Effects of flammulina velutipes stipe wastes on egg performance, cecum microbiota, intestinal barrier and serum immune response of laying hens

Abstract

Background

Improving production performance and health is the key goal of laying hens farming. This experiment was conducted to examine the effects of Flammulina velutipes stipe wastes (FVW) on the performance of laying hens by regulating cecum microbiota, intestinal barrier and immune response. A total of 108 24-week-old Loman brown laying hens were randomly divided into basal diet group (BD), basal diet supplemented with 0.05 g/kg probiotic compound (PRO), and basal diet supplemented with 40 g/kg FVW. The trial lasted for 8 weeks.

Results

The results showed that compared with PRO and BD, FVW supplementation decreased feed conversion and increased egg Haugh unit of laying hens (P < 0.05). 16 S rRNA high-throughput sequencing analysis showed that Muribaculaceae, Eubacteriaceae, Synergistes, and Anaerofustis were differentially enriched in FVW-fed laying hens (P < 0.05). In addition, FVW increased the proportion of propionate in cecum, and mRNA levels of TLR-2, TLR-4, MyD88, Muc-2, Claudin-1, and ZO-1 in small intestinal mucosa were increased (P < 0.05). Meanwhile, FVW decreased the content of proinflammatory cytokines in serum (P < 0.05). According to Spearman correlation analysis, Eubacteriaceae and Anaerofustis were positively correlated with propionic acid and anti-inflammatory cytokine ratios, Muribaculaceae and Synergistes were positively correlated with intestinal barrier related gene levels.

Conclusions

Dietary FVW supplementation improved the performance and egg quality of laying hens, increased the mRNA expression of intestinal mucosal immune factors, and decreased the content of proinflammatory factors in serum, which could potentially be linked to the changes of gut microbiota of laying hens.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-025-05198-6.

Background

Intestinal health is of vital importance in modern laying hen production. The gastrointestinal tract of chickens is central to basic physiological processes such as digestion, absorption, and metabolism, and is closely linked to immune function [1]. In previous intensive laying hen farming, antibiotic growth promoters (AGPs) were used to enhance intestinal health and production performance by killing bacteria, reducing microbial competition for nutrients, inhibiting subclinical infections, and lowering immune stress. However, they have been banned by the WHO due to residue and resistance issues [2–5]. The long-term use of antibiotics to suppress harmful bacteria reduces the diversity of the gut microbiota, preventing the host from restoring normal gut function through the functional redundancy of the gut bacteria [6]. This led to the explosive colonization of opportunistic pathogens after the discontinuation of antibiotics. These overgrown pathogens depleted the gut mucus layer, disrupted tight junctions, and crossed the epithelial barrier, triggering the release of inflammatory cytokines [7, 8]. These cytokines further compromised the integrity of epithelial cells and increased intercellular permeability, ultimately causing gut microbiota dysbiosis and inflammation, which manifest as decreased feed intake and reduced feed efficiency in laying hens. In antibiotic-free farming, maintaining microbial homeostasis, intestinal integrity, and immune balance poses significant challenges.

A healthy gut microbiota refers to a state of equilibrium in the types, quantities, and functions of gut bacteria. A highly diverse gut microbiota can lead to functional redundancy among gut bacteria that perform the same functions, thereby enhancing the self-healing ability in response to external disturbances [9]. The gut microbiota is closely linked to the development of the gut immune system [10]. The colonization of beneficial bacteria can stimulate the body to establish immune tolerance, training it to distinguish between commensal and pathogenic bacteria, in order to reduce unnecessary immune responses and enhance the response to pathogenic bacteria [11]. In addition, short-chain fatty acids (SCFAs), which are metabolic products of the gut microbiota, can also stimulate the development of Treg cells and regulate the balance of inflammation [12]. Microbial ligands recognized by Toll-like receptors (TLRs) are not unique to pathogens, commensal bacteria are recognized by TLRs under normal homeostasis, and this interaction plays a crucial role in maintaining intestinal epithelial homeostasis [13]. Stimulation of the TLRs family may regulate epithelial barrier integrity by up-regulating tight junction (TJ) complex protein expression [14]. The effect of microbiota on intestinal epithelial cell proliferation is mediated through MyD88 and is independent of microbiota-induced inflammatory responses [15]. Inhibition of TLRs/MyD88 pathway-related molecules disrupts the integrity of the epithelial barrier, disrupts the balance between gut microbiota-host defense, and increases pathogen susceptibility [16]. Mucus plays a defensive role by participating in reducing the exposure of antigens and bacteria to the immune system underlying intestinal epithelial cells [17]. Mucin 2 (Muc-2), a major gel-like mucin secreted by goblet cells, is the most secreted signature mucin in the gastrointestinal tract [18]. Adjacent intestinal epithelial cells are linked together by the interaction of tight junction proteins, such as claudin-1, occluding, and zonula occludens protein 1 (ZO-1), which block the passage of bacteria between epithelia [19]. These evidence on the balance of microbiota-immune-barrier interaction have thus provided key strategies for healthy production of laying hens. Replace antibiotics with ecological-niche management to shift the gut microbiota of laying hens from passive defense to active balance: smaller fluctuations, faster recovery, and stable output under external disturbances—this is the long-term, non-antibiotic strategy for high-yield, healthy production.

Flammulina velutipes (FV) is a delicious edible and medicinal fungus [20], rich in nutrients and active substances such as protein, dietary fiber, polysaccharides, amino acids, ergosterol, flavonoids, etc., with antioxidant, anti-inflammatory, and immune-enhancing effects [21]. Our previous study found that FV ameliorated colonic inflammatory and antioxidant factors/cytokines by inhibiting NF-κB and MAPK/ERK1/2 signaling pathways, as well as improving the distribution of gut microbiota [22]. FV is widely cultivated in China and around the world with a huge annual yield. F. velutipes stipe wastes (FVW) are by-products of the processing and production of FV. Our laboratory has conducted a series of studies on the use of FVW in the feed of laying hens of different phases. We found that FVW supplementation improved the antibody titer and immunoglobulin levels of laying hens during the starting and growing phase [23, 24]. In the growing and laying phase, FVW supplementation stimulated the production of sex hormones, promoted follicular development and reduced follicular atresia, thereby promoting ovarian development of laying hens [25]. In the late laying phase, FVW supplementation regulated antioxidant through liver-blood-ovary axis, reduced ovarian cell apoptosis, and improved yolk precursor synthesis, thereby maintaining the performance of aged laying hens [26]. In addition, we conducted a longitudinal study covering the entire commercial breeding cycle from 1-day-old to 490-day-old, aiming to explore the occurrence and development patterns of intestinal flora in laying hens that consume FVW from an early age [27]. However, we do not know the impact of short-term feeding of FVW starting from adult laying hens on the intestinal flora of the hens. This makes our support for the application of FVW still limited.

In this study, the commonly used composite probiotics in commercial large-scale breeding were used as positive controls to evaluate whether FVW has similar intestinal health functions. The main purpose was to further assess the effects of short-term supplementation of FVW in an antibiotic-free breeding environment on the production performance, egg quality, intestinal microbiota, intestinal barrier function, and intestinal immune function of laying hens.

Methods

Preparation of PRO and FVW

The compound probiotics (PRO) employed in this investigation were freeze-dried bacteria powder (Bacillus subtilis, Bacillus bifidobacterium, Lactobacillus, Enterococcus faecalis, yeasts, and photosynthetic bacteria) with a viable density of 2 × 10¹⁰ CFU/g, purchased from Huanong Feed Co., LTD (Siping, China). Bacillus subtilis, Bacillus bifidobacterium, Lactobacillus, Enterococcus faecalis, yeasts, and photosynthetic bacteria were blended in a 2:1:1:1:1:1 ratio to form compound probiotics. Flammulina velutipes stipe wastes (FVW) were provided by Xuerong Biotechnology Co., Ltd. (Changchun, China).

Birds and experimental designs

The experimental was approved by the Laboratory Animal Care Review Committee of Jilin Agricultural University (ID: 2019-08-28-001). A total of 108 24-weeks-old LOHMAN Brown laying hens with similar body weight were selected and divided into three groups: 36 birds per treatment, housed 4 per cage in 9 cages. The birds of control group were fed with a basal diet group (BD). The birds of PRO and FVW groups were fed with basal diets supplementation with 0.05 g/kg PRO, and 40 g/kg FVW, respectively. The supplementation of 40 g/kg FVW was determined based on the results of previous experiments [25]. All feedings were applied according to the NRC (1994) and the principle of equal energy and nitrogen (Table 1). Feed and water were provided ad libitum during the whole experimental period of 8 weeks. The general nutrients of FVW were summarized in a previous study by our group [27].

Table 1.

Ingredients and nutrient composition of the experimental diets (%, as-fed basis)

Items	BD1	PRO1	FVW1
Ingredients (%)
Corn	60.61	60.56	58.11
Soybean meal	13.50	13.50	12.00
DDGS	8.50	8.50	8.50
Limestone	8.00	8.00	8.00
Peeling soya meal	4.50	4.50	4.50
Corn gluten meal	1.50	1.50	1.50
Corn germ meal	1.00	1.00	1.00
Soybean oil	0.75	0.75	0.75
Calcium hydrophosphate	0.60	0.60	0.60
NaCl	0.25	0.25	0.25
Sodium bicarbonate	0.10	0.10	0.10
Choline chloride	0.15	0.15	0.15
Methionine	0.15	0.15	0.15
Lysine 70%	0.05	0.05	0.05
Phytase	0.06	0.06	0.06
Lycine	0.03	0.03	0.03
Complex phosphoesterasum	0.01	0.01	0.01
Premix2	0.24	0.34	0.24
Compound probiotics3	0.00	0.05	0.00
FVW4	0.00	0.00	4.00
Total (%)	100.00	100.00	100.00
Nutrient composition
ME1(MJ/kg)	11.43	11.43	11.02
CP1 (%)	16.78	16.78	16.45
Ca1 (%)	3.09	3.09	3.10
P1 (%)	0.44	0.44	0.45
EE1 (%)	4.17	4.17	4.17
CF1 (%)	2.56	2.56	3.32
Lys1 (%)	0.77	0.77	0.74
Met1 (%)	0.44	0.44	0.43

Egg production performance and egg quality

Eggs were collected daily at 2 pm during the 8-week experiment, egg number and weight were recorded, and the weight of feed consumed per subgroup was counted weekly to calculate egg production performance. On days 53, 54, and 55 of the feeding experiments, 9 eggs were randomly selected from each of the nine cages corresponding to each group, and a total of 27 eggs from each group were used for egg quality testing. The blunt, middle and sharp eggshells were taken, and the inner shell membrane was stripped. The egg quality indexes were calculated as previously reported [28].

Sample collection

At the end of the 8th week of the formal experiment, all experimental chickens were fasted for more than 12 h and had free access to water. Chickens were euthanized using carbon dioxide (CO₂) inhalation [29]. Nine chickens were randomly selected from each group for slaughter sampling. The sampling site was Minggan Green Egg Breeding base of Liaoyuan City, China. The blood samples were collected, allowed to stand for 30 min at room temperature, then centrifuged at 3000 rpm, 4℃ for 15 min to obtain the serum, and stored at -20℃ before analysis. The small intestinal tissue and cecum digesta were collected and snap-frozen in liquid nitrogen, and stored at -80℃. The cecum digesta were used for DNA extraction and determination of SCFAs contents, and the jejunum tissue was used for RNA extraction.

DNA extraction, PCR amplification and 16 S illumina sequencing

The cecum digesta from every 3 birds was pooled to give 3 replicate samples, plus 1 extra single-bird sample, yielding 4 samples per group for sequencing. The microbial DNA was extracted from cecum by using the EZNA soil kit (Omega Bio-Tek, USA) according to the manufacturer’s protocol. The DNA concentration and purity were determined using the NanoDrop2000 instrument, and the integrity of the DNA was verified by 1% agarose gel electrophoresis. The V3-V4 variable region was amplified using the 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) primer pairs. According to the standard operating procedures of the Illumina MiSeq platform (Illumina, San Diego, USA), the purified amplified fragments were constructed into a PE 2*300 library. The steps for constructing the library are as follows: (1) Connect the “Y” shaped adapter; (2) Use magnetic beads to screen and remove self-connected fragments of the adapter; (3) Use PCR amplification to enrich the library template; (4) Denature with sodium hydroxide to generate single-stranded DNA fragments. The sequencing program was provided by Shanghai Majorbio Biological Co., LTD. The sequencing data have been uploaded to the NCBI (sequence Read Archive, SRA) under the project number PRJNA628750.

SCFAs concentrations in cecum

The cecal contents were taken and mixed with 2.5 times the volume of ultrapure water at 4 °C for 5 min. The mixture was centrifuged at 10,000 rpm 4 °C for 15 min. The metaphosphate solution was added at a ratio of 5:1 between the supernatant and metaphosphate and maintained at 4 °C for 30 min, followed by centrifugation at 10,000 rpm for 15 min. The resulting supernatant was filtered through a 0.22 µm filter, and the cecum concentrations of acetate, propionate and butyrate were determined by GC-MS according to a previous study [27].

Total RNA extration and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from the jejunum tissues using RNAiso Plus (RNAiso Plus, Code No. 9108/9109). Agarose gel electrophoresis was used to determine the integrity of the RNA. RNA purity analysis: An OD260/OD280 ratio of 1.7–2.1 indicates qualified RNA, which can be used for subsequent reverse transcription. RNA reverse transcription kit (PrimeScriptTM RT reagent Kit with gDNA Eraser, Code No. RR047A), and SYBR Green dye-based real-time fluorescence quantitative reagent kit (SYBR^® Premix Ex TaqTMⅡ, Code No. RR820A), all were purchased from TaKaRa Company. β-Actin was used as an invariant control. The primer sequences applied to this experiment are shown in Table 2. Real-time quantitative PCR (RT-qPCR) was performed on the Analytic-jena^® thermocycler (Biometra TOne 96, Germany) as previously reported [30]. The relative expression levels of target genes were determined using the 2-ΔΔCt method.

Table 2.

Primer sequences for qPCR

Gene	GeneBank accession number	Forward primers (from 5’ to 3’)	Reward primers (from 5’to 3’)
β-Actin	NM_205518.1	AACCGGACTGTTACCAACACC	AGACTGCTGCTGACACCTTCAC
Muc 2	NM_001318434.1	TTCATGATGCCTGCTCTTGTG	CCTGAGCCTTGGTACATTCTTGT
Claudin-1	NM_001013611.2	CATACTCCTGGGTCTGGTTGGT	GACAGCCATCCGCATCTTCT
Occludin	NM_205128.1	ACGGCAGCACCTACCTCAA	GGGCGAAGAAGCAGATGAG
Zo-1	XM_015278975.1	CTTCAGGTGTTTCTCTTCCTCCTC	CTGTGGTTTCATGGCTGGATC
TLR2	NM_001161650.1	TGCTGGACGTTAGTGCTAACAACC	GTGGCTTCAGGCAAGGTCTTCAG
TLR4	NM_001030693.1	AGTCTGAAATTGCTGAGCTCAAAT	GCGACGTTAAGCCATGGAAG
MyD88	NM_001030962.1	AAGGTGTCGGAGGATGGTGGTC	GGAATCAGCCGCTTGAGACGAG
TRAF6	XM_004941548.3	TGGAGGCACAGCAATGTAATGGC	GCACACCGCTGAGCACTTGG
I-κb	NM_001001472.2	CCGAGGACGGCGATACTTTT	TACGGCCAAGTGTAGTGCTG
NF-κB	NM_001012887.2	TTCTCCACTTGGCGATCATTCACG	GTCTGGCTGAGGTTGTTCTGGAAG

Serum analysis

The concentration of serum tumor necrosis factor-α (TNF-α), interleukin 1β (IL-1β), interleukin 6 (IL-6), interleukin 12 (IL-12), interleukin 4 (IL-4), and interleukin 10 (IL-10) was measured using the chicken-specific ELISA kits (Lengton Bioscience Co. Ltd., Shang Hai, China) in accordance with the manufacturer’s instructions.

Bioinformatics and statistical analysis

The bioinformatics analysis was carried out using the MEGA Bioinformatics Cloud Platform (https://www.cloud.majorbio.com). The UPARSE software (version 7.1, http://drive5.com/uparse/) was used to perform OTU clustering based on a 97% similarity threshold; UCHIME software was employed to eliminate chimeric sequences. Each sequence was classified and annotated using the RDP classifier (http://rdp.cme.msu.edu/), and compared with the Silva database (SSU123) with a comparison threshold of 70%. PCoA was performed using R language (version 3.3.1) for statistical analysis and plotting. The Venn diagram was created using the R language (version 3.3.1) for statistical analysis and plotting. LEfSe (http://galaxy.biobakery.org/) conducts linear discriminant analysis (LDA) on the samples based on their taxonomic composition, according to different grouping conditions, to identify the communities or species that have a significant impact on the division of the samples.

All data were analyzed at the individual-bird level All data were expressed as means and standard error of the mean (SEM) determined by SPSS v.25 (SPSS Inc., Chicago, USA). The significant difference was analyzed with one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. Spearman correlation analysis was performed using SPSS v.25. P value of less than 0.05 was considered to indicate statistical significance. All box plots, stacked bar charts, and bar charts were drawn using GraphPad Prism v.8 (GraphPad Software, San Diego, USA).

Results

Production performance and egg quality

As shown in Table 3, there was no difference between the BD and PRO group during the 8-weeks feeding experiment (P > 0.05). FVW had no significant effects on average feed intake, egg production rate, egg mass, eggshell, and yolk indices (P > 0.05). However, the FVW reduced the feed conversion ratio by 12.24% and 11.49%, as well as increased Haugh unit by 2.97% and 3.51% compared to the BD and PRO group (P < 0.05), respectively.

Table 3.

Effects of Flammulina velutipes stipe wastes on performance and egg quality of laying hens¹

Items	BD	PRO	FVW	SEM	P-value
Average daily feed intake (g/d)	119.15	118.22	111.10	2.39	0.35
Feed conversion ratio (g/g)	2.37a	2.35a	2.08b	0.05	0.01
Egg production (%)	89.65	91.17	89.95	0.50	0.39
Egg mass (g/hen/d)	51.62	51.61	50.48	0.34	0.31
Shape index (%)	125.46	127.41	126.78	0.61	0.41
Eggshell thickness (mm)	0.33	0.31	0.31	0.00	0.11
Eggshell strength (N)	51.34	53.16	53.50	0.76	0.45
Yolk color	8.88	8.73	8.91	0.06	0.46
Yolk weight (%)	30.77	31.86	31.73	0.29	0.22
Haugh unit	84.78b	84.43b	87.39a	0.41	0.02

Diversity and composition of the cecum microbiota

There was no difference among the three groups in alpha diversity indices (ACE, Chao, Simpson, and Shannon) at the OTU levels (P > 0.5) (Fig. 1A to D).

Fig. 1.

Effect of Flammulina velutipes stipe wastes on microbial diversity in the cecum digesta of laying hens (n = 4). Ace index (A), Chao index (B), Simpson index (C), and Shannon index (D). BD, basal diet group; PRO, compound probiotics group; FVW, Flammulina velutipes stipe wastes group. * P < 0.05 vs. BD, ** P < 0.01 vs. BD, # P < 0.05 vs. PRO, ## P < 0.01 vs. PRO

The Principal coordinate analysis (PCoA) based on OTU level showed that the sample points in the PRO group and the FVW group were clustered separately (R = 0.245, P = 0.039), indicating that the microbial community structure was different between the two groups (Fig. 2A). At the Phylum level, Bacteroidetes and Firmicutes had the highest relative abundance, which were 53.04% and 37.23%, respectively (Fig. 2B). At the Family level, Bacteroidaceae, Rikenellaceae, Ruminococcaceae, and Lachnospiraceae were the most dominant bacteria, accounting for about 60% of the total abundance (Fig. 2C). The top five genera across the three groups were Bacteroides, Rikenellaceae_RC9_gut_group, unclassified_o_Bacteroidales, [Ruminococcus]_torques_group, and unclassified_f_Lachnonospiraceae (Fig. 2D).

Fig. 2.

Comparison of the composition of the cecum digesta microbiome (n = 4). The principal coordinate analysis (PCoA) plots of the three group (A). Microbial structure at the Phylum level (B), Family level (C), and Genus level (D). BD, basal diet group; PRO, compound probiotics group; FVW, Flammulina velutipes stipe wastes group. * P < 0.05 vs. BD, ** P < 0.01 vs. BD. # P < 0.05 vs. PRO, ## P < 0.01 vs. PRO

As shown in the Venn diagram of the OUTs in the three groups, the three supplementation groups shared 754 OTUs among their cecum microbiota. The FVW supplementation group enriched the largest number unique OTUs (Fig. 3A). Multilevel discriminant analysis of species differences in cecum microbiota was performed by using LEfSe. The LDA scores contributed to the abundance of differential species within the group. Compared to the BD group, Rikenellaceae_RC9_gut_group, Rikenellaceae, Muribaculaceae, norank_f_Muribaculaceae, Ruminococcaceae_UCG-007, Nitrosomoas, and Nitrosomonadaceae were enriched in the PRO group (P < 0.05) (Fig. 3B), and Muribaculaceae, norank_f_Muribaculaceae, members of Synergistetes, Eubacteriaceae, and Anaerofustis were significantly enriched in the FVW group (P < 0.05) (Fig. 3C). In comparison with the PRO group, Faecalibacterium, Olsenella, Atopobiaceae, Actinobacteria, Coriobacteriales, Actinobacteria, Eubacteriaceae, Anaerofustis, [Eubacterium]_halii_group, norank_f_Lachnospiraceae, and Lachnoclostridium were enriched in the FVW group (P < 0.05) (Fig. 3D).

Fig. 3.

Shifts in taxa of the main microbiome in cecum digesta of laying hens (n = 4). The Venn diagram at the OTU level of the three groups (A). LEfSe multilevel discriminant analysis of species differences between BD and PRO (B), BD and FVW (C), and PRO and FVW (D). Different colors represent groups of microorganisms that have significant effects in different groups. It mainly shows the significantly different species with LDA score > 3.0. The color of the histogram represents the respective group, and the length represents the LDA score, that is, the impact of significantly different species between different groups. BD, basal diet group; PRO, compound probiotics group; FVW, Flammulina velutipes stipe wastes group

Contents and proportion of SCFAs

Compared with the BD group, the concentrations of acetate, propionate and total SCFAs in the FVW group were increased by 61.47%, 103.92%, and 62.61%, respectively (Fig. 4A, B and D). There was no change in butyrate concentrations and the proportion of acetate among the three groups (P > 0.05) (Fig. 4C and E). Compared with the BD group, the proportion of propionate in the FVW group was increased by 25.07%, whereas the proportion of butyrate was decreased by 50.48% (P < 0.05) (Fig. 4F and G).

Fig. 4.

Characteristics of the short chain fatty acids (SCFAs) profile in the cecum digesta of laying hens (n = 6). Acetate (A), Propionate (B), Butyrate (C), Total SCFAs (D), Proportion of acetate (E), Proportion of propionate (F), Proportion of butyrate (G). BD, basal diet group; PRO, compound probiotics group; FVW, Flammulina velutipes stipe wastes group. * P < 0.05 vs. BD, ** P < 0.01 vs. BD. # P < 0.05 vs. PRO, ## P < 0.01 vs. PRO

Intestinal barrier related genes analysis

The relative mRNA expression levels of TLR2, TLR4, and MyD88 in the jejunum of the FVW group were increased, in comparison with those in the BD and PRO group (P < 0.05) (Fig. 5A to C). Compared with the BD group, the relative mRNA expression level of Mucoprotein-2 (Muc-2), in the PRO and FVW group was up-regulated by 147.64% and 138.73%, respectively (P < 0.05) (Fig. 5D). The relative mRNA expression levels of Claudin-1 and Zonula occludens-1 (ZO-1) in the small intestine of the PRO and FVW group were higher than those of the BD group (P < 0.05) (Fig. 5E and G). There was no significant difference in mRNA expression of Occludin in FVW group compared with BD group (P > 0.05) (Fig. 5F). Moreover, the mRNA expression level of ZO-1 was the highest in the FVW group at 5.04 (P < 0.05) (Fig. 5G).

Fig. 5.

The relative mRNA expression of the gut barrier and immune genes in small intestinal tissues of laying hens on 34 weeks of age (n = 9): (a) TLR2, toll-like receptor 2; (b) TLR4, toll-like re-ceptor 4; (c) MyD88, myeloid differentiation primary response gene 88; (d) Muc-2, Mucoprotein-2; (e) Claudin-1; (f) Occludin; (g) ZO-1, zonula occludens-1. * P < 0.05 vs. BD, ** P < 0.01 vs. BD. # P < 0.05 vs. PRO, ## P < 0.01 vs. PRO

Contents of inflammatory cytokines

As shown in Table 4, the concentration of inflammatory cytokines in serum of laying hens was measured. The concentrations of pro-inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-12 in the FVW group were significantly lower than those in the BD group by 21.90%, 19.76%, 12.25%, and 22.70%, respectively (P < 0.05). In contrast, the concentrations of anti-inflammatory cytokines IL-4 and IL-10 in the FVW group were the highest, which were 11.49 pg/mL and 6.88 pg/mL, respectively (P < 0.05).

Table 4.

Effects of FVW on the serum inflammation factors of laying hens detected by ELISA (pg/mL) ¹

Item	BD	PRO	FVW	SEM	P-value
TNF-α (pg/mL)	63.48a	55.17bc	49.58c	1.48	0.000
IL-1β (pg/mL)	343.39a	327.50ab	275.54b	11.22	0.032
IL-6 (pg/mL)	21.80a	21.62a	19.13b	0.48	0.001
IL-12 (pg/mL)	656.36a	616.09a	507.35b	17.33	0.002
IL-4 (pg/mL)	8.66c	9.50b	11.49a	0.30	0.000
IL-10 (pg/mL)	4.53c	6.20b	6.88a	0.25	0.000

Correlation between SCFAs, intestinal barrier factors, immunity factors, and differential bacteria

Figure 6 presents the spearman correlation analysis of the SCFAs, intestinal barrier factors, immunity factors, and main differential bacteria. The content and the proportion of propionate were positively correlated with the relative abundance of Anaerofustis and Eubacteriaceae (P < 0.05). The relative expression levels of TLR2 and MyD88 were positively correlated with the relative abundance of Anaerofustis and Eubacteriaceae (P < 0.05). Regarding mucus barrier marker, relative expression level of Muc-2 was positively correlated with the relative abundance of Synergistes (P < 0.01). The relative expression levels of mechanical barrier genes (Claudin-1, Occludin, and ZO-1) were positively correlated with the relative abundance of Muribaculaceae (P < 0.01). Concerning the serum pro-inflammation factors, the concentration of TNF-α and IL-6 were negatively correlated with the relative abundance of Anaerofustis and Eubacteriaceae and the content of propionate (P < 0.05). Moreover, the concentration of IL-1β was negatively correlated with the relative abundance of Synergistes (P < 0.05) whereas for the anti-inflammation factors, the concentration of IL-4 and IL-10 was positively correlated with the relative abundance of Anaerofustis and Eubacteriaceae (P < 0.05).

Fig. 6.

Correlation between cecum digesta microbiota and SCFAs and intestinal barrier genes and serum parameters in Spearman correlation analysis. Abbreviations: Muc-2, Mucoprotein-2; ZO-1, zonula occludens-1; TLR2/4, toll-like receptor 2/4; MyD88, myeloid differentiation primary response gene 88; TRAF6, tumor necrosis factor receptor associated factor 6; NF-кB, Nuclear transcription factor кB; IкB, inhibitor of NF-кB; TNF-α, tumor necrosis factor-α; and IL-1β/6/12/4/10, interleukin-1β/6/12/4/10. Red indicates a positive correlation; blue indicates a negative correlation. * P < 0.05, ** P < 0.01

Discussion

Dietary fiber can be used as a cost-effective nutrient to modulate the poultry intestinal microecology [31]. However, few studies have been focused on the protective effect of mushroom fiber on gut barrier in laying hens triggered by the modulation of gut microbiota. In the present study, diet that included mushroom (F. velutipes) stipe wastes (FVW) was fed to laying hens for 8 weeks at the laying phase, using PRO (compound probiotics) as a reference. Our study revealed that FVW improved feed efficiency and egg freshness. FVW was found to specially modulated the cecum microbiota of laying hens, increased the proportion of propionate, stimulated the gut barrier integrity, and regulate the inflammatory responses. These results suggest that FVW may serve as a natural prebiotic supplementation for layer production.

FVW diet significantly decreased feed conversion ratio (FCR) during the 8-week experiment (25–33 age of weeks). The present study was similar with the previous study by Sun et al. [25]who reported that 4%FVW-fed hens significantly reduced FCR and improved eggshell strength during 17–27 age of weeks. Our previous studies reported that there were no significant effects of FVW on growth performance and production performance during 1–10 age of weeks and 47–67 age of weeks, but the eggshell thickness was improved [23, 26]. Moreover, Shu et al. [32]

stated that supplementation of fermented F. velutipes bed decreased the broken and soft-shelled eggs. Thus, FVW may reduce the FCR of laying hens by improving eggshell quality and reducing the number of broken eggs. In this study, egg Haugh unit was enhanced in the FVW group, which was associated with the improvement of egg freshness [28]. The various proportions of F. velutipes mushroom has been reported as a potential source of antioxidants [33]. FVW could also improve yolk antioxidant properties of laying hens [34]. Increasing the feeding source of antioxidants could be a potential strategy for improving egg quality as well as extending the shelf life of eggs. This study confirmed the beneficial effects of dietary supplementation with FVW on feed efficiency and egg freshness of laying hens.

The gut microbiota plays an important role in regulating the nutrient utilization and the immune system, thereby improving the host health and performance [35]. Interestingly, after microbiota mutual transplantation, the production of high-yielding hens slightly decreased but soon recovered, while the production of low-yielding hens increased [36], indicating that the stable homeostasis of the microbiota is essential for maintaining the performance of laying hens. In this study, Muribaculaceae, Eubacteriaceae, Synergistes, and Anaerofustis were differentially enriched in the cecum of FVW-fed laying hens. Muribaculaceae can metabolize endogenous and exogenous polysaccharides, including alpha-glucans, plant glycans, and host glycans [37]. As a dominant family of Bacteroideaceae, Muribaculaceae encodes enzymes that heavily hydrolyze carbohydrates [38]. We speculated that FVW intake enriched the dietary fiber available to Muribaculaceae and increased the nutrient source of intestinal bacteria, thereby reducing the feed conversion rate of laying hens. Muribaculaceae is positively correlated with the tryptophan metabolism [39]. Tryptophan which is the third limiting amino acid for laying hens and primarily used for protein synthesis to maintain egg production [40]. The increase of Synergistetes was closely related to the increase in fiber digestion, and its metabolism produced large amounts of acetate [41, 42], and contributed to the anti-inflammation [43]. Anaerofustis was beneficial to the intestinal morphological development of broilers [44], and was positively correlated with apparent digestibility of fecal crude fiber of sows [45].

Short-chain fatty acids (SCFAs), such as acetate, propionate and butyrate, are metabolites generated by the microorganisms fermentation of complex carbohydrates and play an important role in maintaining intestinal homeostasis [46]. In addition, they can affect calcium utilization and deposition by regulating systemic calcium metabolism homeostasis, thereby improving egg shell quality [47–49]. Muribaculacea has genes involved in the fermentation pathway to produce succinate, a substrate for propionate production, which contributes to propionate production [38, 50]. The short-term FVW supplementation significantly increased the content and proportion of propionate in cecal digesta of laying hens, accompanied by a decrease in the proportion of butyrate. In this study, the content and the proportion of propionate were positively correlated with the relative abundance of Anaerofustis and Eubacteriaceae. Moreover, genera from the Eubacteriaceae family can break down complex carbohydrates in dietary fiber and use 1, 2-propylene glycol to produce propionate by cross-feeding [51]. In addition, our previous study found that the polysaccharide of FVW mainly contains xylose, which is associated with enhanced propionate synthesis through cross-feeding of gut microbiota [52, 53]. The above results suggest that dietary fiber-rich FVW may produce propionate in a direct or cross-feeding manner by enriching members of the family Muribaculacea and Eubacteriaceae. Walugembe et al. [54]found that the proportion of butyrate significantly decreased with increasing dietary fibers content, which is consistent with the results of the present study. Most of the butyrate-producing bacteria belong to the Firmicutes phylum, such as Faecalibacterium, Coprococcus, Roseburium, and Blautia [55], which are mostly enriched in the BD group, but are lacking in the FVW group which is rich in dietary fiber. Meanwhile, the intestinal bacteria that produce propionate through fermentation are enriched in the FVW group, resulting in an increase in the proportion of propionate. The production of butyrate or propionate is highly correlated with the type and concentration of dietary fibers [56]. The above results may explain the possible reasons for the decrease in the proportion of butyrate.

FVW upregulated the expression of TLR2, TLR4, and MyD88 genes in the small intestinal mucosa of laying hens. TLR2 and TLR4 are pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs) and thus initiate innate immune responses [57]. MyD88 is a key adaptor of TLR signaling, and its up-regulation further supports the activation of TLR signaling pathway [58]. Rana et al. [59] reported that Lactobacillus acidophilus attached to the surface of intestinal epithelium in a TLR2-dependent manner to enhance intestinal tight junction barrier function. both PRO and FVW were found to increase the relative expression levels of intestinal barrier genes. In this study, compared with the BD group, the relative expression levels of Muc-2, Claudin-1, and ZO-1 mRNA in the PRO group and the FVW group were significantly upregulated, and the expression level of Occludin in the PRO group was significantly upregulated. These results indicate that the addition of FVW can achieve a similar protective effect on the intestinal barrier as commercial compound probiotics. Moreover, Yin et al. [60] found that dietary supplementation with Lactobacillus plantarum GX17 up-regulated the mRNA expressions of TLR2 and MUC2, while commercial complex probiotics increased the expressions of TLR2, TLR4, Muc2, and Occludin in small intestine of broilers, which is partially consistent with the PRO group in this study. MyD88 is a cytoplasmic adaptor protein of TLRs, the expression of Claudin-3 in neonatal mice requires activation of MyD88. Neonatal mice whose MyD88^-/- gene was knocked out showed impaired intestinal barrier and increased intestinal permeability [61]. These results suggest that TLR2-MyD88 may be necessary for the formation and maintenance of intestinal epithelial barrier. Muc2, the most secreted mucin in the gastrointestinal tract, was upregulated in this study, indicating that the mucus barrier was well-established [62]. In this study, FVW supplementation up-regulated the expression level of intestinal tight junction genes, especially ZO-1, which was consistent with the results of previous studies on the supplementation of prebiotics (combination of galactooligosaccharides, milk fat globule membrane, and fructooligosaccharides) in piglets [63]. These results further suggest that FVW may maintain the health of the intestinal tight junction barrier by up-regulating TLR2-MyD88. Furthermore, the adaptor protein MyD88 plays a major role in regulating host-microbe interactions [64]. The intestinal barrier and microbiota have been revealed to be bi-directional regulated to jointly maintain the host intestinal homeostasis [18]. In this study, Claudin-1, Occludin, and ZO-1 were positively correlated with Muribaculaceae. Muribaculaceae classified so far as either Porphyromonadaceae in RDP or S24-7 in SILVA [65], is associated with a healthy gut environment [66]. The spearman correlation analysis affirmed the indispensable role of the beneficial microbes in improving the gut barrier functions of laying hens.

FVW decreased the content of pro-inflammatory cytokines and increased the content of anti-inflammatory cytokines. The maintenance of host mucosal homeostasis requires a dynamic balance between anti-inflammatory and proinflammatory cytokines generated in the microenvironment [67]. In this study, the concentration of IL-4 and IL-10 were positively correlated with Anaerofustis, Eubacteriaceae and the proportion of propionate. Anaerofustis is a strictly anaerobic and gram-positive genus belonging to the family of Anaerofustaceae [68], and is well known as a beneficial bacterium in chicken [69, 70]. Some Anaerofustis species could be involved in the fermentation of carbohydrates and glucose metabolism in the cecum [71]. Furthermore, the propionate could bind GPR43/41 receptor to immune cells, down-regulate the expression of pro-inflammatory cytokines such as TNF-α, IL-6, and IL-12, and up-regulate the expression of anti-inflammatory cytokines such as IL-10 [72, 73].

Conclusion

In this study, fiber-rich FVW was used as a substitute of feed ingredients to demonstrate that it could change the fermentation substrates for cecum microbiota, enrich the fiber degrading bacteria and change the proportion of SCFAs, thereby enhancing the expression of intestinal barrier genes, regulating the dynamic balance of inflammatory cytokines, and ultimately maintaining intestinal health. Importantly, this study highlights the beneficial effects of FVW on feed efficiency and egg freshness in laying hens (Fig. 7). In conclusion, FVW, as a functional feed ingredient substitute, has potential gut protective effects, optimizes intestinal microecological balance, to a certain extent, optimizing the egg production performance of laying hens.

Fig. 7.

Schematic diagram outlining the regulation of performance in laying hens by Flammulina velutipes stipe wastes through the microbiota-innate immunity interact

Abbreviations

FVW

Flammulina velutipes stipe wastes

BD

Basal diet group

PRO

Probiotic compound

AGPs

Antibiotic growth promoters

SCFAs

Short-chain fatty acid

TLRs

Toll-like receptors

ZO-1

Zonula occludens protein 1

PCoA

Principal coordinate analysis

Authors’ contributions

JW: Data curation, Methodology, Writing - original draft, Writing -review & editing. BJ and ZD: Data curation. ISNT and ZL: Writing -review & editing. ZJ: Investigation, Conceptualization. HS: Supervision, Funding acquisition, Writing -review & editing.

Funding

This work was funded by Department of Science and Technology of Jilin Province (no. JJKH20190917KJ).

Data availability

The original contributions presented in the study are publicly available. This data can be found here: https: //www.ncbi.nlm.nih.gov/bioproject/; PRJNA628750.

Declarations

Ethics approval and consent to participate

The experimental was approved by the Laboratory Animal Care Review Committee of Jilin Agricultural University (ID: 2019-08-28-001). The study was conducted in accordance with the local legislation and institutional requirements.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.