Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Jan 23;40(2):e71426. doi: 10.1096/fj.202503081R

Maternal Fructose Intake During Pregnancy Induced the Hepatic Glucose Homeostasis Imbalance in the Offspring by Inhibiting Glucokinase

Yahui Miao 1, Ziyu Meng 1, Shihang Chen 1, Xiaoyu Li 1, Ting Fang 1, Xiaoqing Deng 1, Bei Sun 1,, Liming Chen 1,
PMCID: PMC12829521  PMID: 41575313

ABSTRACT

The global incidence of metabolic disorders has shown a significant upward trend, with growing evidence suggesting a strong association between their development and maternal environmental factors during gestation, including dietary patterns. This study investigated the effects of maternal fructose consumption during pregnancy on hepatic glucose metabolism in male mouse offspring. The results revealed that downregulation of glucokinase expression was closely associated with impaired glucose metabolism in the liver tissue of the offspring. Furthermore, DNA Methyltransferase 3 beta (DNMT3B)‐mediated hypermethylation of the glucokinase (GCK, protein: GK) promoter region was responsible for this transcriptional repression. This study established that maternal fructose intake during pregnancy led to reduced GK expression through DNMT3B‐dependent epigenetic modifications, resulting in abnormal glucose metabolism. Importantly, pharmacological intervention with a GK activator effectively ameliorated these metabolic abnormalities. Besides, the expression of DNMT3B was regulated by CCAAT Enhancer Binding Protein Beta (C/EBPβ) at the transcriptional level. In brief, this study demonstrated that maternal fructose intake has a negative effect on glucose metabolism in the liver of offspring and highlights the importance of dietary guidance during pregnancy and diabetes prevention.

Keywords: DNA methylation, fructose, glucokinase, liver glucose metabolism, offspring


Schematic diagram of the core mechanisms. The study demonstrated that maternal fructose intake during pregnancy led to glucose intolerance and insulin resistance in offspring. The abnormal hepatic glucose metabolism in offspring was associated with decreased GK expression, which was inhibited by DNMT3B. Besides, the expression of DNMT3B was regulated by C/EBPβ at the transcriptional level. This condition was improved by the administration of dorzagliatin.

graphic file with name FSB2-40-e71426-g005.jpg

1. Introduction

The Developmental Origins of Health and Disease (DOHaD) theory emphasizes the correlation between maternal exposure to harmful environmental factors during pregnancy and the development of metabolic disorders in the offspring [1]. Numerous studies have supported this correlation, demonstrating that maternal dietary and environmental factors can have long‐term effects on offspring's health [2, 3, 4, 5]. Fructose, owing to its low cost and high sweetness, is increasingly used in bread, beverages, and other foods. Maternal fructose intake during pregnancy increases the risk of metabolic diseases in the offspring, including insulin resistance, hypertension, and hyperuricemia [6, 7, 8, 9, 10].

The liver plays an important role in the metabolism of fructose and glycolipids [11]. While it has been established that maternal fructose intake during pregnancy affects liver lipid metabolism in offspring [10], the impact on hepatic glucose metabolism remains poorly understood.

GK, a subtype of hexokinase primarily expressed in the liver and pancreas, is a key regulator of glucose metabolism in these organs [12]. In the liver, GK senses the blood glucose levels and promotes glycogen synthesis, thereby maintaining glucose homeostasis [12, 13, 14, 15, 16]. Reduced expression or dysfunction of GK can lead to systemic glucose metabolism disorders, which are central to the pathogenesis of Maturity‐Onset Diabetes of the Young 2 (MODY2) [17, 18, 19, 20]. Dorzagliatin is a novel glucokinase activator (GKA) that acts on the pancreas and liver [21]. In the pancreas, it stimulates insulin secretion. In the liver, it promotes the dissociation of the GK‐Glucokinase Regulatory protein (GKRP) complex, enabling GK to move to the cytoplasm and exert hypoglycemic effects [22].

DNA methylation is a well‐characterized epigenetic mechanism that regulates gene expression by transferring a methyl group from S‐adenosylmethionine (SAM) to the fifth carbon of cytosine residues to form 5‐methylcytosine (5mC) [23]. This process is catalyzed by DNA methyltransferases (Dnmts) and primarily occurs in CpG‐rich regions of the genome [24]. Previous studies have demonstrated that the maternal environment during pregnancy can alter offspring gene expression through DNA methylation or demethylation, thereby increasing the risk of metabolic diseases [2, 3, 10, 25, 26, 27].

In this study, we developed a model of maternal fructose intake during pregnancy to investigate its effects on hepatic glucose metabolism in the offspring, with a particular focus on the role of GK. Our findings provide new insights into the mechanisms underlying metabolic diseases and offer valuable guidance for dietary recommendations during pregnancy.

2. Research Design and Methods

2.1. Construction of the Model of Fructose Exposure During Pregnancy in Female Mice

Seven‐week‐old C57BL/6N mice were purchased from Si Pei Fu Biotechnology Co. Ltd (Beijing, China) as experimental animals which were kept in a 12:12 h light–dark cycle at 22°C ± 2°C under specific pathogen‐free conditions for 1 week. Male and female mice were allowed to mate, and vaginal plugs were checked at 5:00 p.m. on the same day and again at 8:00 a.m. the next day. Once pregnancy was confirmed, the female mice were separated and randomly fed either a normal diet or a 34% fructose diet (Readydietech Co. Ltd, Shenzhen, China) on the 0.5th day of pregnancy. To ensure statistical significance, we ensured that there were 12 pregnant mice per group. Of these, six pregnant mice were used for the experiments, and the offspring of the remaining six were used for subsequent experiments. To determine the effect of fructose intake during pregnancy on the pregnant mice, from then on, the pregnant mice were weighed every 3 days, and the data were recorded. Blood glucose levels of pregnant mice were measured at the 10.5th and 18.5th days of pregnancy. In addition, the energy metabolism of pregnant mice on day 15.5 was monitored using an energy metabolism system. On the day of production, the mother mice were fasted for 6 h, and their livers were collected for subsequent experiments.

After the female mice gave birth, their fructose diet was changed to a normal diet and they were allowed to lactate normally. Their living environments remained the same. To reduce the influence of hormonal fluctuations and other variables, we chose male offspring for subsequent experiments. To ensure a balanced diet and avoid litter effects, we retained only one male offspring per female mouse. Birth weights of male offspring were measured and documented. Offspring were weighed biweekly. They were weaned at 4 weeks and continued to eat a normal diet. Fasting blood glucose levels of the offspring were measured every 2 weeks. Fasting blood glucose levels were assessed after 4 weeks because the blood glucose measurement was inaccurate with the low blood volume, and the offspring mice were easily frightened at birth and at 2 weeks. This study was approved by the Ethics Committee of Tianjin Medical University Chu Hsien‐I Memorial Hospital (Tianjin, China).

To exclude the influence of various operations on the participants' conditions, we attempted to perform the same operations simultaneously. The animals were kept in the same room and provided the same living conditions. More importantly, we performed double‐blind experiments on the experimental animals, which meant that the experimenters could not clearly distinguish between the control and experimental groups.

2.2. Indirect Calorimetric Measurements

The experimental mice were individually housed in metabolic monitoring chambers under standardized and constant environmental conditions. Oxygen consumption, CO2 production, RER, and EE of pregnant mice were recorded and calculated. Finally, the data were exported using Macro Interpreter software.

2.3. Glucose and Insulin Tolerance Test

GTTs and ITTs were performed on the offspring to clarify the effect of maternal fructose during pregnancy. First, the subjects were fasted for 6 h and then injected with glucose at a concentration of 2 g/kg body weight. Three days later, the same subjects were fasted for 6 h and injected with insulin at a concentration of 0.5 U/kg body weight. Blood glucose levels were measured at 15, 30, 60, 90, and 120 min.

2.4. The Injection of the GKAs

Offspring received dorzagliatin (a GKAs) by gavage from the fourth week (50 mg/kg/day) [28]. GTT and ITT were performed on the offspring 4 weeks after dorzagliatin injection.

2.5. Hematoxylin and Eosin Staining and Periodic Acid‐Schiff Staining

Fresh liver tissues were placed in 4% paraformaldehyde and embedded in paraffin. The paraffin sections used for HE and PAS staining were purchased from Solarbio (Beijing, China).

2.6. RNA‐Sequencing and Statistical Analysis

Fresh livers were collected for total RNA extraction using the TRIzol method, and the RNA was sent to APTBIO (Shanghai, China). The results were analyzed, and heat maps, volcano maps, and KEGG pathway analyses were performed using the related tools in Hiplot Pro (https://hiplot.com.cn/), a comprehensive web service for biomedical data analysis and visualization.

2.7. Cell Culture

HEK293T cells were purchased from the American Type Culture Collection (ATCC, CRL‐3216) and cultured in DMEM‐high glucose with 10% FBS and 1% penicillin and streptomycin mixture in a humidified incubator at 37°C with 5% CO2. To inhibit DNMT3B expression for 72 h, 5 μM of 5‐Azacytidine (HY‐10586, Med Chem Express, Monmouth Junction, NJ, USA) was used, and DMSO was used as a control.

AML12 (alpha mouse liver 12) cells were obtained from American Type Culture Collection (ATCC, CRL‐2254) and cultured in DMEM/F12 Medium with 10% FBS (fetal bovine serum), 10 μg/mL insulin, 5.5 μg/mL transferrin, 5 ng/mL selenium, 40 ng/mL dexamethasone, and 1% penicillin–streptomycin. Cells were maintained in the humidified incubator at 37°C with 5% CO2.

2.8. Primary Mouse Hepatocyte Isolation

Primary mouse hepatocytes were isolated according to the method described in a previous paper [29]. The isolated hepatocytes were cultured in collagen‐coated cell culture dishes and used for experiments the following day.

2.9. Bisulfite Sequencing PCR

After the liver tissue is extracted, it is sent to Tsingke Biotechnology Co., Ltd (Beijing, China) for testing, and the test sequence is TGTTCTTTTGGTTCTCAGATATAGAGGGCTCTGCTCCTTAGTGTGATAGGCACCAAGGCACTGACCTGGGAACTAAGCAGGTGGTAATGTCTACCAAGCTGGCAGTCACTGTGGTGACAGGGTGACAGAGTGGTCACCATGGTGACAGGAGTAGAGAGGCCTTTGGCAATCAGTCCCAGTTTTCTGCATGGTGGCTCTAATGAGACAATGGTCACCATAGAAACCACAGGCCCTCCCAGGAGCACAGAGGCCCTGACAGGAGACATCTACTCCACACCTGGTTGGAACAGAAGCACCGACTGTGACTGAGCCCAGAGAAGAAAGCTGAGGCGTGAGGGACAGAGAGTTACCTGTTGCCTCATTACTCAAAAGCCATCCCCAAGCCACTGGAGGGAGAGACCTTTTGTGCTGAGTCCGTCTAGAGGCCACCAGTTCCTCACAGCTCAGCAGAGCTGGAAGAAAGTCAGTCAACACTGAGGAACCACATGGCTCCTCCTGAAGACCGCTGGGCCTGAAGAGGCCTTGGTGGGGAGGGGTCCAGAAGTGAACAATGAAAAAGAGGAAGCTGTGGCTTCAACCAGCCTGAGGTGGACGGCAGAGCTCTCTGAGGTCCGGGGCTGGCTGTGACTCTGTGGGGGAAGTCTGGGCTACTTCTGCTTTGGAAAGCTGCTGCGGAACACTGAGGGGTCCCAGCTCACCTGGGCTGGCGGCTGGGCAGATGCTGGATGACAGAGCCAGGATGGAGGCCACCAAGAAGGAAAAGGTAGCTACCTCATGAAGCATTTTAGAAGTATCTGTTTGCATGTCCCCAACACTCACAGGGTTGGCTGCCACCTATAAGTGTCTATGCCTCAGAATTTGCTTTTATCTTTAAGAAAGATGTGGCTGGGGGCA.

2.10. Quantitative PCR

TRIzol reagent (Invitrogen) was used to extract RNA from the liver. A reverse transcription kit was purchased from TransGen Biotech (Beijing, China) to reverse the total RNA to cDNA in a thermal cycler (Thermo Scientific, USA). qPCR was performed using primers, cDNA, and a SYBR Green PCR reagent kit (TransGen Biotech, China). Finally, all results were normalized to 18 s. The primer sequences are listed in Table 1.

TABLE 1.

Primer sequences used for qPCR.

mus‐18 s‐F AGGCCCTGTAATTGGAATGAGTC
mus‐18 s‐R GCTCCCAAGATCCAACTACGAG
mus‐Gck‐F TGAGCCGGATGCAGAAGGA
mus‐Gck‐R GCAACATCTTTACACTGGCCT
mus‐Pfkfb3‐F CAACTCCCCAACCGTGATTGT
mus‐Pfkfb3‐R TGAGGTAGCGAGTCAGCTTCT
mus‐G6pc‐F GCTGGAGTCTTGTCAGGCAT
mus‐G6pc‐R ATCCAAGCGCGAAACCAAAC
mus‐Fox o1‐F GGGTCCCACAGCAACGATG
mus‐Fox o1‐R CACCAGGGAATGCACGTCC
mus‐Pck1‐F CTGCATAACGGTCTGGACTTC
mus‐Pck1‐R CAGCAACTGCCCGTACTCC
mus‐Gys 2‐F GAGTGGGGAGAGAATTACTTCCT
mus‐Gys 2‐R GGGCTCACATTGTTCTACTTGA
mus‐Gmds‐F GCTAAAGCTCCCgcTAAGTG
mus‐Gmds‐R GCCAAGTACGAACCATCCTGT
mus‐Adh4‐F TGGCAGTCCCCTTTGCATT
mus‐Adh4‐R ACTACCGGGAAGAGAGCTTTC
mus‐Acss2‐F AAACACGCTCAGGGAAAATCA
mus‐Acss2‐R ACCGTAGATGTATCCCCCAGG
mus‐Dnmt1‐F GGACAAGGAGAATGCCATGAAGC
mus‐Dnmt1‐R TTACTCCGTCCAGTGCCACCAA
mus‐Dnmt3a‐F CTGTCAGTCTGTCAACCTCAC
mus‐Dnmt3a‐R GTGGAAACCACCGAGAACAC
mus‐Dnmt3b‐R CCCAACTCCTTGAGCACCAA
mus‐Dnmt3b‐F TGAGCCACCCAAGTTGTACC
mus‐Tet1‐F CGGGTTTACAATGGCTCTTCG
mus‐Tet1‐R GGTTTGGGTGTGACTACTGGG
mus‐Tet2‐F GAAGGCAAGAGCTCTCAGGG
mus‐Tet2‐R TGAGAACAGCGACGGTTGG
mus‐Tet3‐F CCTGACCCTATGGCAGAACTG
mus‐Tet3‐R CAGGCCGCTTGAATACTGACT

2.11. Western Blotting

Proteins were extracted from the liver, HEK293T cells, and AML12 cells using RIPA buffer and separated by SDS‐PAGE. The concentration of the gels was determined based on the molecular weight of the target protein. Following electrophoresis, the target bands were transferred onto membranes. After blocking with 5% non‐fat milk for 1 h at room temperature, the membranes were incubated with primary antibodies overnight at 4°C. The primary antibodies used were as follows: GK (Abclonal, A15059, 1:1000), DNMT3B (Abclonal, A22658, 1:5000), HK2 (Proteintech, 22029‐1‐AP, 1:1500), GLUT2 (Proteintech, 20436‐1‐AP, 1:1500), KHK (Proteintech, 15681‐1‐AP, 1:1000), ALDOB (Proteintech, 18065‐1‐AP, 1:5000), ACLY (Proteintech, 15421‐1‐AP, 1:1000), Actin (Bioworld, BS6007M, 1:5000), and C/EBPβ (Proteintech, 23 431‐1‐AP, 1:15,000).

The next day, the membranes were washed three times with TBST and incubated with horseradish peroxidase‐conjugated secondary antibody (Sungene Biotech, China) diluted in 5% non‐fat milk for 1 h at room temperature. Protein bands were visualized using an ECL kit (Advansta, USA) and imaged. Band intensities were quantified using ImageJ software, and all results were normalized to actin (Table 2).

TABLE 2.

Abbreviation.

Full name Abbreviations
5hmc 5‐hydroxymethylcytosine
5mc 5‐methylcytosine
ACLY ATP Citrate Lyase
AldoB Aldolase B
BSP Bisulfite Sequencing PCR
C/EBPβ CCAAT Enhancer Binding Protein Beta
CHIP Chromatin immunoprecipitation
Dnmt1 DNA Methyltransferase 1
Dnmt3a DNA Methyltransferase 3 Alpha
DNMT3B DNA Methyltransferase 3 Beta
DOHaD Developmental origins of health and disease
G6pc Glucose‐6‐phosphatase
GK/Gck Glucokinase
GKA Glucokinase activators
GLUT2 Glucose transporter 2
GTT Glucose Tolerance Test
HE Hematoxylin and Eosin staining
ITT Insulin Tolerance Test
KHK KetohexoKinase
MEDIP Methylated DNA immunoprecipitation sequencing
PAS Periodic Acid‐Schiff staining
Pfkfb3 Fructose‐2,6‐bisphosphatase 3
Tet1 Tet methylcytosine dioxygenase 1
Tet2 Tet methylcytosine dioxygenase 2
Tet3 Tet methylcytosine dioxygenase 3

2.12. The 5‐mC and 5‐hmC Levels Detection

The total levels of 5‐mC and 5‐hmC in the liver DNA were measured using Mlbio (Shanghai, China). Liver tissue (15 mg) was homogenized in 1 mL saline, and 5‐mC and 5‐hmC levels were analyzed according to the manufacturer's instructions.

2.13. ChIP‐PCR

DNMT3B overexpression was induced in HEK293T cells, and after 48 h, the ChIP experiment was conducted in accordance with the protocol provided by the Simple ChIP Enzymatic Chromatin IP Kit (#9002, Cell Signaling Technology, USA). To capture valid DNA fragments, antibodies targeting IgG (Cell Signaling Technology, Danvers, MA, USA) and DNMT3B (ABclonal Technology, Wuhan, China) were used. The isolated DNA was subsequently subjected to PCR using GCK primers, with the sequences hum‐GCK‐F, 5′‐CACCTGCAGCCTAATTACTC‐3′ and hum‐GCK‐R, 5′‐CGCTTTCTCTCCTGGTTGTG‐3′.

ChIP‐PCR was also performed in primary mouse hepatocytes to assess the enrichment at the Gck promoter using the following primers: mus‐Gck‐F, 5′‐GAAGGAGAAGGGGAAGGAG‐3′ and mus‐Gck‐R, 5′‐CTGATGGCACCCCAAATGTTC‐3′.

Furthermore, C/EBPβ overexpression was induced in AML12 cells, and after 48 h, the ChIP‐PCR was performed using an antibody against C/EBPβ (Proteintech, Wuhan, China). The enrichment of the Dnmt3b promoter region was assessed by PCR with the following primers, mus‐Dnmt3b‐F, 5′‐ACCACTGAGCCATCTGTCCA‐3′, and mus‐Dnmt3B‐R, 5′‐GGCTGTGTGAGACACTGTCT‐3′.

2.14. MeDIP‐PCR

DNMT3B was overexpressed in HEK293T cells. After 48 h, the MeDIP experiment was initiated using the Methylamp Methylated DNA Capture Kit (P‐1015, EpiGentek, USA). We used antibodies of IgG and 5‐mC to capture valid DNA fragments. Finally, the captured DNA was used for PCR with the primers for GCK. The primer sequences were: hum‐GCK‐F, 5′‐CACCTGCAGCCTAATTACTC‐3′ and hum‐GCK‐R, 5′‐CGCTTTCTCTCCTGGTTGTG‐3′.

MeDIP‐PCR was also performed in primary mouse hepatocytes to assess the enrichment at the Gck promoter using the following primers: mus‐Gck‐F, 5′‐GAAGGAGAAGGGGAAGGAG‐3′ and mus‐Gck‐R, 5′‐CTGATGGCACCCCAAATGTTC‐3′.

2.15. Dual‐Luciferase Reporter Assay

AML12 cells were seeded into 96‐well plates and co‐transfected with the reporter plasmids containing the C/EBPβ or the promoter regions of DNMT3B and the Renilla luciferase plasmid using Lipofectamine 2000. Luciferase activity was detected 48 h after transfection using a dual‐luciferase assay kit (Yeasen, China), following the manufacturer's instructions.

2.16. Statistical Analysis

All data were processed in Prism 8.0 software (GraphPad, La Jolla, CA, USA) and expressed as mean ± SEM. Intergroup differences were assessed using unpaired t‐tests, and multigroup comparisons were performed using one‐way ANOVA followed by Tukey's post hoc test. Statistical significance was defined as p < 0.05 or 0.01.

3. Results

3.1. Maternal Fructose Intake During Pregnancy Activated Fructose Metabolism Pathways in the Liver

In our initial experiments, we tested the effects of fructose on pregnant mice. Pregnant mice fed a fructose diet showed lower body weights than those fed a normal diet (Figure 1A), despite consuming equivalent amounts of food (Figure 1B). Further analysis revealed that the fructose group consumed less fat and protein than the control group (Figure 1C). A metabolic instrument was used to test the metabolism of pregnant mice, and the results indicated that O2 inhalation, CO2 emissions, and energy consumption in the experimental group were higher than those in the control group (Figure 1D–F). Notably, maternal fructose intake had no significant impact on blood glucose levels (Figure 1G). Histological examination of liver tissues showed no significant changes in liver morphology but revealed increased glycogen accumulation and lipid vacuolization in the fructose‐fed group (Figure 1H). At the molecular level, maternal fructose intake significantly upregulated the key enzymes involved in fructose metabolism, including GLUT2, KHK, ALDOB, and ACLY, which are associated with lipid synthesis (Figure 1I). These findings collectively indicate that maternal fructose intake during pregnancy activates fructose metabolic pathways in the liver.

FIGURE 1.

FIGURE 1

Maternal fructose intake during pregnancy activated fructose metabolism pathways in the liver. mPnc: Mice fed a standard chow diet during pregnancy and mPfru: Mice fed a fructose‐enriched diet during pregnancy. (A) Effect of fructose intake during pregnancy on maternal weight (n = 6 mother samples per group). (B, C) Effect of fructose intake during pregnancy on maternal food consumption (n = 6 mother samples per group). (D–F) Effects of fructose intake during pregnancy on maternal energy metabolism (n = 6 mother samples per group). (G) Effect of fructose intake during pregnancy on maternal blood glucose levels (n = 6 mother samples per group). (H) Effects of fructose intake during pregnancy on liver morphology and glycogen deposition in female mice (Scale bar: 200 μm). (I) Effects of fructose intake during pregnancy on the expression of fructose metabolism and the lipid synthesis factors in the maternal liver of mice. Actin was used as a loading control (n = 3 mother samples per group). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

3.2. Offspring Exposed to Fructose In Utero Develop Impaired Glucose Tolerance and Are More Likely to Develop Diabetes Under Adverse Environmental Conditions

We investigated the effects of maternal fructose intake during pregnancy on the metabolic health of offspring (Figure 2). From birth to adulthood, the body weight and fasting blood glucose levels of the offspring were monitored. Offspring exposed to maternal fructose during pregnancy exhibited lower birth weights than the controls, and this difference persisted into adulthood (Figure 2A). Interestingly, fasting blood glucose levels were elevated in these offspring but normalized by adulthood (Figure 2B). To explore this phenomenon further, we focused on the lactation stage. Results revealed that maternal fructose feeding during pregnancy induced impaired glucose tolerance and insulin resistance in offspring at weaning (Figure 2C,D). Additionally, hepatic glycogen accumulation was reduced in the offspring (Figure 2E). Taken together, these findings reveal that in utero fructose exposure predisposes offspring to impaired glucose tolerance and increases their susceptibility to diabetes under adverse environmental conditions.

FIGURE 2.

FIGURE 2

Offspring exposed to fructose in utero developed impaired glucose tolerance and were more likely to develop diabetes under the adverse conditions. Pnc: Offspring from mothers fed a chow diet during pregnancy, and Pfru: Offspring from mothers fed a fructose‐enriched diet during pregnancy. (A) Changes in body weight of offspring from birth to adulthood (n = 6 offspring samples per group). (B) Changes in fasting blood glucose of offspring from birth to adulthood (n = 6 offspring samples per group). (C) Effects of maternal fructose intake during pregnancy on glucose tolerance in 4‐week‐old offspring (n = 6 offspring samples per group). (D) Effects of maternal fructose intake during pregnancy on insulin tolerance in 4‐week‐old offspring (n = 6 offspring samples per group). (E) Effects of maternal fructose intake during pregnancy on liver morphology and glycogen deposition in 4‐week‐old offspring (Scale bar: 200 μm). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

3.3. Maternal Fructose Intake During Pregnancy Inhibited Hepatic GK Expression in Offspring

To investigate the mechanisms underlying abnormal glucose metabolism in the offspring and to exclude the potential confounding effects of the post‐weaning diet, we focused on weaning mice for further analysis (Figure 3). Given the central role of the liver in glucose metabolism [14, 29], we hypothesized that hepatic dysfunction contributes to glucose intolerance and insulin resistance. RNA‐seq analysis of livers from 4‐week‐old offspring revealed the dysregulation of several glucose metabolism‐related pathways in the experimental group (Figure 3A). Differential gene expression analysis identified 377 downregulated and 438 upregulated genes in fructose‐exposed offspring compared to the controls (Figure 3B). Differential expression analysis of glucose metabolism‐related factors highlighted a significant reduction in Gck expression in the livers of fructose‐fed offspring (Figure 3C), which was further validated by qPCR (Figure 3D). Consistent with this, the protein level of GK significantly decreased in the experimental group (Figure 3E). To determine whether this suppression was an early developmental event, we assessed GK expression in newborn offspring and found that it was inhibited at this stage (Figure 3F,G).

FIGURE 3.

FIGURE 3

Maternal fructose intake during pregnancy inhibited hepatic GK expression in offspring. Pnc: Offspring from mothers fed a chow diet during pregnancy, and Pfru: Offspring from mothers fed a fructose‐enriched diet during pregnancy. (A) KEGG analysis revealed signaling pathways regulated by maternal fructose intake during pregnancy in the liver of offspring. (B) Volcano plot showed the effect of maternal fructose intake during pregnancy on gene expression in the liver of offspring. Blue indicated down‐regulated genes, red represented up‐regulated genes, and gray represented unaffected genes. (C) Heat map showed the expression of glucose metabolism‐related factors. (D) Validation of RNA‐Seq results by RT‐PCR. (E) Protein‐level expression of GK in the liver of 4‐week‐old offspring. Actin was used as a loading control (n = 4 offspring samples per group). (F, G) Expression of GK in the liver of newborn offspring. Actin was used as a loading control (n = 4 offspring samples per group). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

To confirm the specificity of GK suppression, we assessed the expression of additional glucose metabolism genes, GLUT2 and HK2, and found that maternal fructose intake during pregnancy had no notable effect on their expression (Figure S1A,B). Together, these findings suggest that maternal fructose intake during pregnancy disrupts liver glucose metabolism in the offspring, mainly through the downregulation of GK expression.

3.4. Maternal Fructose Intake During Pregnancy Enhanced DNA Methylation by Upregulating DNMT3B Expression in the Offspring Livers

These results indicate that reduced hepatic GK expression in offspring is a key factor contributing to glucose metabolism disorders. However, the mechanisms underlying GK suppression remain unclear. We first examined GK expression in maternal livers but found no significant differences between the two groups (Figure S2A). Epigenetic modifications, such as DNA methylation, regulate gene activity without altering the DNA sequence and play a critical role in mediating the effects of maternal environmental factors on offspring gene expression [3, 10, 27, 30, 31]. To investigate whether maternal fructose intake affected GK expression through DNA methylation, we performed multiple experiments (Figure 4).

FIGURE 4.

FIGURE 4

Maternal fructose intake during pregnancy enhanced DNA methylation by increasing DNMT3B expression in offspring livers. Pnc: Offspring from mothers fed a chow diet during pregnancy, and Pfru: Offspring from mothers fed a fructose‐enriched diet during pregnancy. (A, B) Effects of maternal fructose intake during pregnancy on methylation and demethylation levels in the liver of offspring at 0 days and 4 weeks (n = 6 offspring samples per group). (C) Heat map showed the expression of factors related to DNA regulation (n = 3 offspring samples per group). (D, E) RNA expression of methylation‐related and demethylation‐related factors in the liver of offspring mice at 0 days and 4 weeks (n = 4–8 offspring samples per group). (F, G) Effects of maternal fructose intake during pregnancy on the DNMT3B expression in the liver of offspring mice at 0 days and 4 weeks. Actin was used as a loading control (n = 4 offspring samples per group). (H) BSP for the methylation status of Gck. White circles represented unmethylated CpGs, and black circles represented methylated CpGs. Methylated shown in yellow, unmethylated shown in blue, and not present shown in gray. The All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Global DNA methylation was assessed by quantifying 5‐mC and 5‐hmC in the hepatocytes of the offspring. Maternal fructose intake during pregnancy significantly increased 5‐mC levels, whereas 5‐hmC levels remained unaffected (Figure 4A,B). RNA‐seq analysis revealed upregulated DNMT3B expression in the experimental group (Figure 4C), which was further confirmed at both the mRNA and protein levels (Figure 4D–G). Importantly, BSP revealed a significant increase in the methylation levels of the hepatic Gck promoter in the experimental group (Figure 4H). Collectively, these findings demonstrate that maternal fructose intake during pregnancy enhances DNA methylation in the offspring's liver by upregulating DNMT3B expression, leading to the persistent suppression of GK and contributing to glucose metabolism disorders.

3.5. DNMT3B Inhibited GK Expression by Enhancing Promoter Methylation

To further investigate the role of DNMT3B in the regulation of GK expression, we conducted a series of experiments. Treatment of HEK293T cells with 5‐azacytidine, a DNA methylation inhibitor, resulted in increased GK expression and reduced DNMT3B levels (Figure 5A). Conversely, transient overexpression of DNMT3B by plasmid transfection in HEK293T cells led to a significant decrease in GK expression (Figure 5B). To elucidate this mechanism, we performed ChIP‐PCR and demonstrated that DNMT3B directly binds to the promoter region of GCK (Figure 5C). We also verified the binding of Dnmt3b to the promoter region of Gck in primary mouse hepatocytes using ChIP‐PCR and found that the binding of DNMT3B to the Gck promoter region was more obvious in the experimental group (Figure 5D). Furthermore, MeDIP‐PCR analysis revealed that DNMT3B overexpression increased the methylation levels at the GCK promoter (Figure 5E). Similarly, by experimenting with primary mouse hepatocytes, we found that the Gck promoter region in mouse hepatocytes of the experimental group exhibited higher methylation levels (Figure 5F). Collectively, these findings demonstrate that DNMT3B suppresses GCK expression by enhancing DNA methylation of its promoter region.

FIGURE 5.

FIGURE 5

DNMT3B inhibited GK expression by enhancing methylation level in its promoter. (A) Expressions of DNMT3B and GK in HEK293T cells treated with 5‐AZA. Actin was used as a loading control (n = 3 samples per group). (B) Transient overexpression of DNMT3B inhibited GK expression at the protein level in HEK293T cells. Actin was used as a loading control (n = 3 samples per group). (C) CHIP‐PCR results showed that DNMT3B bound to the GCK promoter (n = 3 samples per group). (D) CHIP‐PCR results showed enhanced DNMT3B binding to the Gck promoter in primary mouse hepatocytes of the experimental group (n = 3 offspring samples per group). (E) MEDIP‐PCR results showed that DNMT3B overexpression made the methylation level of GCK's promoter increase (n = 3 samples per group). (F) MEDIP‐PCR results showed an enhanced methylation level of Gck promoter in primary mouse hepatocytes of the experimental group (n = 3 offspring samples per group). The All data were presented as mean ± SEM, *p < 0.05, **p < 0.01.

Subsequently, to explore the regulatory mechanisms of increased DNMT3B, we used the PROMO database to predict potential transcription factors and identified C/EBPβ as a candidate (Figure 6A). In line with this, C/EBPβ expression was significantly elevated in hepatocytes of fructose‐exposed offspring (Figure 6B,C). To further validate these findings, siRNA‐mediated knockdown of C/EBPβ in AML12 cells resulted in a marked reduction in DNMT3B expression (Figure 6D), indicating that C/EBPβ positively regulates DNMT3B. In addition, Dual‐Luciferase Assay and ChIP‐PCR further demonstrated that C/EBPβ can bind directly to the Dnmt3b promoter region (Figure 6E,F). The results confirmed that the downregulation of DNMT3B was linked to C/EBPβ. Here, we have only demonstrated that DNMT3B is transcriptionally activated by C/EBPβ, as this study primarily focuses on GK. In subsequent research, we will further validate the transcriptional activation of DNMT3B by C/EBPβ.

FIGURE 6.

FIGURE 6

C/EBPβ promoted DNMT3B expression through transcriptional activation. (A) The results of PROMO database prediction. (B, C) Effects of maternal fructose intake during pregnancy on the C/EBPβ expression in the liver of offspring at 0 days and 4 weeks. Actin was used as a loading control (n = 4 offspring samples per group). (D) Knockdown of C/EBPβ inhibited DNMT3B expression at the protein level in AML12 cells. Actin was used as a loading control (n = 3 samples per group). (E) Dual‐Luciferase Assay revealed that C/EBPβ trans‐activates the Dnmt3b promoter (n = 6 samples per group). (F) CHIP‐PCR results showed that C/EBPβ bound to the Dnmt3b promoter. All data were presented as mean ± SEM. *p < 0.05, **p < 0.01, and ****p < 0.0001.

3.6. The Novel GKA Dorzagliatin Alleviated Impaired Hepatic Glucose Tolerance and Insulin Resistance in Offspring

Previous studies have demonstrated that a reduction in GK activity led to impaired glucose tolerance in laboratory animals [18, 19]. To further investigate this mechanism, 4‐week‐old offspring were administered the novel GKA dorzagliatin by gavage (Figure 7).

FIGURE 7.

FIGURE 7

The novel GKA dorzagliatin alleviated impaired hepatic glucose tolerance and insulin resistance in the offspring. Pnc: Offspring from mothers fed a chow diet during pregnancy, and Pfru: Offspring from mothers fed a fructose‐enriched diet during pregnancy, and Pfru+GKA: Offspring from mothers fed a fructose‐enriched diet during pregnancy and treated with GKA (n = 6 offspring samples per group). (A–C) Effects of maternal fructose intake during pregnancy on glucose metabolism of offspring in 8‐week‐old offspring (n = 6 offspring samples per group). (D–F) Effects of 4‐week GKA intervention on glucose metabolism of offspring (n = 6 offspring samples per group). All data were presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

In our earlier experiments, we observed that the fasting blood glucose levels of adult offspring tended to normalize. However, maternal fructose exposure during pregnancy significantly elevated random blood glucose levels in the offspring (Figure 7A). Additionally, 8‐week‐old offspring exhibited both glucose intolerance and insulin resistance (Figure 7B,C). The results revealed that the 4‐week intervention with dorzagliatin effectively mitigated the increase in random blood glucose levels (Figure 7D). More importantly, glucose intolerance and insulin resistance were completely alleviated following the 4‐week treatment period (Figure 7E,F). These findings demonstrated that dorzagliatin successfully restored hepatic glucose tolerance and improved insulin sensitivity in the offspring.

In summary, the results indicated that maternal fructose intake during pregnancy suppressed hepatic GK expression in the offspring by upregulating DNMT3B. This suppression may be the primary cause of impaired glucose tolerance and insulin resistance in the young offspring. Importantly, this abnormality was mitigated by dorzagliatin. Furthermore, glucose intolerance and insulin resistance persisted into adulthood, increasing the susceptibility of these mice to type 2 diabetes (Figure 8).

FIGURE 8.

FIGURE 8

Schematic diagram of the core mechanisms. The study demonstrated that maternal fructose intake during pregnancy led to glucose intolerance and insulin resistance in offspring. The abnormal hepatic glucose metabolism in offspring was associated with decreased GK expression, which was inhibited by DNMT3B. Besides, the expression of DNMT3B was regulated by C/EBPβ at the transcriptional level. This condition was improved by the administration of dorzagliatin.

4. Discussion

In this study, we demonstrated that maternal fructose intake during pregnancy inhibits the expression of GK by increasing the methylation level of its promoter region in the liver of offspring. This reduction in hepatic GK expression led to glucose intolerance and insulin resistance in offspring. Notably, liver‐specific GK knockout mice have been shown to exhibit abnormal glucose metabolism and serve as animal models for studying MODY2 and non‐obese type 2 diabetes [30]. Our findings suggest that maternal fructose intake may represent a non‐genetic mechanism contributing to GCK‐MODY2, providing a novel perspective for the prevention of abnormal glucose metabolism and diabetes.

While it is widely recognized that maternal fructose intake during pregnancy negatively affects offspring, the underlying mechanisms remain incompletely understood. In this study, we established a novel mechanism by which maternal fructose intake during pregnancy disrupts glucose metabolism in the liver of the offspring via DNMT3B‐mediated hypermethylation of the GK promoter. Previous studies have shown that pregestational hyperglycemia induces glucose intolerance in offspring by impairing the demethylation processes associated with TET3 [3]. Similarly, maternal exercise during pregnancy improves glucose metabolism in offspring by increasing the demethylation levels of glucose metabolism‐related genes [31, 32]. Our study identified distinct effects of gestational fructose exposure on glucose metabolism in maternal and offspring mice. This differential effect is likely attributable to the direct metabolic effects of fructose on the dam, in contrast to its indirect influence on the offspring. Collectively, these studies support the notion that the maternal environment during pregnancy influences offspring metabolism via changes in DNA methylation and demethylation. Our findings reinforce this concept and may pave the way for the discovery of new mechanisms underlying fatty liver disease and diabetes.

Dorzagliatin, a novel glucokinase activator, activates pancreatic and hepatic GK in a glucose‐dependent manner and improves glycemic control in patients with T2DM [33, 34]. In this study, dorzagliatin effectively alleviated the abnormal glucose metabolism in the offspring of the experimental group, highlighting its therapeutic potential.

5. Conclusion

In conclusion, our study clearly demonstrates that maternal fructose intake during pregnancy has adverse effects on hepatic glucose metabolism in offspring, providing a new perspective on pregnancy dietary guidance and disease prevention. The observed glucose intolerance and insulin resistance in the offspring of the experimental group indicated a state of metabolic imbalance, which may predispose them to diabetes under adverse environmental conditions such as high‐fat diets.

6. Limitations and Future Directions

However, this study had several limitations. First, we did not explore the effects of other organs such as the pancreas and adipose tissue on glucose metabolism. While GKA also improves glucose metabolism through the pancreas, we focused on its effects on the liver, as the liver is central to glucose and fructose metabolism and is a key target of GKA. In addition, the potential effects of insulin have not been ruled out. Furthermore, the study did not investigate the role of other glucose metabolism‐related signaling pathways such as FOXO1/PKA/CREB [35]. We focused on GK, as it may serve as a critical link between fructose and glucose metabolism [11]. Adverse maternal nutritional environments during pregnancy can lead to various diseases in offspring, and many areas are worthy of further exploration [36, 37].

Author Contributions

Y.M., Z.M., and S.C. performed all of the experiments and edited the manuscript. Z.M. provided the funding. X.L., T.F., and X.D. collected samples and helped with data analysis. B.S. and L.C. designed the project, supervised research, provided the funding, and coordinated the execution of the experimental plan. B.S. and L.C. are the guarantors of this work and, as such, had full access to all study data. They take responsibility for the integrity of the data and the accuracy of the analysis. All authors shared equally in the manuscript and approved submission.

Funding

This study was supported by the National Key Research and Development Program of China (grant no. 2019YFA0802503), Natural Science Foundation of Tianjin Municipal (grant no. 23JCYBJC00980), Scientific Research Funding of Tianjin Medical University Chu Hsien‐I Memorial Hospital (ZXY‐ZDSYSZD2022‐2), and Tianjin Key Medical Discipline Construction Project (TJYXZDXK‐3‐007B).

Ethics Statement

All experiments were performed in accordance with the ARRIVE guidelines and approved by the Animal Ethical and Experimental Committee of Tianjin Medical University (no. 220517005).

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: Pnc: offspring from mothers fed a chow diet during pregnancy, and Pfru: offspring from mothers fed a fructose‐enriched diet during pregnancy. (A, B) Expression of HK2 and GLUT2 in the liver of offspring at 0 day and 4 weeks. Actin was used as a loading control (n = 4 offspring samples per group). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Figure S2: mPnc: Mice fed a standard chow diet during pregnancy and mPfru: Mice fed a fructose‐enriched diet during pregnancy. (A) Effect of fructose intake during pregnancy on GK expression in the liver of maternal mice. Actin was used as a loading control (n = 3 mother samples per group). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Acknowledgments

We are grateful to Hua Medicine (Shanghai, China) for providing the experimental drugs and thank Shanghai Tengyun Biotechnology Co., Ltd for developing the Hiplot Pro platform (https://hiplot.com.cn/) and providing technical assistance and valuable tools for data analysis and visualization. The schematics are from Scidraw.io.

Miao Y., Meng Z., Chen S., et al., “Maternal Fructose Intake During Pregnancy Induced the Hepatic Glucose Homeostasis Imbalance in the Offspring by Inhibiting Glucokinase,” The FASEB Journal 40, no. 2 (2026): e71426, 10.1096/fj.202503081R.

Contributor Information

Bei Sun, Email: beisun@tmu.edu.cn.

Liming Chen, Email: xfx22081@vip.163.com.

Data Availability Statement

Data are available from the corresponding author upon reasonable request.

References

  • 1. Hoffman D. J., Powell T. L., Barrett E. S., and Hardy D. B., “Developmental Origins of Metabolic Diseases,” Physiological Reviews 101 (2021): 739–795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Yi S. J., Xiong Y. W., Zhu H. L., et al., “Environmental Cadmium Exposure During Pregnancy Causes Diabetes‐Like Phenotypes in Mouse Offspring: Association With Oxidative Stress in the Fetal Liver,” Science of the Total Environment 777 (2021): 146006. [DOI] [PubMed] [Google Scholar]
  • 3. Chen B., Du Y.‐R., Zhu H., et al., “Maternal Inheritance of Glucose Intolerance via Oocyte TET3 Insufficiency,” Nature 605 (2022): 761–766. [DOI] [PubMed] [Google Scholar]
  • 4. Liu W. B., Zhu H. L., Xiong Y. W., Lv J., Huang Y. C., and Wang H., “Environmental Cadmium Exposure During Gestation Impairs Fetal Brain and Cognitive Function of Adult Offspring via Reducing Placenta‐Derived E2 Level,” Chemosphere 307 (2022): 135668. [DOI] [PubMed] [Google Scholar]
  • 5. Wang H., Liu L., Hu Y. F., et al., “Maternal Serum Cadmium Level During Pregnancy and Its Association With Small for Gestational Age Infants: A Population‐Based Birth Cohort Study,” Scientific Reports 6 (2016): 22631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Asghar Z. A., Thompson A., Chi M., et al., “Maternal Fructose Drives Placental Uric Acid Production Leading to Adverse Fetal Outcomes,” Scientific Reports 6 (2016): 25091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. dos Santos C. P., Nascimento‐Filho A. V. d., Araujo A. A., et al., “Parental Fructose Consumption Induces Early Baroreflex Dysfunction in Offspring: Impact on Arterial Pressure and on Insulin Resistance,” International Journal of Obesity 48 (2023): 284–287. [DOI] [PubMed] [Google Scholar]
  • 8. Seong H. Y., Cho H. M., Kim M., and Kim I., “Maternal High‐Fructose Intake Induces Multigenerational Activation of the Renin‐Angiotensin‐Aldosterone System,” Hypertension 74 (2019): 518–525. [DOI] [PubMed] [Google Scholar]
  • 9. Wang P., Wu T., Fu Q., et al., “Maternal High‐Fructose Intake Activates Myogenic Program in Fetal Brown Fat and Predisposes Offspring to Diet‐Induced Metabolic Dysfunctions in Adulthood,” Frontiers in Nutrition 9 (2022) : 848983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Ando Y., Yamada H., Munetsuna E., et al., “Maternal High‐Fructose Corn Syrup Consumption Causes Insulin Resistance and Hyperlipidemia in Offspring via DNA Methylation of the Pparα Promoter Region,” Journal of Nutritional Biochemistry 103 (2022) : 108951. [DOI] [PubMed] [Google Scholar]
  • 11. Jang C., Hui S., Lu W., et al., “The Small Intestine Converts Dietary Fructose Into Glucose and Organic Acids,” Cell Metabolism 27 (2018): 351–361.e353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Agius L., “Glucokinase and Molecular Aspects of Liver Glycogen Metabolism,” Biochemical Journal 414 (2008): 1–18. [DOI] [PubMed] [Google Scholar]
  • 13. Oosterveer M. H. and Schoonjans K., “Hepatic Glucose Sensing and Integrative Pathways in the Liver,” Cellular and Molecular Life Sciences 71 (2014): 1453–1467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Han H. S., Kang G., Kim J. S., Choi B. H., and Koo S. H., “Regulation of Glucose Metabolism From a Liver‐Centric Perspective,” Experimental & Molecular Medicine 48 (2016): e218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Nolan C. J. and Prentki M., “The Islet Beta‐Cell: Fuel Responsive and Vulnerable,” Trends in Endocrinology and Metabolism 19 (2008): 285–291. [DOI] [PubMed] [Google Scholar]
  • 16. Irwin D. M. and Tan H., “Molecular Evolution of the Vertebrate Hexokinase Gene Family: Identification of a Conserved Fifth Vertebrate Hexokinase Gene,” Comparative Biochemistry and Physiology. Part D, Genomics & Proteomics 3 (2008): 96–107. [DOI] [PubMed] [Google Scholar]
  • 17. Chakera A. J., Steele A. M., Gloyn A. L., et al., “Recognition and Management of Individuals With Hyperglycemia Because of a Heterozygous Glucokinase Mutation,” Diabetes Care 38 (2015): 1383–1392. [DOI] [PubMed] [Google Scholar]
  • 18. Kim M. Y., Jo S. H., Park J. M., Kim T. H., Im S. S., and Ahn Y. H., “Adenovirus‐Mediated Overexpression of Tcfe3 Ameliorates Hyperglycaemia in a Mouse Model of Diabetes by Upregulating Glucokinase in the Liver,” Diabetologia 56 (2012): 635–643. [DOI] [PubMed] [Google Scholar]
  • 19. O'Doherty R. M., Lehman D. L., Télémaque‐Potts S., and Newgard C. B., “Metabolic Impact of Glucokinase Overexpression in Liver: Lowering of Blood Glucose in Fed Rats Is Accompanied by Hyperlipidemia,” Diabetes 48 (1999): 2022–2027. [DOI] [PubMed] [Google Scholar]
  • 20. Langlet F., Haeusler R. A., Lindén D., et al., “Selective Inhibition of FOXO1 Activator/Repressor Balance Modulates Hepatic Glucose Handling,” Cell 171 (2017): 824–835.e818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Ren Y., Li L., Wan L., Huang Y., and Cao S., “Glucokinase as an Emerging Anti‐Diabetes Target and Recent Progress in the Development of Its Agonists,” Journal of Enzyme Inhibition and Medicinal Chemistry 37 (2022): 606–615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Haddad D., Dsouza V. S., Al‐Mulla F., and Al Madhoun A., “New‐Generation Glucokinase Activators: Potential Game‐Changers in Type 2 Diabetes Treatment,” International Journal of Molecular Sciences 25 (2024): 571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Wu Y. L., Lin Z. J., Li C. C., et al., “Epigenetic Regulation in Metabolic Diseases: Mechanisms and Advances in Clinical Study,” Signal Transduction and Targeted Therapy 8 (2023): 98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Luo C., Hajkova P., and Ecker J. R., “Dynamic DNA Methylation: In the Right Place at the Right Time,” Science 361 (2018): 1336–1340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Wang S., Wu J., Chen Z., et al., “DNA Methylation Reprogramming Mediates Transgenerational Diabetogenic Effect Induced by Early‐Life p,P'‐DDE Exposure,” Chemosphere 349 (2024): 140907. [DOI] [PubMed] [Google Scholar]
  • 26. Yamazaki M., Yamada H., Munetsuna E., et al., “Excess Maternal Fructose Consumption Impairs Hippocampal Function in Offspring via Epigenetic Modification of BDNF Promoter,” FASEB Journal 32 (2018): 2549–2562. [DOI] [PubMed] [Google Scholar]
  • 27. Tobi E. W., Goeman J. J., Monajemi R., et al., “DNA Methylation Signatures Link Prenatal Famine Exposure to Growth and Metabolism,” Nature Communications 5 (2014): 5592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Porat S., Weinberg‐Corem N., Tornovsky‐Babaey S., et al., “Control of Pancreatic β Cell Regeneration by Glucose Metabolism,” Cell Metabolism 13 (2011): 440–449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Charni‐Natan M. and Goldstein I., “Protocol for Primary Mouse Hepatocyte Isolation,” STAR Protocols 1 (2020): 100086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Zhang Y. L., Tan X. H., Xiao M. F., et al., “Establishment of Liver Specific Glucokinase Gene Knockout Mice: A New Animal Model for Screening Anti‐Diabetic Drugs,” Acta Pharmacologica Sinica 25 (2004): 1659–1665. [PubMed] [Google Scholar]
  • 31. Kusuyama J., Alves‐Wagner A. B., Conlin R. H., et al., “Placental Superoxide Dismutase 3 Mediates Benefits of Maternal Exercise on Offspring Health,” Cell Metabolism 33 (2021): 939–956.e938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Stanford K. I., Takahashi H., So K., et al., “Maternal Exercise Improves Glucose Tolerance in Female Offspring,” Diabetes 66 (2017): 2124–2136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Zhu D., Li X., Ma J., et al., “Dorzagliatin in Drug‐naïve Patients With Type 2 Diabetes: A Randomized, Double‐Blind, Placebo‐Controlled Phase 3 Trial,” Nature Medicine 28 (2022): 965–973. [DOI] [PubMed] [Google Scholar]
  • 34. Chow E., Wang K., Lim C. K. P., et al., “Dorzagliatin, a Dual‐Acting Glucokinase Activator, Increases Insulin Secretion and Glucose Sensitivity in Glucokinase Maturity‐Onset Diabetes of the Young and Recent‐Onset Type 2 Diabetes,” Diabetes 72 (2023): 299–308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Chen Y., Liu H., Wang Y., et al., “Glycosaminoglycan From Apostichopus japonicus Inhibits Hepatic Glucose Production via Activating Akt/FoxO1 and Inhibiting PKA/CREB Signaling Pathways in Insulin Resistant Hepatocytes,” Food & Function 10 (2019): 7565–7575. [DOI] [PubMed] [Google Scholar]
  • 36. Yang S., Guan H., Wang y., et al., “Effects of Steatotic Liver Disease and Cardiometabolic Risk Factors in MASLD on Adverse Pregnancy Outcomes,” Metabolism and Target Organ Damage 5 (2025): 33. [Google Scholar]
  • 37. Liu Y., Chen Z., Dang J., et al., “Cumulative Metabolic, Behavioral, and Early‐Life Factors for MASLD in Chinese Children With Validation in U.S. Adolescents,” Metabolism and Target Organ Damage 5 (2025): 4. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: Pnc: offspring from mothers fed a chow diet during pregnancy, and Pfru: offspring from mothers fed a fructose‐enriched diet during pregnancy. (A, B) Expression of HK2 and GLUT2 in the liver of offspring at 0 day and 4 weeks. Actin was used as a loading control (n = 4 offspring samples per group). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Figure S2: mPnc: Mice fed a standard chow diet during pregnancy and mPfru: Mice fed a fructose‐enriched diet during pregnancy. (A) Effect of fructose intake during pregnancy on GK expression in the liver of maternal mice. Actin was used as a loading control (n = 3 mother samples per group). All data were presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Data Availability Statement

Data are available from the corresponding author upon reasonable request.


Articles from The FASEB Journal are provided here courtesy of Wiley

RESOURCES