure Alg hydrogel and AECR hydrogel was approximately 108.29 µm and 95.31 µm, respectively, the aperture size of the AECR group is larger than that of the Alg group. This property makes the scaffold appropriate as a wound care material because it supplies sufficient space for migration and cell growth and absorption of fluid from tissues. The porous structure also enables the scaffold to swell significantly. EDX analysis was used for elemental identification (Figure 2). It confirmed the presence of alginate/eggshell membrane/Centella asiatica/RG roots (AERC) by detecting Oxygen, Carbon, Chlorine, Calcium and Potassium as tracers. Based on current knowledge, carbon, hydrogen, and sodium are the main elements that make up aginate [57, 58, 59]. Studies show that potassium has been identified as one of the most abundant mineral cations in ginseng root, so the main ionic element in ginseng root is potassium [60]. Given the lack of direct data on the main ionic element in Centella asiatica, but based on general knowledge of plant physiology and past studies [61, 62], potassium and calcium, as an abundant cation in plants and its vital role in cellular processes, is probably of the main ionic elements in this plant. Other elements such as carbon, oxygen, and calcium may also be present as primary organic elements. Based on the results in Figure 2, it can be seen that the main elements mentioned are also uniformly distributed. Cross‐linking with CaCl₂ has also led to the addition of calcium and chlorine ions to the structure. In addition, the increase in calcium and sodium ions is due to the use of a higher weight/weight amount of alginate polymer compared to plant extracts.

FIGURE 1.

Morphology of the hydrogel Alginate (A: 100X and B: 500X) and hydrogel Alginate/ Eggshell membrane/ Centella asiatica/ Red ginseng roots (C: 100X and D: 500X).

FIGURE 2.

Elemental mapping of and alginate/eggshell membrane/Centella asiatica/red ginseng roots by evalution of Oxygen, Carbon, Chlorine, Calcium and Potassium as tracers.

3.2. Fourier Transforms Infrared Spectroscopy (FTIR) Analysis

3.2.1. FTIR of Extracts

In Figure 3, the FTIR spectra of eggshell membrane, Centella asiatica, and RG are presented. The FTIR spectrum of the eggshell membrane material reveals key functional groups characteristic of its proteinaceous composition. A broad peak at 3397.81 cm^{− 1} corresponds to O–H and N–H stretching vibrations, indicative of hydrogen bonding typical in amide and hydroxyl groups. The amide I and amide II bands appear at 1656.12 cm^{− 1} and 1529.68 cm^{− 1}, respectively, reflecting C = O stretching and N–H bending vibrations, which are hallmarks of protein structures. Additional bands at 1449.07 cm^{− 1} and 1394.67 cm^{− 1} are associated with CH₂ scissoring and symmetric COO⁻ stretching. The peak at 1237.54 cm^{− 1} likely arises from amide III (C–N stretching and N–H bending), while the band near 1080.84 cm^{− 1} can be attributed to C–O stretching, possibly from carbohydrate components. Lower frequency peaks, such as at 660.55 cm^{− 1} may reflect out‐of‐plane bending vibrations [63, 64, 65] (Figure 3A). The FTIR analysis of the Centella Asiatica extract revealed characteristic absorption peaks indicative of key functional groups. Prominent O‐H stretching vibrations were observed at 3394.65 cm^{− 1}, suggesting phenolic or alcoholic compounds. Aliphatic C‐H stretching bands at 2928.95 cm^{− 1} and 2972.24 cm^{− 1} align with typical lipid or hydrocarbon constituents. Peaks in the 1000–1500 cm^{− 1} region (e.g., 1160.52, 1379.32, and 1463.10 cm^{− 1}) correspond to C‐O stretching, CH₂/CH₃ bending, and possibly ester or carbohydrate moieties. The presence of a peak at 4107.35 cm^{− 1} may indicate broad O‐H/N‐H stretching [66, 67] (Figure 3B). Finally, RG extract exhibits characteristic absorption bands indicative of its major functional groups. Broad peaks around 3300 cm^{− 1} suggest O‐H stretching vibrations from phenolic compounds or polysaccharides. Peaks near 2925 cm^{− 1} and 2850 cm^{− 1} correspond to aliphatic C‐H stretching in hydrocarbon chains. A distinct absorption around 1650 cm^{− 1} may arise from conjugated C = O or aromatic C = C stretching, typical of saponins or flavonoids. Additionally, bands in the 1050–1150 cm^{− 1} region likely reflect C‐O‐C and C‐O‐H vibrations from glycosidic linkages and carbohydrates [68, 69, 70] (Figure 3C).

FIGURE 3.

FTIR spectra of Eggshell membrane (A), Centella asiatica (B), and Red ginseng roots (C).

3.2.2. FTIR of Hydrogels

In Figures 4A‐B, the FTIR spectra of hydrogel alginate (Alg) and hydrogel alginate/ eggshell membrane/ centella asiatica/ RG roots (AECR) are presented. Peaks characteristic of the amide I region (1700‐1600 cm⁻¹) were identified at 1603 cm⁻¹ (Alg) and 1625 cm⁻¹ (AECR). These peaks can be attributed to the stretching vibrations of C = O bonds within peptide linkages. The peaks observed in the amide II region, specifically between 1540 and 1520 cm⁻¹, can be attributed to the vibrations of C‐H stretching and N‐H bending [52]. The peaks within the range of 1220–1300 cm⁻¹ in the amide III region are indicative of the vibrations related to C‐N stretching and C = O bending. The peaks observed between 1635‐1615 cm⁻¹ and 1535‐1520 cm⁻¹ can be attributed to the presence of the β‐sheet structure. The presence of C‐S and S‐S bonds was indicated by the spectrum peaks observed at 992 cm⁻¹ and 580 cm⁻¹, respectively. Additionally, bands within the range 950–1200 cm⁻¹, which are characteristic of polysaccharide polymers such as alginate, can be attributed to the stretching properties of C−O and C−O−C bonds. The peaks observed between 1420−1500 cm⁻¹ correspond to the amide II region. Specifically, the peak at 1454 cm⁻¹ indicates the symmetric stretching of −COO− in alginate [71].

FIGURE 4.

FTIR spectra of hydrogel Alginate (A) and hydrogel Alginate/ Eggshell membrane/ Centella asiatica/ Red ginseng roots (B).

3.3. Swelling Ratio Analysis

To evaluate the potential of the hydrogels as wound dressings, we studied their swelling behavior in phosphate‐buffered saline (PBS, pH 7.4) at 37°C. An ideal wound dressing should be able to absorb wound exudates and create a moist environment to promote wound healing [72]. As shown in Figure 5, due to their network structure characterized by large pores, all seven hydrogel groups displayed a comparatively significant swelling capacity. The basic hydrogel consisting of AER (Alginate/ Eggshell membrane / RG roots) showed higher water uptake rates than the other groups (****p < .0001). The AC (Alginate/ Centella asiatica) hydrogels had a lower swelling rate compared to the basic hydrogel (*p > .05). Overall, the hydrophilic nature of the scaffolds indicates their potential application in tissue engineering, as the scaffold's ability to absorb body fluid, mainly composed of water, is crucial for facilitation of nutrient and metabolite diffusion.

FIGURE 5.

Swelling ratio among seven groups of the prepared scaffolds. Values represent the mean ± SD, n = 3, *p < .05, **p < .01, and ****p < .0001. SD: standard deviation.

3.4. In Vitro Degradation Analysis

It is crucial to match the degradation rate of a therapeutic structure with the regeneration rate of wounded tissue. In this study, the degradation rate of the prepared hydrogels was found to be consistent with the wound healing period, with approximately 80% of the hydrogel degrading within 14 days. It is hypothesized that the degradation occurs as a result of ion exchange processes between the divalent chelating ions of ionotropically crosslinked alginate and the Na+ ions found within the saline solution [73]. The hydrogel degradation rate was measured at 1, 3, 7, and 14‐day intervals, and the mean values were calculated and plotted in Figure 6. The AE (Alginate/ Eggshell membrane) group showed the highest degradation rate among the groups, while the AR (Alginate/ RG roots) group had the lowest. As a consequence of this phenomenon, the polymeric chains dissolve, the gel disintegrates, and weight loss occurs due to the partial solubilization of alginate. These outcomes are influenced by the properties of the physical network and the degree of ion exchange [73]. Therefore, the slower degradation rate of the scaffolds may be advantageous, as it provides sufficient time for the formation of neotissue and extracellular matrix during tissue repair.

FIGURE 6.

The weight loss outcomes of the hydrogel groups measured in PBS solution (pH: 7.4). During 14 days. Values represent the mean ± SD, n = 3.

3.5. In‐vitro Hemolytic Activity of Hydrogel

The BHP (blood hemolysis percentage) is a key indicator of red blood cell (RBC) hemolysis caused by hydrogel extracts [74]. During the initial phase of inflammation, the interaction between the hydrogel and erythrocytes becomes crucial as wound dressings inevitably encounter blood. Assessing blood compatibility requires considering the crucial factor of the hemolysis rate of erythrocytes when they come into direct contact with hydrogel and drugs [75]. Therefore, we conducted a hemolysis test on the prepared hydrogels before their application to wounds. The hemolysis ratio was assessed by measuring the absorbance of the supernatant and comparing it with positive and NCs. Previous studies have suggested that hemolysis rates below 5% are suitable for biopolymers [74]. As revealed in Figure 7, the hemolysis percentage in all groups remained below 5%. Among the groups, the highest observed hemolysis rate was in AC and AR, while the lowest rate was observed in AECR (*p > .05). These results indicate that the prepared hydrogels are compatible with blood, making them suitable for use in regenerative medicine.

FIGURE 7.

Percentage of the in vitro hemolytic activity in different groups of hydrogels. Values represent the mean ± SD, n = 3, and ****p < .0001. SD: standard deviation.

3.6. Blood Coagulation Index (BCI)

The Blood Coagulation Index (BCI) is a vital indicator of the coagulation effect of dressings, with lower values indicating better coagulation ability [76]. Throughout this research, the blood clotting capability of the prepared hydrogels was evaluated using the BCI, which is negatively correlated with hemostasis capacity in vitro [77]. The AER (Alginate/ Eggshell membrane/ RG roots) group had a lighter solution color and lower BCI than the control group (****p < .0001), indicating that it was more effective in stopping blood loss (Figure 8). This may be due to the hydrogel's ability to promote erythrocyte and platelet aggregation, which quickly fills the wound and forms a barrier to prevent tissue fluid and cell leakage [77]. Furthermore, the structures inside the hydrogels could absorb percolate and activate platelets to enhance hemostasis [78]. However, further investigation is needed to determine its impact on skin lipids and the restoration of the skin barrier [79].

FIGURE 8.

Percentage of the in vitro blood coagulation index in different groups of hydrogels. Values represent the mean ± SD, n = 3, *p < .05, **p < .01, and ****p < .0001. SD: standard deviation.

3.7. Cell Viability Findings

The cytocompatibility of RG roots and Centella asiatica extracts was found to depend on both time and dosage. To ascertain the ideal concentration for utilization in the hydrogel groups, various concentrations of RG roots (1, 0.5, 0.1, 0.01, and 0.001 mg/mL) in Alg hydrogel and Centella asiatica (1, 0.5, and 0.1 mg) in Alg were tested on 3T3 cells, and cell survival was evaluated using MTT experiments, as shown in Figures 9A‐B. The optimal concentrations of RG root and Centella asiatica were found to be 0.01 mg (*p < .05) and 0.1 mg (**p < .01), respectively. The biocompatibility of the extract obtained from the different groups of hydrogels on 3T3 cell lines was assessed using an indirect MTT assay at 24 and 72 h post‐cell seeding, using cells seeded on a scaffold‐free tissue culture plate as the control group. As depicted in Figure 10, the AECR composite scaffold exhibited an increase in cell viability and proliferation over time, with absorbance values higher than those of the Alg hydrogel group. Among the groups tested, AECR hydrogel was found to be the most biocompatible (**p < .01). Interestingly, after a three‐day seeding period, the cells effectively adjusted to the environment, resulting in increased cell viability compared to the first day. No cytotoxicity was observed in any of the groups.

FIGURE 9.

Viability of 3T3 cells on various concentrations of Red ginseng roots (A) and various concentrations of Centella Asiatica (B), Values represent the mean ± SD, n = 3, ns > .05, *p < .05, and **p < .01. SD: standard deviation.

FIGURE 10.

Viability of 3T3 cells on prepared scaffolds, Values represent the mean ± SD, ns > .05, *p < .05, and **p < .01. SD: standard deviation.

3.8. In Vitro Scratch Assay

The scratch assay is a commonly used in vitro technique for studying cell migration [80].  This method is particularly useful for investigating the regulation of cell migration by cell interaction with the extracellular matrix (ECM) and cell‐cell interactions [81]. An experiment was conducted to evaluate the effectiveness of hydrogels in facilitating the migration of 3T3 fibroblasts. The sample images of the migration of 3T3 cells on days 0 and 2 following wounding are shown in Figure 11a‐h for control cultures and cultures supplemented with prepared scaffolds compared to the control cultures, the culture treated with AC composite showed a significantly higher migration rate of 3T3 cells, and the wound area recovered substantially faster than in the other groups within two days. However, in Alg, the rate of migration of 3T3 cells decreased significantly and was similar to that of the control culture (Figure 12).

FIGURE 11.

Representative pictures of 3T3 cells grown in control and test conditions healing wounds in vitro (supplemented with prepared scaffolds). Control (a), Alg (b), AE(c), AR(d), AC(e), AER(f), AEC(g), AECR(h).

FIGURE 12.

Migration rate of 3T3 cells cultured supplemented with the prepared scaffolds in test conditions and a control group. Image J software calculated the migration rate by measuring the distance traveled by cells. Values represent the mean ± SD, **p < .01, **p < .01, and ***p < 0.001. SD, standard deviation.

3.9. Antibacterial Assay Analysis

When wounds are exposed to the external environment, they become vulnerable to bacterial infections, which can lead to serious complications and even become life‐threatening [82]. Therefore, preventing bacterial infections is crucial for successful wound healing. The examination of the antibacterial activity of the hydrogel groups revealed that all groups exhibited a specific inhibitory effect against Staphylococcus aureus, a gram‐positive bacteria, as shown in Figure 13A. Furthermore, the degree of bacterial inhibition of the hydrogel groups against Pseudomonas aeruginosa, a gram‐negative bacteria, was investigated, as depicted in Figure 13B. The findings demonstrated that the hydrogel groups exhibited a reduced number of bacterial colonies in comparison to the group without a wound dressing. These findings imply that the lag growth phase of the two bacteria investigated in the prepared scaffolds was notably prolonged compared to that of the control group.

FIGURE 13.

Antibacterial assay (time‐kill curve) of hydrogel groups and control group against Staphylococcus aureus (A) Pseudomonas aeruginosa (B) Data are expressed as CFU/ml recovered on blood agar and Mueller Hinton agar at each specific time interval. The values represent the mean standard deviation (n = 3).

3.10. Release of Centella Asiatica and Red Ginseng

The cumulative release profiles of Centella asiatica are shown in Figure 14A and RG in Figure 14B. The release of Centella Asiatica from AE hydrogel reached a plateau after 24 h and Ginseng after 48 h. It reached 84.15±11.61 µg and 9.22±2.87 µg after 24 and 48 h, respectively. The results indicated a slow and continuous release of both herbs. Therefore, according to the results of this experiment, the dressing change time for the in vivo study was determined to be every 48 h.

FIGURE 14.

The Centella Asiatica (A) and Red Ginseng (B) release from AE hydrogels measured in PBS solution. Values represent the mean ± SD, n = 3.

3.11. In Vivo Wound Healing Study

In this study, the effectiveness of the prepared hydrogels in promoting wound healing was evaluated through the utilization of a full‐thickness excisional wound model and the macroscopic observation of wound closure, as shown in Figure 15A. The NC group, which had a wound covered with sterile gauze, exhibited signs of infection and inflammation, and wound healing was incomplete after two weeks. Moreover, after two weeks, the wound site in the control group was still hemorrhagic, while the groups treated with the hydrogels showed improvement during the same period. The photographic evaluation revealed that one week after surgery, the Alg group exhibited a significant presence of exudate along with minimal bleeding. In general, the AECR group showed the best performance, with no signs of infection or inflammation, and the wound healed well. In order to quantify the progression of wound healing, the extent of wound closure was measured, as depicted in Figure 15B.

FIGURE 15.

In vivo wound‐healing results: a macroscopic appearance of the wounds treated with the groups of hydrogels, 7 and 14 post‐wounding (A) and histogram comparing the percentages of wound closure among the experimental groups after 7 and 14 days following the initial wound. (B). Values represent the mean ± SD, **p < .01, and ***p < 0.001. SD, standard deviation.

3.12. Histopathological Study

In this study, histological analysis of skin wounds was performed using H&E and VVG staining, as shown in Figure 15 and Figure 16. The NC group consisted of untreated wounds, which showed infiltration of polymorphonuclear inflammatory cells (PMNs) and granulation tissue formation 14 days after surgery. However, the wounds were not fully healed, and the epidermal layer was not formed, leaving the wound covered by a crusty scab. The results of H&E staining on the seventh day (Figure 16) showed that collagen deposition, re‐epithelialization, and dermal thickness were higher in the AECR group than in all other groups. In contrast, these parameters were lower in the NC group. VVG staining (Figure 17) showed that the formation of elastin fibers was higher in the AR group than in the other treated groups. The mature collagen formation was higher in the AECR group than in the other treated groups. On the 14th day, H&E staining revealed that wound regeneration was better in the AECR group than in the Alg and NC groups. Therefore, the epidermal layer was completely formed, and blood vessel formation was significantly higher in the Alg group than in the NC group. The AR‐treated animals showed the most similarity to intact skin tissue (positive control), with the rejuvenation of hair follicles, sebaceous glands, as well as typical epidermis. The rate of collagen fiber synthesis, deposition, and maturation were highest in the AECR group. In addition, VVG staining on the 14th day showed that the AECR group had the greatest elastin fiber synthesis, maturation, and arrangement, as well as a significant increase in fibroblast and fibrocyte cell density and higher collagen fiber density compared to other groups. These findings indicated a distinct dissimilarity in comparison to the NC group. Finally, an increase in cellular population at the site of the wound in the treated groups resulted in a higher level of angiogenesis during the final days of the wound healing period compared to the NC group.

FIGURE 16.

Histology (hematoxylin‐eosin (H&E) staining) of skin wounds in rats in various hydrogel treatments with the comparison of the positive control group on the seventh and 14th day of wound healing. (Magnification: 40X, 100X, and 400X). Black thin arrow: elastin fibers, red thin arrow: blood vessels, Arrowhead: sebaceous glands, Thick arrow: hair follicles, Stars: epidermal layer and yellow circle: granulation tissue.

FIGURE 17.

Histology (Verhoeff Van Gieson (VVG) staining) of skin wounds in rats in various hydrogel treatments with the comparison of the positive control group on the seventh and 14th day of wound healing. (Magnification: 40X, 100X, and 400X). Black thin arrow: elastin fibers.

Quantitative measurement of histological parameters indicated a stark difference in the infiltration of inflammatory cells and formation of granulation tissue among the treatment groups (Table 3). The NC group exhibited the highest degree of PMN infiltration, indicative of chronic inflammation. Conversely, all treated groups had significantly lower PMN counts. Among these, the PMN infiltration was lowest in the AERC group and indicated a greater degree of progress from the inflammatory phase to the proliferative phase. All the other combinations, like AEC, AR, and AER, were positive for anti‐inflammatory effects as well as compared to AE, AC, and ALG, which had relatively higher percentages of PMNs. Granulation tissue formation, a critical part of dermal regeneration, was quite different between the groups. AERC had the highest tissue thickness (243 ± 18 µm), followed by AER and AEC. Both AR and AE also played a meaningful role in granulation. AC and ALG showed middle‐level improvements, while NC showed low levels of granulation tissue (96 ± 14 µm) with zero regenerative activity.

TABLE 3.

Quantitative histological assessment of wound healing parameters on day 14 post‐treatment (mean ± SD).

Groups	PMNs (cells/HPF)	Granulation Tissue Thickness (µm)
Alg	9.7±1.5	188±17
AR	6.1±1.3	205±22
AE	7.4±1.2	198±19
AC	8.1±1.6	176±20
AER	6.8±1.0	215±18
AEC	6.5±1.1	222±15
AECR	5.2±1.0	243±18
Negative control	19.4±2.3	95±14

3.13. Histomorphometric

The histomorphometric evaluation of the experimental groups is shown in table 4. Based on the results in the table, AECR is the most effective treatment, demonstrating the importance of the combination of components eggshell membrane, centella asiatica, and RG in alginate hydrogel for improving wound healing. While the NC group and alginate hydrogel alone recorded the lowest regenerative potential for epithelial layer formation.

TABLE 4.

Re‐epithelialization score of all treated groups after 14 days.

Groups	Re‐Epithelialization (0–4)
Alg	2
AR	3
AE	3
AC	2
AER	3
AEC	3
AECR	4
Negative control	2

3.14. Gene Expression Studies

Real‐time PCR was utilized to investigate the expression of TIMP‐1, MMP‐9, TGF‐β₁, and VEGF genes along with the housekeeping gene GAPDH on the seventh and 14th days (Figure 18A‐D). The expression of TGF‐β₁ genes considerably amplified in the AECR group compared to the other groups on both the seventh and 14th days after skin excision (***p < 0.001). Angiogenesis plays a critical role in facilitating healing of wounds by supplying oxygen and nutrients to the affected area. It is triggered by the migration of nutrients to endothelial cells and capillaries [83, 84]. The expression of VEGF was found to be significantly enhanced in the AECR groups compared to the control groups on both the seventh and 14th postoperative days (***p < 0.001), indicating a crucial role of VEGF in promoting angiogenesis. On the other hand, MMPs are endopeptidases that require zinc and can break down all types of extracellular matrix (ECM) proteins. While TGF‐β₁ and VEGF are critical in the early stages of wound healing, MMPs become more substantial in the later stages. So there was no significant difference in the expression of MMP‐9 and TIMP‐1 genes on the seventh day after skin wounding among the groups. However, on the 14th day, the expression of TIMP‐1 and MMP‐9 genes noticeably higher in the AECR group compared to the control group (***p < 0.001).

FIGURE 18.

Gene expressions of VEGF, MMP‐9, TGF‐β₁ and TIMP‐1 were evaluated by real‐time PCR. (A) TGF‐β1, (B) VEGF, (C) TIMP‐1and (D) MMP‐9 expression in SD rats at seventh day and 14th‐day post‐treatment of wound tissue with various hydrogels and the control group. Data are presented as mean ± SD. Statistically different from the control is marked. *p < 0.05, **p˂0.01, and ***p < 0.001.

4. Discussion

The successful healing of wounds is dependent on the complex interplay between various components of the extracellular matrix, different types of cells, and their soluble mediators. Ingredients that can stimulate this process are highly sought‐after for use in wound‐healing products [85]. There has been a rising interest in the development of wound dressings that can effectively aid in the process of wound healing in recent years. Hydrogel‐based biomaterials have emerged as one of the most effective wound dressings, exhibiting promising results in wound healing [86, 87].

The purpose of this investigation was to create a biocompatible hydrogel wound dressing using natural‐based biomaterials that can significantly contribute to the wound healing process. Hydrogels possess several advantages, with their high water absorption capacity being the most significant [88, 89]. Due to their favorable characteristics, alginate‐based hydrogels are extensively utilized as wound dressings among the various types of hydrogels [90]. Hydrogel dressings have advantages over nanofibers due to their limited hydration capacity and mechanical fragility. They also have advantages over foams and films, as foams have poor adaptability to deep wounds and the risk of excessive drying. Films also have limited absorption of exudate and adhesion‐related trauma [91, 92, 93]. In this study, a basic hydrogel was created by combining two natural polymeric biomaterials, namely alginate and eggshell membrane. One of the key highlights of this survey is the attainment of the optimal concentration of RG roots and Centella asiatica within the hydrogel structure while still retaining the unique structural properties of the hydrogel, as verified through SEM imaging. Also, the SEM images acquired in this research offer a precise depiction of the cross‐linking process between the polymeric chains and side chains, leading to the creation of a porous structure. The creation of a favorable environment for cell growth during the wound healing process, including cell migration, cell proliferation, and re‐epithelialization at the wound region, is greatly influenced by the size of the pores. Hydrogels with a porous structure provide an optimal environment for molecular processes like proliferation, migration, and adhesion [94]. In the present investigation, SEM micrographs were utilized to assess the porous nature of the structure. Based on current knowledge, pore sizes of 20–120 µm are an appropriate range to facilitate wound healing and migration of skin fibroblast cells [37, 56, 95]. The hydrogels produced were determined to be within the 28–138 µm range, indicating that they can promote and support cellular processes. Given the differences in molecular weight of the prepared extracts, one would expect differences in density that could affect the homogeneity of the scaffold. However, with rapid dispersion over a long period of time and rapid transfer to a ‐20°C and then ‐80°C freezer for the freeze‐drying process, one would expect that the structural integrity would be maintained. As SEM images of the cross‐sections of the scaffolds show a regular structure and uniform pores. Thus, utilizing low‐cost methods to create a bioactive dressing derived from waste materials could offer a promising alternative to overcome the limitations of expensive present interventions. The eggshell membrane (ESM) obtained from eggshell waste contains multiple bioactive components, including collagen, glycoproteins, and keratin [96]. In recent times, ESM has become increasingly popular in the fields of bioengineering, material engineering, and environmental engineering due to its versatile applications. Being a commonly produced waste material, it is readily accessible and a cost‐effective biomaterial [97]. An alternative is chicken ESM, which contains a combination of collagen types I, V, and X, as well as hyaluronic acid (HA), making it a promising alternative ECM for tissue regeneration [98]. Besides its crucial impact on cell attachment and proliferation, additionally, HA plays a crucial function in the synthesis of MMPs, which aid in tissue regeneration and repair [99]. The biomimetic properties of ESM have the capacity to progress cell adhesion and ECM synthesis, making it a promising material for the healing of wounds and the regeneration of skin. Hence, numerous research investigations have been conducted to investigate its effectiveness in these applications [96]. Maintaining the safety and effectiveness of skin health products is of utmost importance, and quality control measures are essential in achieving this goal [100]. Microbial contamination in these products can generate endotoxins and metabolites, potentially resulting in skin irritation and allergic reactions [101]. The ESM within the egg serves as a protective barrier against both physical and chemical pathogen invasion, thereby safeguarding the developing embryo. Additionally, the ESM in the egg contains various antimicrobial proteins, such as ovotransferrin, ovocalyxin‐36, histones, avian β‐defensins, and lysozyme; all of these proteins have been found in the proteome of ESM [102]. Nevertheless, certain bacteria, including Salmonella enteritidis, are capable of surviving and proliferating on eggshells. A study conducted by Salehi et al. found that the use of hydrochloric acid neutralized with 0.1 molar sodium hydroxide proved to be more effective for the extraction and isolation of eggshells compared to other methods, as it exhibited greater compatibility with cellular structures and blood components. Furthermore, microscopic examinations revealed no signs of bacterial growth, likely attributable to the treatment and washing process with sodium hydroxide, even though the Salmonella genus is known to exhibit some resistance to hydrochloric acid [65].

Centella asiatica (CA) is commonly used in traditional medicine because of its antibacterial and antifungal properties, which reduce the risk of contamination. An example of CA's antibacterial properties is demonstrated in a study indicating that CA extracted oil has the ability to combat both gram‐positive and gram‐negative bacteria [103]. Studies conducted previously have shown that natural compounds like RG roots possess wound‐healing potential, as well as anti‐inflammatory and antibacterial properties [104]. The findings indicated that the combination of RG roots, centella asiatica, and eggshell membrane produced the highest level of antibacterial activity. Given the potential to inhibit the growth of bacterial microorganisms in these wound dressings, the results of this study can be further validated by designing a separate in vivo study focusing on investigating the antibacterial properties of infected wounds and comparing them with a conventional drug in the treatment of these wounds.

It is essential to take into account the structural stability and swelling behavior of hydrogels when utilizing them for tissue engineering purposes. According to a previous study, primary swelling can be beneficial as it can increase the pore size of hydrogels, leading to improved growth and cell attachment within a 3D configuration [105]. The study demonstrated that both AER hydrogel and AECR hydrogel possess the ability to absorb extracellular fluid, and their porous structure allows for cell migration and proliferation. Alginate's ability to absorb extracellular fluid may be attributed to the interaction between its hydrophilic medium and the carboxylic acid functional groups [106].

In clinical settings, dressings are generally deemed safe, with a hemolysis rate of less than 5% [107]. The current study found that the Alg and AECR hydrogel groups exhibited lower hemolysis rates compared to the positive control group. The reduced hemolysis rates can be attributed to the polymer chains present in the hydrogels, which provided coverage and helped to decrease the antigenic effect on the membranes of red blood cells [107]. The coagulation activity of dressings was evaluated using the BCI test, and the drug‐loaded hydrogel exhibited superior coagulation properties, platelet adhesion, fluid absorption capacity, and fluid balance on the wound bed compared to gauze. According to research, the coagulation effect of a dressing is more effective when the BCI value is lower [108]. Some studies suggest that ginsenosides may prevent platelet aggregation and act as a natural blood thinner. CA is also effective in improving venous insufficiency and reducing inflammation and may indirectly affect hemostasis by increasing blood flow. However, the eggshell membrane helps platelets adhere and aggregate at the site of injury by providing a suitable surface. This process plays a key role in the initial hemostasis stage (platelet plaque formation). Studies have shown that by absorbing fluids and creating local pressure, it helps reduce bleeding and accelerate clot formation [103, 109, 110, 111]. Therefore, eggshell plays the most effective role in reducing BCI values ​​by improving coagulation potential. The study found that both AER and AECR hydrogels demonstrated an effective coagulation effect based on their BCI values.

In this study, the biocompatibility of the hydrogel was confirmed through the assessment of the MTT analysis and the ratio of cell viability. Compared to other groups, the AECR composite scaffold demonstrated a gradual enhancement in proliferation and viability over time. By integrating organic compounds and bio‐based polymers into the structure of hydrogels, it is possible to reduce cytotoxicity to a minimum. This is because these materials are generally biocompatible and less likely to induce harmful effects on cells or tissues [112].

To evaluate the impact of the prepared scaffolds on cell migration and proliferation, a scratch assay was conducted. Outcomes of the wound healing evaluations revealed that the prepared scaffolds had a significant impact on the in vitro migration rate of 3T3 cells, indicating their potential benefit in promoting re‐epithelialization during wound healing. The study results revealed that the AC and AECR hydrogel groups demonstrated a higher migration rate than the other groups, resulting in a substantial enhancement in the wound area in vitro. These findings suggest that AC and AECR hydrogels may hold great potential for promoting wound healing and could be a promising treatment option for managing specific types of wounds [113]. The study employed histological analysis using H&E‐and VVG‐stained tissue sections to examine the microchanges occurring at the wound sites. The rats that received treatment with the AR and AECR hydrogel groups exhibited accelerated rates of neovascularization and re‐epithelialization. Throughout the process of wound healing, there was a gradual increase in the deposition of collagen over time. The efficacy of the AR and AECR hydrogel groups in promoting wound healing was validated by their ability to accelerate epithelialization, facilitate cell migration, stimulate angiogenesis and collagen synthesis. The staining analysis further revealed that the cells participating in the wound repair process manifested more rapidly in the AR and AECR hydrogel groups as compared to the control groups. Hence, based on visual observations, it was established that the AR and AECR hydrogel groups exhibited a faster recovery rate. Former investigations have suggested that RG has a favorable effect on human fibroblast synthesis [114]. According to Kim et al. [115], saponin derived from RG increased epidermal cell division by upregulating the expression of Bcl‐2 levels in keratinocytes. Thus, it is advocated that ginseng enhances epidermal cell growth and keratinocyte migration [116].

CA, a traditional medicinal treatment for wounds in Southeast Asia and China for centuries, was evaluated by Fang et al. for its efficacy in treating burn wounds in a mouse model, with positive outcomes observed [117]. In a preclinical study, rats with open wounds were treated with different formulations of aqueous CAE (Centella asiatica extract) for 24 days. The study found that the application of CAE led to intensified collagen synthesis and cellular regeneration at the wound region, indicated by a rise in tensile strength and collagen density [36]. The study's authors observed that wounds treated with CAE healed faster, as evidenced by faster epithelialization and a higher wound remodeling rate by comparison with untreated placebo wounds. The gel formulation of CAE was found to be particularly effective in promoting healing [36]. The process of burn healing is complex and time‐consuming, involving several stages such as neovascularization, granulation response, inflammation, and epithelialization. The extract of CA is known to promote collagen synthesis and improve the integration of the ECM [117, 118]. Therefore, this hydrogel is more effective in a full‐thickness wound model, and its greatest therapeutic potential lies in the repair of acute and chronic wounds with large tissue loss, including traumatic lacerations and diabetic wounds, where collagen regeneration and angiogenesis are of great importance. Although not specifically tested for use in burn wounds, the thermally responsive and porous quality of the scaffold would necessitate modification for high‐exudate or heavy eschar injuries. However, for further and more detailed investigation, the need for burn and diabetic wound modeling is recommended. In comparison to such comparable research, our results indicate comparable or even improved regenerative properties. For example, Miao Zhang et al. utilized alginate dressings for full‐thickness wounds but indicated less structural homogeneity due to the absence of soluble phytochemicals, which we improved on by adding bioactive compounds such as RG and Centella Asiatica [119]. On the other hand, endothelial cytotoxicity demonstrated by Ioana Bâldea et al.’s Lilium‐loaded hydrogels at high concentration and lack of long‐term biocompatibility studies were issues with our AECR system, as it demonstrated less than 5% hemolysis and cell viability was greater than 90% for up to 72 h [38].

Quantitative PCR (qPCR) was employed to quantify the levels of TGF‐b, MMP‐9, TIMP‐1, and VEGF in the damaged skin. The timely fibroblast migration to the wound site is crucial for tissue regeneration, as these cells play a role in collagen synthesis, which serves as the basis for tissue regeneration [116]. In this experiment, the expression of TGF‐b was distinctly higher in the AECR hydrogel than in the untreated group on the seventh day after the operation. According to Kanzaki et al. [116], saponin obtained from RG activates and enhances the production of TGF‐b1. Moreover, the promotion of the TGF‐b receptor within the wound healing mechanism by saponin extracted from RG suggests that it may stimulate the level of TGF‐b1, which can accelerate fibroblast performance in generating fibronectin for skin tissue regeneration. Therefore, RG is believed to enhance the initial phase of epidermal regeneration. The study analysis demonstrated that the expression of VEGF was substantially higher in the AECR sample on the seventh and 14th days after the operation, as compared to the untreated groups. Kimura et al., demonstrated that ginsenoside Rb1, which is a component of ginseng saponins, promotes the production of VEGF. Furthermore, the saponin constituent of RG stimulates the activation of the Akt [31]. The activation of these pathways enhances the migration and proliferation of fibroblasts, ultimately leading to an increase in collagen protein expression [120]. Moreover, Sung WN observed that the administration of RG led to the downregulation of miR‐377 expression, increasing the synthesis of the protein VEGF. Thus, it is postulated that RG stimulates angiogenesis by inducing the production of VEGF in skin wounds [31]. After 14 days following a wound, the tissue remodeling phase initiates, wherein a level of balance is achieved between the production and breakdown of collagen. MMPs are responsible for the breakdown of collagen. David [121] demonstrated that MMP‐1 released by fibroblasts and MMP‐9 synthesized by keratinocytes during the maturation phase of tissue regeneration facilitate the migration of keratinocytes, thereby aiding in the remodeling of ECM. The study results indicated that the MMP expression was substantially greater in the AECR and AER hydrogel on the 14th day after the operation, as compared to the untreated group. Test outcomes signified that RG promotes the secretion of MMP‐1 and MMP‐9, which aids in the detachment of keratinocytes from the basement membranes, leading to improved epithelialization in the advanced stage of wound repair. Asiatic acid (AA), madecassoside (MA), and asiaticoside (AE) are the primary components of centella asiatica (CA) extracts, and together, they are key players in the process of cutaneous injury repair. AE aids in the tissue regeneration process by promoting the formation of collagen and new blood vessels [117]. AE promotes the synthesis of collagen type by phosphorylating Smad 3. Studies conducted previously have indicated that AE promotes collagen synthesis by activating the kinase of the receptor I for tumor growth factor‐β (TGF‐β) [122].

Conversely, MA, a crucial constituent of CA, plays a substantial role in the recovery of burn wounds by promoting angiogenesis, enhancing antioxidant function, and augmenting collagen secretion [123]. Furthermore, MA additionally releases multiple growth factors, which aid in the restoration of tissue functionality [124]. Asiatic acid, another potent component of CA, promotes the expression of hyaladherin TNFAIP6 and contributes to ECM restructuring in fibroblast cells [125]. Additionally, it enhances collagen synthesis by increasing the balance between MMPs and TIMP, thereby reducing metalloproteinase activity [126].

However, the data collected in this study indicate that the hydrogel incorporating AECR demonstrates advantageous structural properties, including pore size, swelling ability, degradation rate, and stability. Thus, taking into account the unique wound healing properties of RG roots and Centella asiatica, which have been previously confirmed and emphasized in individual studies. Thus, considering the above‐mentioned findings and perspectives, the wound dressing material fabricated in this study has the potential to be a more effective alternative to commercially available bandages for promoting wound healing.

5. Conclusion

In the present research, a biodegradable hydrogel dressing for wound was successfully prepared by incorporating Centella asiatica and RG into an alginate–eggshell membrane matrix. The developed AERC hydrogel possessed favorable physicochemical and biological characteristics such as porous morphology, high swelling ratio, controlled biodegradability, and good hemocompatibility. It also possessed excellent antibacterial activity and did not exhibit cytotoxicity against 3T3 fibroblasts. In vivo gene expression and histopathological studies confirmed that the hydrogel stimulated epithelialization and overall wound repair considerably over control groups. These observations highlight the hydrogel as a multifunctional, bioactive wound dressing for full‐thickness wound repair that justifies further preclinical and clinical study.

Author Contribution

Samaneh Esmaeili: Methodology, Investigation, Visualization, Writing—original draft. Majid Rahmati: Conceptualization, Funding acquisition, Resources, Supervision, Project administration. Majid Salehi: Supervision, Validation, Investigation. Badrul Hisham Yahaya: Validation, Writing—review & editing. Sepehr Zamani: Methodology.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Esmaeili S., Rahmati M., Salehi M., Yahaya B. H., and Zamani S., “Enhancing Wound Healing with a Novel Alginate/Eggshell Membrane‐Based Hydrogel Enriched with Red Ginseng Roots and Centella Asiatica.” Skin Research and Technology 32, no. 1 (2026): e70325. 10.1111/srt.70325

Data Availability Statement

Data will be made available on request.