Skip to main content
European Journal of Medical Research logoLink to European Journal of Medical Research
. 2025 Dec 18;31:119. doi: 10.1186/s40001-025-03642-9

TRIM2 exacerbates the advancement of idiopathic pulmonary fibrosis by modulating β-catenin and endoplasmic reticulum stress

Yong Zhang 1,#, Di Jiang 2,#, Ganjuan Nie 3, Zhanping Lei 3, Jie Ling 4, Mi Tang 1, Yanmei Hu 1, Hengzhong Yi 1,
PMCID: PMC12829005  PMID: 41413621

Abstract

Background

The progression of idiopathic pulmonary fibrosis (IPF) is closely associated with endoplasmic reticulum stress (ERS). However, its precise regulatory mechanism has not been fully elucidated. As an E3 ubiquitin ligase, the biological function of TRIM2 in IPF and its regulatory role in ERS remain unexplored.

Methods

We analyzed the transcriptomic data of IPF from the Gene Expression Omnibus (GEO) database and collected clinical lung tissue samples. The expression of TRIM2 was detected using quantitative real-time polymerase chain reaction (qRT-PCR), Western blot, and immunohistochemistry (IHC). An in vitro pulmonary fibrosis model was established by treating A549 cells with 10 ng/mL TGF-β1 for 48 h. Based on this model, short hairpin RNA (shRNA) was used to knock down TRIM2 expression. Cell Counting Kit-8 (CCK-8) and scratch assay were employed to evaluate cell proliferation and migration abilities. Additionally, Western blot was performed to analyze the expression changes of epithelial-mesenchymal transition (EMT) markers (E-cadherin, α-SMA, Collagen I), endoplasmic reticulum stress (ERS)-related proteins (p-IRE1, IRE1, ATF6, GRP78), and β-catenin.

Results

This study demonstrated that TRIM2 was significantly upregulated in both IPF patients' lung tissues and TGF-β1-induced A549 cells. Functional experiments revealed that TRIM2 knockdown markedly suppressed TGF-β1-induced cell proliferation and migration, while reversing the epithelial-mesenchymal transition process—evidenced by increased E-cadherin and decreased α-SMA and Collagen I expression. Mechanistic investigations showed that TRIM2 knockdown effectively inhibited endoplasmic reticulum stress, as indicated by reduced expression of key ERS markers including p-IRE1, IRE1, ATF6, and GRP78. Notably, the ERS inducer thapsigargin reversed the suppressive effects of TRIM2 knockdown on cell proliferation, migration, EMT, and ERS. Furthermore, we discovered, for the first time, that TRIM2 negatively regulates β-catenin expression, and the β-catenin inhibitor JW55 partially restored the fibrotic phenotypes suppressed by TRIM2 knockdown.

Conclusion

This study demonstrates that TRIM2 promotes idiopathic pulmonary fibrosis progression by regulating β-catenin expression and endoplasmic reticulum stress, providing new insights into IPF pathogenesis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s40001-025-03642-9.

Keywords: Idiopathic pulmonary fibrosis, TRIM2, β-catenin, Epithelial-mesenchymal transition, Endoplasmic Reticulum Stress

Introduction

As a progressive chronic interstitial lung disease, idiopathic pulmonary fibrosis (IPF) is distinguished by the gradual destruction of alveolar structures and their substitution with fibrous tissue [1]. Clinical manifestations comprised progressive dyspnea, declining lung function, and an irritating dry cough [2]. Patients often succumb to respiratory failure and secondary lung infections. IPF represented approximately 20–30% interstitial lung diseases. Recently, IPF worldwide prevalence has been steadily rising, impacting over 3 million individuals [3]. Due to the highly complex etiology and pathogenesis of IPF, investigating the mechanism of pulmonary fibrosis and exploring potential therapeutic targets held significant clinical importance.

The current study considered epithelial-mesenchymal transition (EMT) as the principal cause of IPF where epithelial cells undergo a transformation into mesenchymal cells, leading to the loss of their original phenotype and function [4]. This process involved the transition of epithelial cells from tight interconnections to separate mesenchymal cells, which then migrate to neighboring tissues [5]. Consequently, the epithelial cell marker E-cadherin expression is downregulated, while mesenchymal cell markers expression such as N-cadherin and Alpha smooth muscle actin (α-SMA) was upregulated [6]. This ultimately results in the deposition of extracellular matrix (ECM) thereby promoting IPF development. Yan et al. [7] empirically demonstrated the involvement of MALAT1 in activating downstream signaling pathways by sequestering miR-503, thereby influencing EMT and contributing to IPF promotion. Qi et al. [8] demonstrated through experiments in the IPF cells that TUG1 triggered downstream signaling pathways by regulating CDC27, thus influencing EMT and promoting IPF. Therefore, the regulation of the EMT process has become a central component in understanding the pathogenesis of IPF.

Endoplasmic Reticulum Stress (ERS) primarily arises from the accumulation of unfolded or misfolded proteins within the ER [9]. Various factors, including hypoxia, starvation, calcium ion imbalance, oxidative stress, and drugs, could trigger ERS [10]. Studies have demonstrated the significant involvement of ERS in IPF onset and progression. ERS contributed to IPF advancement through multiple mechanisms, including the apoptosis of A549, polarization of M2 macrophages, and EMT [11]. Research has indicated that stimulated A549 cells with rhIL-32 could enhance ERS and induced EMT, thus ameliorating IPF progression [12]. The ER stress by MSCs contributed to ameliorating EMT in A549 cells, suggesting that the modulation of the IRE1α-XBP1 branch within the ER stress pathway played a pivotal role in this process [13]. Existing evidence indicated that ERS accelerated IPF progression. However, due to the presence of numerous regulatory factors, the intricate mechanisms governing this process remain incompletely understood.

TRIM2 belonged to the TRIM protein family, was situated at 4q31.3, and exhibited E3 ubiquitin ligase activity [14]. Research has shown that ubiquitin E3 ligases such as HRD1 drive IPF pathogenesis by modulating TGF-β–independent and –dependent pathways to promote fibrosis [15]. E3 ubiquitin ligase BRCA1-associated RING domain 1 (BARD1) could involve in lung fibrosis due to its role in regulating both the proliferation of fibroblast and deposition of ECM [16]. However, research on TRIM2 in IPF was limited. Currently, research on TRIM2 was primarily focused on the domain of tumors, for instance, its role as an E3 ligase for AXL and its association with the phosphorylation level induced by p85β, thereby disrupting the autophagic degradation of AXL protein and regulating ovarian cancer progression [17]. One study [18] identified differentially upregulated mRNA-TRIM2 from IPF-correlated datasets (GSE32537, GSE10667, GSE24206). Their study revealed that DLEU2 knockdown can modulate the expressions of miR-369-3p and TRIM2, thereby suppressing IPF. However, the specific biological function of TRIM2 in IPF, its mechanism of action, and its potential association with endoplasmic reticulum stress remain to be systematically elucidated. To address this knowledge gap, this study aims to investigate the precise role of TRIM2 in IPF progression. Through integrated bioinformatics analysis, clinical tissue validation, and in vitro cellular models, we systematically evaluated TRIM2's regulatory effects on the fibrotic phenotype of alveolar epithelial cells, the epithelial-mesenchymal transition process, endoplasmic reticulum stress signaling pathways, and β-catenin expression. This study not only reveals a previously unknown core function of TRIM2 in IPF but also provides new theoretical insights into the molecular mechanisms of IPF. Furthermore, it offers novel target directions for developing potential therapeutic strategies against this disease.

Materials and methods

Database analysis

Differential expressions of TRIM2 gene in IPF and normal lung tissues was analyzed using datasets GSE110147 and GSE53845 from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). The GSE110147 dataset comprised 22 IPF tissue specimens and 11 normal lung tissue specimens, and the GSE53845 dataset included 35 IPF tissue specimens with 8 normal lung tissue specimens. Normalization was performed using normal lung tissue data as the reference.

The patient samples

24 samples of IPF tissues and 8 samples of non-IPF controls (normal adjacent lung tissues from patients undergoing lung cancer resections) were collected during the surgical treatment process. Informed consent forms were obtained from all patients. A portion of the collected tissues was preserved at 80 °C, while the remaining lung tissue was fixed in formalin and then subsequently in paraffin. Table 1 listed the patient characteristics. The approval was granted by the Ethics Committee of The First Affiliated Hospital of University of South China (No. 2022ll1031001).

Table 1.

Basic characteristics of the participants in the validation cohort

Control (n = 8) IPF (n = 24) P value
Age (year) 58 ± 4.90 60 ± 3.71 0.23
Sex(male/Female) 4/4 15/9 0.55
BMI (Kg/m2) 21.25 ± 1.75 22.37 ± 2.70 0.28
SBP (mmHg) 120.50 ± 12.99 128.04 ± 11.94 0.14
DBP (mmHg) 73.37 ± 13.03 70.45 ± 9.69 0.51
Hyperlipemia (%) 2 (25%) 3 (12.5%) 0.41
Hypertension (%) 1 (12.5%) 9 (37.5%) 0.14
Smoking (%) 3 (37.5%) 10 (41.67) 0.84
Drinking (%) 2 (25%) 4 (16.67%) 0.61

BMI body mass index, SBP systolic blood pressure, DBP diastolic blood pressure

Cell culture and induction

A549 (Cell Bank of the Chinese Academy of Sciences, Shanghai, China) was cultured in DMEM (11965092, Gibco, Grand Island, NY, USA) added with 10% FBS (A5670701, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillium and 100 U/mL streptomycin in an incubator (5% CO2, 37 °C) until reaching 80% confluence. Subsequently, the cells were passaged following trypsin (25200072, Gibco) digestion and divided into TGF-β1 treatment group and control group (untreated). In the treatment group, A549 was stimulated with 10 ng/ml TGF-β1 (100–21, Peprotech, Rocky Hill, NJ, USA) for 48 h to induce fibrotic phenotypes. The harvested cells were utilized for subsequent experiments. For inducing ER stress, cells were pre-incubated with 0.1 μM TG for 4 h, followed by treatment with TGF-β1. To suppress β-catenin expression, we treated the cells with 10 μmol/L of JW55 (a β-catenin inhibitor) for 24 h.

Cell transfection

Prior to transfection, A549 cells were digested into single-cell suspension with trypsin. Subsequently, 3 × 105 cells were planted into 6-well plate and cultured overnight. After reaching 40% confluence, Lipofectamine™ 3000 (L3000150, Invitrogen, Carlsbad, CA, USA) was employed to separately transfect A549 cells with short hairpin RNA targeted to TRIM2 (sh-TRIM2) and its control (sh-NC). After 48 h cultivation, the cells underwent continuous screening with 3 μmol/L Puromycin for two weeks. Stable transfected cells were acquired and subjected to induction with TGF-β1 or treated with a combination of TGF-β1 and Thapsigargin (TG, a specific in vitro inducer of ERS), or TGF-β1 and JW55 following the aforementioned cell induction protocol. Ribobio Inc. (Guangzhou, Guangdong, China) synthesized the shRNAs and its control used in this study.

qRT-PCR

Total RNAs were extracted from cells and tissues by TRIzol kit (15596026CN, Thermo Fisher Scientific, USA). Subsequently, cDNA synthesis was conducted using the PrimeScript™ RT reagent Kit (RR047A, Takara, Otsu, Shiga, Japan) following the specifications. qRT-PCR was completed on a Real-Time PCR Systems (Integrated DNA Technologies, Coralville, IA, USA). The PCR was performed under initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 5–10 min after 40 cycles. With GAPDH as the internal control for mRNA, relative expressions were computed according to the 2−ΔΔCt method. Table 2 listed primer sequences.

Table 2.

The primers used for qPCR

Gene Forward primer (5′−3′) Reverse primer (3′−5′)
TRIM2 TGGAGAAGGAAATGGGCATG CTGCAACCACAACATGCACCA
α-SMA CTGTTCCAGCCATCCTTCAT CCGTGATCTCCTTCTGCATT
Collagen I TGACCGAGACGTGTGGAAAC CAGATCACGTCATCGCACAAC
E-cadherin GGGGTCTGTCATGGAAGGTGC GTAAGCGATGGCGGCATTGTA
IRE1 CATCACCATGTATGACACCAAGACC TGTCCACAGTTACCACCAGTCCA
p-IRE1 GCTGTGGAGACCCTACGCTAT TCGATGTTTGGGAAGATTGTTAG
ATF6 CAGCCCCTGTGGTGAGCAGC GCAGCCTTGAGCCTGGCCTC
GRP78 TCTCCACGGCTTCCGATAAT GTACCTTTGTCTTCAGCTGTCACTC
β-catenin CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC
GAPDH AAGGTGAAGGTCGGAGTCAAC GGGGTCATTGATGGCAACAATA

Western blotting (WB) analysis

Logarithmically growing cells were collected, lysed with RIPA buffer to extracted total proteins [19]. Using BCA protein kit (A65453, Thermo Fisher Scientific), protein concentration was quantified. After separating 50 µg protein sample with 10% SDS-PAGE gel, the protein was moved onto a PVDF. After using 5% skim milk to block the film for 2 h at room temperature, primary antibody TRIM2 (1:1,000; A14394; ABclonal Biotech Co., Ltd., Wuhan, China), α-SMA (1:1000; ab124964; Abcam, Cambridge, UK), collagen I (1:1000; ab260043; Abcam, UK), E-cadherin (1:1000; ab40772; Abcam, UK), p-IRE1 (1:1000; ab48187; Abcam, UK), IRE1(1:1000; ab124945; Abcam, UK), ATF6(1:1000; ab83504; Abcam), GRP78(1:1000; ab108613; Abcam, UK), β-catenin(1:500; ab68183; Abcam, UK) or GAPDH (1:2500; ab181602; Abcam, UK) was added and incubated with the film overnight at 4 °C, followed by washing with TBST. Then, the membrane was incubated with secondary antibodies (1:2500; ab6721; Abcam, UK) at room temperature for 1 h. ECL (Amersham Biosciences Fairfield, London, UK) was utilized for visualization. The grayscale values of the protein bands was analyzed by Image J software (NIH, Bethesda, MD, USA), with GAPDH as an internal reference. Antibodies were listed in Table 3.

Table 3.

List of Primary antibody antibodies

Name Vendor Cat no Dilution
TRIM2 ABclonal Biotech A14394 1:1000
α-SMA Abcam ab124964 1:1000
Collagen I Abcam ab260043 1:1000
E-cadherin Abcam ab40772 1:1000
IRE1 Abcam ab124945 1:1000
p-IRE1 Abcam ab48187 1:1000
ATF6 Abcam ab83504 1:1000
GRP78 Abcam ab108613 1:1000
β-catenin Abcam ab68183 1:500
GAPDH Abcam ab181602 1:2500

Immunohistochemistry staining

Paraffin- embedded tissues were sectioned into 4-μm thick slices using a microtome, followed by deparaffinization in xylene, dehydration in ethanol, and washing in PBS (C0221B, Beyotime, Shanghai, China). The slices were then incubated in a 3% H2O2 for 25 min in the dark. Subsequent steps involved incubation in a 3% BSA blocking solution (GC305006, Servicebio, Wuhan, China), overnight exposure to the anti-TRIM2 antibody (1:1,000; A14394; ABclonal Biotech Co., Ltd.) at 4 °C, and subsequent incubation with horseradish peroxidase-labeled goat anti-rabbit IgG H&L (1:500; ab150077; Abcam, UK) at 37 °C for 45 min. Following a 3-min diaminobenzidine (DAB) staining, the slices were counterstained with hematoxylin for 1 min, and the staining patterns were observed using an optical microscope (Olympus Corporation, vs200 ASW3.4.1, Tokyo, Japan) [20].

CCK-8 assay

CCK-8 assay (C0038, Beyotime, China) was employed to detect cell proliferation by first seeding the cells into 96-well plate for 0-, 24-, 48-, 72- and 96- h incubation. After stimulation with TGF-β1 and/or cell transfection for 48 h, 10 μL of CCK-8 was added to each well for further 2-h incubation at 37 °C. Finally, cells absorbance at 450 nm was measured using a microplate reader, and cells growth curves were plotted [21].

Wound healing assay

Following TGF-β1 induction and/or cell transfection, 2 × 105 cells were inoculated into 6-well plates and cultured until reaching the logarithmic growth phase. Scratch wounds were created using a sterile 5 mm pipette tip. Scratches were photographed at 0 h and 24 h with a microscope (Olympus Corporation, Japan), and the scratch widths were measured and documented as A (0 h) and B (24 h) respectively. The migration distance of each cell group was then computed as (A—B)/A and the data was normalized [22].

Statistical analysis

GraphPad Prism 8.0 (GraphPad, San Diego, CA, USA) and SPSS 18.0 software (SPSS, Chicago, IL, USA) were used for statistical analyses. The data from at least three independent experiments were shown in the mean ± SD. Group comparisons were performed using t-test for assessing significance, while one-way ANOVA was employed to compare differences among multiple groups. P < 0.05 was considered as statistical significance.

Results

TRIM2 was high-expressed in IPF tissues and cells

To clarify TRIM2 role in IPF progression, we examined two distinct IPF datasets (GSE110147 and GSE53845) in the Genome expression omnibus (GEO) database, and identified significant overexpression of TRIM2 (Fig. 1A). qRT-PCR and Western blot analyses consistently demonstrated that TRIM2 was significantly upregulated at both the mRNA and protein levels in IPF tissues compared to normal lung tissues, which aligns with the findings from the GEO database analysis (Fig. 1B, C). Immunohistochemistry results demonstrated widespread expression of TRIM2 in IPF tissue (Fig. 1D). TGF-β1 was an effective fibroblast stimulating factor that promote the proliferation, activation, and myofibroblast differentiation of lung fibroblasts in vitro, thereby inducing cells fibrotic phenotype. A549 cells exhibit the morphology and characteristics of typical type II alveolar epithelial cells. Inducing EMT in A549 cells using TGF-β1 is currently a commonly used method to establish in vitro models for pulmonary fibrosis cell studies [23, 24]. As depicted in Fig. 1E, F, we observed elevated TRIM2 expression in TGF-β1-treated A549 cells. These results substantiate TRIM2 was overexpressed in IPF tissues and TGF-β1-induced alveolar epithelial cells.

Fig. 1.

Fig. 1

TRIM2 expression was upregulated in IPF. A TRIM2 was highly expressed in IPF related datasets (GSE110147 and GSE53845). GSE110147 included IPF tissues (n = 22) and Normal lung tissue (n = 11); GSE53845 included IPF tissues (n = 35) and Normal lung tissue (n = 8). B TRIM2 mRNA expression was high-expressed in the lung tissues of IPF patients (IPF tissues: n = 24; Normal lung tissue: n = 8). C TRIM2 protein expression was highly expressed in the lung tissues of IPF patients (n = 3). D TRIM2 expression in TGF-β1-stimulated A549 cells was detected by qRT-PCR (n=3) E TRIM2 protein was detected through IHC staining (magnification, 10 × and 20 ×). IHC (n = 3). F TRIM2 expression in TGF-β1-stimulated A549 cells was detected by Western blot. Significant differences are directly denoted in the figures by p-values

TRIM2 modulated TGF-β1-induced EMT and ERS

To uncover the specific role of TRIM2 in fibrosis, we silenced TRIM2 in A549 cells and employed TGF-β1 treatment in vitro to mimic pulmonary epithelial cells’ fibrosis. Following sh-TRIM2 transfection, qRT-PCR and WB revealed a notable decrease in TRIM2 mRNA and protein expression, and the most significant downregulation effect of sh-TRIM2-2 was selected for subsequent cellular functional studies (Fig. 2A-B). Although TGF-β1 effectively enhanced A549 cells proliferation (Fig. 2C) and migration ability (Fig. 2D), these effects were mitigated by TRIM2 silencing. Given the pivotal role of EMT in pulmonary fibrosis, we assessed the expression of EMT-related proteins. The results depicted in Fig. 2E demonstrated that TGF-β1 upregulated the expression of extracellular matrix components Collagen I and mesenchymal cell marker α-SMA, while decreasing the expression level of the cell adhesion molecule E-cadherin. Notably, TRIM2 silencing reversed these effects (Fig. 2E–F). Furthermore, we observed a significant upregulation of ER stress-related proteins, namely p-IRE1, IRE1, ATF6, and GRP78, which were all inhibited with TRIM2 silencing (Fig. 2G–H). These data showed that TRIM2 promoted proliferation, migration, EMT process, and ERS in TGF-β1-induced A549 cells.

Fig. 2.

Fig. 2

Silencing TRIM2 inhibited the EMT and ERS in TGF-β1-induced A549 cells. A The silencing efficiency of TRIM2 in A549 cells were tested by qRT-PCR (n = 3). B Protein expression levels of TRIM2 after transfection with sh-TRIM2 1# or sh-TRIM2 2# were detected by Western blot. C Cell viability of TGF-β1-stimulated A549 cells transfected with/out sh-TRIM2 (sh-NC, sh-TRIM2) determined by CCK-8 assay (n = 3). D Wound healing assay. was adopted to measure the migration ability of TGF-β1-stimulated A549 cells after transfection (The scale bar shows 10 μm). E–F QRT-PCR and Western blot detected the expressions of E-cadherin, collagen I, and α-SMA in TGF-β1-stimulated cells following transfection (n = 3). G–H QRT-PCR and Western blot detected the expressions of p-IRE1, IRE1, ATF6, and GRP78 in TGF-β1-stimulated cells following transfection (n = 3). Significant differences are directly denoted in the figures by p-values. ns indicates no significant difference

TG could alleviate the inhibitory effect of silenced TRIM2 on A549 cells

TG, a specific in vitro inducer of ERS, depleted ER calcium stores by inhibiting Ca+ pump activity on the ER membrane, inducing ERS [25]. It was found that TG could reverse the inhibitory effects of TGF-β1 + sh-TRIM2 treatment on cell proliferation and migration (Fig. 3A–B). Furthermore, we also explored the effect of TG on TGF-β1-induced EMT and observed a noteworthy upregulation of Collagen I and α-SMA protein expression, both inhibited by sh-TRIM2, while the upregulation of E-cadherin protein expression exhibited a downward trend (Fig. 3C). Moreover, TG treatment reversed the downward trend of ERS-related proteins (p-IRE1, IRE1, ATF6, GRP78) (Fig. 3D). Overall, our study suggested the ERS induction could alleviate the impact of silenced TRIM2 on TGF-β1-induced IPF-modeled cells.

Fig. 3.

Fig. 3

The inducer of ERS alleviated the suppressive effects of silenced TRIM2 on TGF-β1-induced pulmonary epithelial fibrosis. A The cell viability in TGF-β1-stimulated cells after transfected with sh-NC, sh-TRIM2 or sh-TRIM2 + TG (n = 3). B Wound healing assay showed the migratory ability of TGF-β1-stimulated cells transfected with sh-NC, sh-TRIM2, or sh-TRIM2 + TG (The scale bar shows 10 μm). qRT-PCR assay detected the expressions of E-cadherin, collagen I, α-SMA in TGF-β1-stimulated cells after the transfection with sh-NC, sh-TRIM2 or sh-TRIM2 + TG (n = 3). D The expression of p-IRE1, IRE1, ATF6, and GRP78 in TGF-β1-stimulated cells following transfected with sh-NC, sh-TRIM2 or sh-TRIM2 + TG was detected by qRT-PCR assay (n = 3). Significant differences are directly denoted in the figures by p-values. Data were analyzed using one-way ANOVA and Tukey's post hoc test, with all results presented as means ± SD. Significant differences are directly denoted in the figures by p-values

Silencing TRIM2 promoted the expression of β-catenin

In this study, β-catenin expression was initially low in TGF-β1-induced A549 cells but increased following TRIM2 silencing (Fig. 4A–B). Additionally, the introduction of JW55 (β-catenin inhibitor) notably lowered its expression level. The preliminary results indicated that TRIM2 has a regulatory role in β-catenin expression in IPF. Additionally, JW55 notably enhanced the proliferation and migration abilities of TGF-β1-stimulated A549 cells suppressed by silenced TRIM2 (Fig. 4C, D). Simultaneously, inhibiting β-catenin expression reversed the decline of Collagen I and α-SMA caused by silenced TRIM2, while upregulating E-cadherin expression, suggesting that inhibiting β-catenin promoted EMT in IPF cells (Fig. 4E). In summary, silencing TRIM2 can hinder the fibrosis process induced by TGF-β1 in A549 cells by modulating β-catenin expression.

Fig. 4.

Fig. 4

Silencing TRIM2 promoted the expression of β-catenin. A The mRNA expression level of β-catenin after transfection with sh-TRIM2 was detected by qRT-PCR (n = 3). B Protein expression level of β-catenin after transfection with sh-TRIM2 was detected by western blot analysis. C The migratory ability of TGF-β1-stimulated cells transfected with sh-NC, sh-TRIM2, or sh-TRIM2 + JW55 was detected by the wound healing assay (The scale bar shows 10 μm, n = 3). D The cell viability in TGF-β1-stimulated cells after transfected with sh-NC, sh-TRIM2 or sh-TRIM2 + JW55 (n = 3). E The expressions of collagen I, α-SMA and E-cadherin in TGF-β1-stimulated cells following transfected with sh-NC, sh-TRIM2 or sh-TRIM2 + JW55 was detected by qRT-PCR analysis (n = 3). Significant differences are directly denoted in the figures by p-values. ns indicates no significant difference

Discussion

Pulmonary fibrosis presented a severe respiratory ailment characterized by gradual decline in body’s respiratory function, primarily attributed to the damage to lung epithelial cells [26]. Subsequently, there is a notable activation of fibroblasts and their proliferation, resulting in excessive collagen deposition and the onset of pulmonary fibrosis [27]. The increasing incidence of IPF patients represented a substantial threat in contemporary environment. Research predominantly focused on gene mutations and environmental exposures as crucial pathogenic factors, encompassing mutations in genes such as SFTPC, TERT, TERC, TOLLIP, ABCA3, MUC5B, as well as environmental factors like smoking, dust, and viruses [28, 29]. These factors induced dysfunction in A549, triggering ERS and activating TGF-β to prompt EMT and the release of various signaling molecules [30]. The analysis conducted in this study, using the GSE110147 and GSE53845 dataset from the GEO database, revealed significant upregulation of TRIM2 in IPF tissues and TGF-β1-induced pulmonary fibrosis cells. TRIM2 belonged to the TRIM family and functioned as RING-type E3 ubiquitin ligase [31]. TRIM2 distinct expression was closely associated with specific neurological disorders [14]. Research has revealed TRIM2 elevated levels in various conditions including pancreatic cancer, lung adenocarcinoma, and others [32, 33]. Furthermore, research has demonstrated a significant increase in TRIM2 expression in IPF tissues [18]. Here, Here, this study demonstrates for the first time through systematic functional experiments that TRIM2 plays a key driving role in IPF progression by synergistically regulating the ERS and EMT processes.

The effect of downregulating TRIM2 gene on TGF-β1-induced IPF cells was examined. TRIM2 downregulation inhibited A549 cells proliferation and migration induced by TGF-β1 and suppressed the EMT process. EMT was characterized by reduced E-cadherin expression and epithelial cell markers, augmented α-SMA expression in interstitial cell markers, loss of cell polarity, and a fibroblast-like morphology [34, 35]. Comparable protein changes were noted, but were reversed by TRIM2 silencing. Prior research has demonstrated that TRIM2 could promote lung adenocarcinoma malignant progression through EMT [36]. Additionally, downregulating TRIM2 was observed to impact ERS-related proteins expression. ERS was a cellular response to improper protein folding induced by external stimuli, which was implicated in promoting pulmonary fibrosis, inducing apoptosis, and aging of epithelial cells [37]. Beomseok Son et al. [38] demonstrated that ERS promoted lung fibrosis progression via regulating AT2 cells apoptosis, EMT, and myofibroblast cell differentiation. Furthermore, this study revealed that ERS inducers effectively counteract the suppressive effect of TRIM2 silencing on the proliferation, migration, EMT, and ERS induction in IPF cells. These findings underscore TRIM2’s role in promoting disease progression by regulating EMT during pulmonary fibrosis. More importantly, they reveal its concurrent involvement in modulating ERS, a critical pathological process. These findings establish TRIM2 as a pivotal hub in both EMT and ERS, suggesting it may coordinate these two critical pathways to jointly drive pulmonary fibrosis progression. This insight offers a novel integrative perspective for understanding the complex pathogenesis of IPF and highlights the potential therapeutic value of TRIM2 as a disease target.

The processes of IPF procession and alveolar epithelium EMT involve the transcription factor β-catenin [39]. We speculated TRIM2 modulated IPF through the β-catenin signaling pathway. β-catenin functioned as a transcriptional activator within the Wnt signaling pathway, intimately linked to numerous human tumors onset and progression [40]. Lehmann et al. [41] demonstrated that dysregulated Wnt/β-catenin activation was involved in IPF pathogenesis, indicating the correlation between lung fibrosis and β-catenin atypical expression. We analyzed the relationship between β-catenin and TRIM2 by examining alterations in protein levels of transfected cells after manipulating TRIM2 expression. Following cell and functional experiments, we observed that transfecting TRIM2 inhibitors significantly elevated β-catenin expression. This mechanism showed that TRIM2 may exacerbate the development of IPF by regulating the expression of β-catenin and ERS (Fig. 5). Owing to time and budget limitations, our study was subject to some constraints. The primary challenge lies in the seemingly contradictory phenomenon we observed: elevated total β-catenin protein levels concurrent with attenuated fibrotic phenotypes following TRIM2 silencing. It is particularly important to note that increased total β-catenin protein levels are not equivalent to enhanced transcriptional activity [42, 43]. We hypothesize that TRIM2 silencing may lead to the abnormal accumulation of β-catenin in the cytoplasm; however, due to the lack of necessary coactivators or the presence of spatial sequestration, these accumulated β-catenin molecules may fail to efficiently translocate into the nucleus to exert transcriptional functions. To verify this hypothesis, future studies need to systematically evaluate the spatial distribution and transcriptional activity of β-catenin through experiments such as subcellular fractionation and immunofluorescence localization. Second, the study relies primarily on the A549 cell line, and the generalizability of the results needs to be validated in primary alveolar epithelial cells and lung fibroblasts. Third, there is a lack of in vivo experimental evidence, and it is imperative to establish a TRIM2 conditional knockout mouse model to assess its impact on pulmonary fibrosis in a living organism. Fourth, the specific substrates of TRIM2 remain unclear, and co-immunoprecipitation (Co-IP) combined with mass spectrometry analysis should be employed to identify its interacting protein network. Finally, the scale of clinical samples is limited, and expanding the sample size with multicenter validation is necessary to enhance the clinical relevance of the conclusions. These in-depth investigations will help fully elucidate the precise mechanism of TRIM2 in IPF.

Fig. 5.

Fig. 5

The schematic diagram of TRIM2 in A549 cells. TRIM2 exhibited high expression in TGF-β1-stimulated A549 cells. Upregulated TRIM2 levels can modulate the expression of ERS-related proteins, including p-IRE1, IRE1, ATF6, and GRP78. In addition, TRIM2 interacted with β-catenin. In conclusion, TRIM2 regulated the expression of β-catenin and ERS, thereby contributing to the proliferation, migration, and progression of IPF in A549 cells

Conclusions

In conclusion, abnormal expression of TRIM2 mRNA and proteins was detected in IPF tissues and TGF-β1-induced IPF cells. Modulating TRIM2 influenced the proliferation and migration of IPF, alongside the protein expression related to EMT and ERS. It is hypothesized that the formation of IPF may be associated with the β-catenin pathway regulated by TRIM2. Hence, this study introduced novel targets for IPF treatment and presented fresh evidence and directions for the clinical diagnosis and management of this condition.

Supplementary Information

Additional file 1 (135KB, pdf)
Additional file 2 (36KB, doc)

Acknowledgements

Not applicable.

Abbreviations

IPF

Idiopathic pulmonary fibrosis

EMT

Epithelial-mesenchymal transition

α-SMA

Alpha smooth muscle actin

ECM

Extracellular matrix

ERS

Endoplasmic reticulum stress

ER

Endoplasmic reticulum

TRIM2

Tripartite motif-containing protein 2

BARD1

BRCA1-associated RING domain 1

GEO

Genome expression omnibus

DMEM

Dulbecco's Modified Eagle's Medium

FBS

Fetal bovine serum

Sh

Short hairpin

TGF-β1

Transforming growth factor-β1

TG

Thapsigargin

qRT-PCR

Quantitative reverse transcription PCR

WB

Western blotting

IHC

Immunohistochemistry

PBS

Phosphate buffered saline

DAB

Diaminobenzidine

RIPA

Radio-Immunoprecipitation Assay Buffer

SDS-PAGE

Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresi

BCA

Bicinchoninic Acid Assay

PVDF

Polyvinylidene Fluoride

ECL

Enhanced Chemiluminescence

CCK-8

Cell counting kit-8

SD

Standard deviation

ANOVA

Analysis of variance

Author contributions

All authors contributed to this present work: [YZ] and [DJ] designed the study, [GJN], [YMH] and [ZPL] acquired the data, [JL] and [MT] interpreted the data. [YZ] drafted the manuscript, [HZY] revised the manuscript. All authors read and approved the manuscript.

Funding

This research was supported by the Scientific Research Project of Hunan Health Committee (202203023624).

Data availability

The datasets used during the current study are available from the corresponding authors on reasonable request.

Declarations

Ethics approval and consent to participate

This study was approved by the Medical Ethics Committee of Hunan Provincial Chest Hospital (approval number: LS2023010902). All participants were provided with written informed consent at the time of recruitment, and all experiments involving human tissue specimens comply with the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yong Zhang and Di Jiang have contributed equally.

References

  • 1.León-Román F, Valenzuela C, Molina-Molina M. Idiopathic pulmonary fibrosis. Medicina Clínica (English Edition). 2022;159(4):189–94. [DOI] [PubMed] [Google Scholar]
  • 2.Glass DS, Grossfeld D, Renna HA, Agarwala P, Spiegler P, DeLeon J, et al. Idiopathic pulmonary fibrosis: current and future treatment. Clin Respir J. 2022;16(2):84–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Asghar S, Monkley S, Smith DJF, Hewitt RJ, Grime K, Murray LA, et al. Epithelial senescence in idiopathic pulmonary fibrosis is propagated by small extracellular vesicles. Respir Res. 2023;24(1):51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Salton F, Ruaro B, Confalonieri P, Confalonieri M. Epithelial-mesenchymal transition: a major pathogenic driver in idiopathic pulmonary fibrosis? Medicina (Kaunas). 2020. 10.3390/medicina56110608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Salton F, Volpe MC, Confalonieri M. Epithelial⁻mesenchymal transition in the pathogenesis of idiopathic pulmonary fibrosis. Medicina (Kaunas). 2019. 10.3390/medicina55040083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Abd Elrazik NA, Helmy SA. Betanin protects against bleomycin-induced pulmonary fibrosis by regulating the NLRP3/IL-1β/TGF-β1 pathway-mediated epithelial-to-mesenchymal transition. Food Funct. 2024;15(1):284–94. [DOI] [PubMed] [Google Scholar]
  • 7.Yan W, Wu Q, Yao W, Li Y, Liu Y, Yuan J, et al. MiR-503 modulates epithelial-mesenchymal transition in silica-induced pulmonary fibrosis by targeting PI3K p85 and is sponged by lncRNA MALAT1. Sci Rep. 2017;7(1):11313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Qi F, Lv ZD, Huang WD, Wei SC, Liu XM, Song WD. LncRNA TUG1 promotes pulmonary fibrosis progression via up-regulating CDC27 and activating PI3K/Akt/mTOR pathway. Epigenetics. 2023;18(1):2195305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Marciniak SJ, Chambers JE, Ron D. Pharmacological targeting of endoplasmic reticulum stress in disease. Nat Rev Drug Discov. 2022;21(2):115–40. [DOI] [PubMed] [Google Scholar]
  • 10.Kowalczyk M, Majsterek I, Gałecki P, Talarowska M. The role of the endoplasmic reticulum stress in depression. Psychiatr Pol. 2020;54(3):499–508. [DOI] [PubMed] [Google Scholar]
  • 11.Phan THG, Paliogiannis P, Nasrallah GK, Giordo R, Eid AH, Fois AG, et al. Emerging cellular and molecular determinants of idiopathic pulmonary fibrosis. Cell Mol Life Sci. 2021;78(5):2031–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gong L, Liu G, Zhu H, Li C, Li P, Liu C, et al. IL-32 induces epithelial-mesenchymal transition by triggering endoplasmic reticulum stress in A549 cells. BMC Pulm Med. 2020;20(1):278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Luo R, Wei Y, Chen P, Zhang J, Wang L, Wang W, et al. Mesenchymal stem cells inhibit epithelial-to-mesenchymal transition by modulating the IRE1α branch of the endoplasmic reticulum stress response. Stem Cells Int. 2023;2023:4483776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xiao M, Li J, Liu Q, He X, Yang Z, Wang D. Expression and role of TRIM2 in human diseases. Biomed Res Int. 2022;2022:9430509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li S, Zhao J, Shang D, Kass DJ, Zhao Y. Ubiquitination and deubiquitination emerge as players in idiopathic pulmonary fibrosis pathogenesis and treatment. JCI Insight. 2018. 10.1172/jci.insight.120362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.André PA, Prêle CM, Vierkotten S, Carnesecchi S, Donati Y, Chambers RC, et al. BARD1 mediates TGF-β signaling in pulmonary fibrosis. Respir Res. 2015;16:118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rao L, Mak VCY, Zhou Y, Zhang D, Li X, Fung CCY, et al. p85β regulates autophagic degradation of AXL to activate oncogenic signaling. Nat Commun. 2020;11(1):2291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yi H, Luo D, Xiao Y, Jiang D. Knockdown of long non‑coding RNA DLEU2 suppresses idiopathic pulmonary fibrosis by regulating the microRNA‑369‑3p/TRIM2 axis. Int J Mol Med. 2021. 10.3892/ijmm.2021.4913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang L, Yang H, Liu J, Wang K, Cai X, Xiao W, et al. Metabolomics-based approach to analyze the therapeutic targets and metabolites of a synovitis ointment for knee osteoarthritis. Curr Pharm Anal. 2023;19(3):222–34. [Google Scholar]
  • 20.Wu F, Zhang S, Fan C, Huang S, Jiang H, Zhang J. High-throughput sequencing reveals N6-methyladenosine-modified LncRNAs as potential biomarkers in mice with liver fibrosis. Curr Gene Ther. 2023;23(5):371–90. [DOI] [PubMed] [Google Scholar]
  • 21.Tian S, Chen M, Jing W, Meng Q, Wu J. MiR-1204 positioning in 8q24.21 involved in the tumorigenesis of colorectal cancer by targeting MASPIN. Protein Pept Lett. 2024;31(7):544–58. [DOI] [PubMed] [Google Scholar]
  • 22.Yu S-F, Cheng T-T, Huang G-K, Hsu C-Y, Kao Y-H, Chung Y-H. Targeting FGFR3 is a useful therapeutic strategy for rheumatoid arthritis treatment. Curr Mol Pharmacol. 2023;17(1):187. [DOI] [PubMed] [Google Scholar]
  • 23.Dehmel S, Weiss KJ, El-Merhie N, Callegari J, Konrad B, Mutze K, et al. MicroRNA expression profile of purified alveolar epithelial type II cells. Genes. 2022. 10.3390/genes13081420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.O’Beirne SL, Walsh SM, Fabre A, Reviriego C, Worrell JC, Counihan IP, et al. CXCL9 regulates TGF-β1-induced epithelial to mesenchymal transition in human alveolar epithelial cells. J Invest Med. 2015;195(6):2788–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhou HY, Sun YY, Chang P, Huang HC. Curcumin inhibits cell damage and apoptosis caused by thapsigargin-induced endoplasmic reticulum stress involving the recovery of mitochondrial function mediated by mitofusin-2. Neurotox Res. 2022;40(2):449–60. [DOI] [PubMed] [Google Scholar]
  • 26.Roque W, Romero F. Cellular metabolomics of pulmonary fibrosis, from amino acids to lipids. Am J Physiol Cell Physiol. 2021;320(5):C689-c695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Borgula IM, Shuvaev S, Abston E, Rotile NJ, Weigand-Whittier J, Zhou IY, et al. Detection of pulmonary fibrosis with a collagen-mimetic peptide. ACS Sens. 2023;8(11):4008–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tirelli C, Pesenti C, Miozzo M, Mondoni M, Fontana L, Centanni S. The genetic and epigenetic footprint in idiopathic pulmonary fibrosis and familial pulmonary fibrosis: a state-of-the-art review. Diagnostics (Basel, Switzerland). 2022. 10.3390/diagnostics12123107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Guérin C, Crestani B, Dupin C, Kawano-Dourado L, Ba I, Kannengiesser C, et al. [Telomeres and lung]. Rev Mal Respir. 2022;39(7):595–606. [DOI] [PubMed] [Google Scholar]
  • 30.Bao M, Feng Q, Zou L, Huang J, Zhu C, Xia W. Endoplasmic reticulum stress promotes endometrial fibrosis through the TGF-β/SMAD pathway. Reproduction (Cambridge, England). 2023;165(2):171–82. [DOI] [PubMed] [Google Scholar]
  • 31.Esposito D, Dudley-Fraser J, Garza-Garcia A, Rittinger K. Divergent self-association properties of paralogous proteins TRIM2 and TRIM3 regulate their E3 ligase activity. Nat Commun. 2022;13(1):7583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sun Q, Ye Z, Qin Y, Fan G, Ji S, Zhuo Q, et al. Oncogenic function of TRIM2 in pancreatic cancer by activating ROS-related NRF2/ITGB7/FAK axis. Oncogene. 2020;39(42):6572–88. [DOI] [PubMed] [Google Scholar]
  • 33.Cao H, Fang Y, Liang Q, Wang J, Luo B, Zeng G, et al. TRIM2 is a novel promoter of human colorectal cancer. Scand J Gastroenterol. 2019;54(2):210–8. [DOI] [PubMed] [Google Scholar]
  • 34.Li R, Guo Y, Zhang Y, Zhang X, Zhu L, Yan T. Salidroside ameliorates renal interstitial fibrosis by inhibiting the TLR4/NF-κB and MAPK signaling pathways. Int J Mol Sci. 2019. 10.3390/ijms20051103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhang G, Bai R, Huang J, Gao Y, Yun X, Haji AA. Barbaloin attenuates pulmonary fibrosis through TGF-β1/Smads/p38 pathway. J Pharm Pharmacol. 2022;74(8):1160–9. [DOI] [PubMed] [Google Scholar]
  • 36.Lin Z, Lin X, Zhu L, Huang J, Huang Y. TRIM2 directly deubiquitinates and stabilizes Snail1 protein, mediating proliferation and metastasis of lung adenocarcinoma. Cancer Cell Int. 2020;20:228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Shen M, Nan Y, Zhang L, Di L, He S, Li Y, et al. Maimendong decoction improves pulmonary function in rats with idiopathic pulmonary fibrosis by inhibiting endoplasmic reticulum stress in AECIIs. Front Pharmacol. 2020;11:1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Son B, Kwon T, Lee S, Han I, Kim W, Youn H, et al. CYP2E1 regulates the development of radiation-induced pulmonary fibrosis via ER stress- and ROS-dependent mechanisms. Am J Physiol Lung Cell Mol Physiol. 2017;313(5):L916-l929. [DOI] [PubMed] [Google Scholar]
  • 39.Reyes M, Flores T, Betancur D, Peña-Oyarzún D, Torres VA. Wnt/β-catenin signaling in oral carcinogenesis. Int J Mol Sci. 2020. 10.3390/ijms21134682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Li YF, Zhang J, Yu L. Circular RNAs regulate cancer onset and progression via Wnt/β-catenin signaling pathway. Yonsei Med J. 2019;60(12):1117–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lehmann M, Hu Q, Hu Y, Hafner K, Costa R, van den Berg A, et al. Chronic WNT/β-catenin signaling induces cellular senescence in lung epithelial cells. Cell Signal. 2020;70:109588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Bandapalli OR, Dihlmann S, Helwa R, Macher-Goeppinger S, Weitz J, Schirmacher P, et al. Transcriptional activation of the beta-catenin gene at the invasion front of colorectal liver metastases. J Pathol. 2009;218(3):370–9. [DOI] [PubMed] [Google Scholar]
  • 43.Goentoro L, Kirschner MW. Evidence that fold-change, and not absolute level, of beta-catenin dictates Wnt signaling. Mol Cell. 2009;36(5):872–84. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1 (135KB, pdf)
Additional file 2 (36KB, doc)

Data Availability Statement

The datasets used during the current study are available from the corresponding authors on reasonable request.


Articles from European Journal of Medical Research are provided here courtesy of BMC

RESOURCES