Development and optimization of T-ARMS PCR assays for detection of lethal haplotypes of TADA2A, UR1B, and PORL1B in pigs in Vietnam

Abstract

Marker-assisted selection has increasingly relied on single-nucleotide polymorphisms (SNPs) as robust genetic markers, particularly in livestock breeding programs. In pig farming, embryonic mortality significantly affects litter size, and SNPs in reference genes have been implicated as potential causal factors. We developed and optimized a tetra-primer amplification refractory mutation system (T-ARMS) PCR assay for rapid, cost-effective detection of SNPs in 3 candidate genes—TADA2A, PORL1B, URB1—that are associated with embryonic lethality and reproductive performance. Primer sets were designed based on known mutation sites and validated using synthetic gene constructs and porcine genomic DNA from pigs of Duroc and Landrace breeds. Optimization of annealing temperatures and primer concentration ratios yielded distinct and reproducible allele-specific amplicon patterns that were corroborated by PCR-RFLP and Sanger sequencing. Our T-ARMS PCR protocol, which requires minimal equipment and reduces processing time to <3 h, had high specificity and efficiency in differentiating wild-type, heterozygous, and homozygous mutant genotypes in 20 Duroc and 20 Landrace pigs. Our Tetra-ARMS PCR assay is a robust and economically viable tool for SNP genotyping in pig breeding programs, potentially contributing to the reduction of embryonic lethality and the improvement of overall reproductive outcomes.

Since the 1980s, marker-assisted selection and its associated techniques have been increasingly implemented. As the simplest form of genetic variation between 2 selected genomes, single-nucleotide polymorphisms (SNPs) are widely considered as one of the most important genetic markers because of their density and mutational stability in an individual’s genome and their relatively straightforward analysis. ¹⁶ Generally, any given nucleotide at any genomic location could be deleted, inserted, and substituted by another one, which by definition, could be detected in every 800 bp throughout the genome. ¹⁴ Thanks to genome-wide association studies, measurement of the correlation between SNPs and their phenotypes has become feasible, thus transforming molecular testing in many fields, including medicine, agriculture, and environmental science. ¹³

One of the key goals in pig farming is to identify SNPs implicated in agriculturally important traits, including reproductive performance and growth rate. Development of methods for high-throughput SNP genotyping has been revolutionized, which provides tools to researchers for establishing the association between the traits of interest and SNPs. The main techniques that are widely employed for high-throughput SNP genotyping are TaqMan technology, DNA microarrays, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and pyrosequencing.^1,7,15 However, these methods often require expensive equipment and reagents. Additionally, in pig-breeding programs, choosing elite individuals usually requires large numbers of animals for genotyping. These issues could be obstacles for scientists in diagnostic laboratories in developing countries with limited resources and funding. ¹⁷

Economical approaches for low- and medium-throughput SNP genotyping, such as PCR–restriction-fragment length polymorphism (PCR-RFLP), high-resolution melting (HRM) analysis, and allele-specific loop-mediated isothermal amplification (AS-LAMP), are involved in DNA amplification and analysis of the amplified products harboring the mutation. Each of these methods—PCR-RFLP, HRM, and AS-LAMP—offers distinct advantages and limitations in terms of specificity, throughput, cost, and technical requirements, making them suitable for different genotyping contexts depending on available resources and experimental goals.

PCR-RFLP is a molecular technique that can be used for SNP genotyping by amplifying a target DNA region and digesting it with a restriction enzyme. The DNA fragments are separated by gel electrophoresis to determine genotype. PCR-RFLP is simple, cost-effective, and highly specific when appropriate enzymes are used. ⁸ However, PCR-RFLP requires knowledge of restriction sites, is time-consuming, and has lower throughput compared with modern methods. ¹¹ HRM analysis detects SNPs by analyzing melting profiles of DNA amplified with a saturating dye. HRM analysis is sensitive, cost-effective, and versatile, but requires high-quality DNA and specialized instruments. ⁹ AS-LAMP amplifies target sequences using allele-specific primers under isothermal conditions. AS-LAMP is rapid, specific, and suitable for point-of-care applications, but faces challenges in primer design, nonspecific amplification, and multiplexing. ¹⁶

Another SNP genotyping approach is tetra-primer amplification refractory mutation system (T-ARMS) PCR testing that allows genotyping by a single PCR followed by agarose gel electrophoresis. T-ARMS utilizes 4 primers: 2 outer primers to amplify a larger fragment containing the SNP and 2 inner primers to selectively amplify either the wild-type or mutant allele. The inner primers are designed with mismatched bases at their 3′ ends to enhance specificity for the target allele. ¹⁰ During PCR, if the SNP of interest is present, the corresponding inner primer will facilitate amplification, leading to different fragment sizes that can be distinguished by gel electrophoresis or real-time PCR ( Fig. 1 ). The advantages of T-ARMS PCR include its high specificity, efficiency, and the ability to genotype SNPs in a single PCR reaction without requiring post-PCR processing steps, such as restriction digestion or sequencing. It is a cost-effective technique that does not require expensive equipment, making it suitable for routine laboratory applications and large-scale genotyping studies. ⁵ Additionally, it allows rapid detection of SNPs with high sensitivity and can be easily adapted for various target sequences. However, primer design for T-ARMS PCR is critical, as poorly optimized primers may lead to nonspecific amplification or preferential amplification of one allele, potentially affecting genotyping accuracy.

Figure 1.

Tetra-primer ARMS-PCR principle for SNP genotyping and expected gel patterns. A. Allele-discrimination design (schematic). Two outer primers (outer forward in blue; outer reverse in purple) flank the SNP region and can amplify a common control fragment from either template. Two inner allele-specific primers are oriented inward and terminate at the SNP site. The SNP nucleotide is highlighted in orange, and the deliberate primer–template mismatch(es) introduced to sharpen allele specificity are also highlighted in orange. Correct 3′-end pairing at the SNP permits extension (✓), whereas a 3′ mismatch prevents amplification (), thereby enabling discrimination between the T and G alleles. B. Expected PCR products. Tetra-primer ARMS-PCR generates: (i) a control amplicon from the outer-primer pair (present regardless of genotype), (ii) a T-allele–specific amplicon produced only when the T-specific inner primer successfully matches the template at the SNP, and (iii) a G-allele–specific amplicon produced only when the G-specific inner primer matches at the SNP. The allele-specific fragments differ in size from the control product, allowing separation by electrophoresis. C. Simulated gel-electrophoresis banding patterns. A DNA ladder is shown at left. The T/G heterozygote yields three bands (control + T-specific + G-specific). The G/G homozygote yields two bands (control + G-specific only). The T/T homozygote yields two bands (control + T-specific only).

In pig farming, embryonic mortality is one of the important problems affecting the number of piglets born alive. In an optimal environment, the embryonic mortality rate is 20–30%. Previous studies have categorized risk factors as genetic, sex, nutrition, and toxicities. ³ It was not until the introduction of the next-generation sequencing approach that SNPs were found as one of the causal mutations for porcine embryonic mortality. ⁴ In 2019, a study in 2 commercial pig populations revealed that a remarkable decrease in litter size by 15.1–21.6% was associated with 3 SNPs found in 3 different reference genes ( Table 1 ).^2,4

Table 1.

Specifics of 3 variants of embryonic lethality haplotypes in pigs.

Breed	Gene	Gene ID	Chromosome	Mutation site	Type	Amino acid change
Duroc	TADA2A	100737761	12	38,922,102 G>A	Splice-donor	Isoleucine319fs
Landrace	PORL1B	100517151	3	43,952,776 T>G	Splice-donor	Isoleucine701fs
	URB1	110256368	13	195,977,038 C>del	Frameshift	Valine1961fs

fs = frameshift.

TADA2A (transcriptional adaptor 2A) is a component of the SAGA (Spt-Ada-Gcn5-acetyltransferase) complex, which plays a crucial role in transcriptional regulation by modulating chromatin structure. ¹² URB1 (U3 small nucleolar RNA-associated protein 1) is a key factor involved in ribosome biogenesis, specifically in the maturation of the 60S ribosomal subunit. ¹⁹ POLR1B (RNA polymerase I subunit B) is a core component of RNA polymerase I, the enzyme responsible for transcribing ribosomal RNA (rRNA), which is essential for ribosome biogenesis and protein synthesis. Mutations in POLR1B have been associated with ribosomopathies and developmental disorders, highlighting the importance of this gene in maintaining normal cellular function and homeostasis. ²⁰ Loss-of-function mutations in the essential reference genes TADA2A, POLR1B, and URB1 give rise to early embryonic lethality in pigs, manifesting as a 15–18% reduction in litter size in carrier-by-carrier matings. Together, these natural “knock-outs” underscore the critical roles of transcriptional co-activation, RNA polymerase I activity, and ribosome assembly in porcine embryogenesis and fertility.

Our aim was to develop T-ARMS PCR assays to detect polymorphisms in 3 SNPs of 3 genes: TADA2A, PORL1B, and URB1. This technique could reduce the cost and time needed to screen for the frequency of lethal alleles in commercial pig populations in Vietnam.

Based on the mutation sites in TADA2A, PORL1B, and URB1 gene sequences, we designed 3 sets of primers for each gene using Primer1 software ( Table 2 ; http://primer1.soton.ac.uk/primer1.html). ²¹ The specificity of the designed primers was verified using NCBI Primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?). All primers were synthesized by Phu Sa Genomics (Vietnam). Primers were diluted with sterilized water and stored at −20°C until use. The T-ARMS PCR assays for TADA2A, PORL1B, and UR1B were designed to produce PCR products of expected sizes ( Fig. 2 ).

Table 2.

Primer sequences and melting temperatures (Tm) of PORL1B, TADA2A, and URB1 genes.

Gene	Primer	Primer sequence	Amplicon size, bp	Tm, °C
PORL1B	OF	AGCTGCAGTATGGAGATCCGTATTATAG	181	63
	OR	TACATTTTCTCCAAAAATTCTCCTGTTG		63
	IF	GGAAAGCTTTGTGGTGTACTATAAGCAC	133 (G allele)	63
	IR	TTTTAAAAAATGGCACTGAGTATGCTTACT	106 (T allele)	63
TADA2A	OF	GCGATTTCCTTTCCTGGGTAGTTCAGTTG	414	70
	OR	GAGGAAAGGCCCTGTTTGACAATGAAGA		70
	IF	TCTGTTCCAATGGCTTCGAATTCCGA	223 (A allele)	71
	IR	AAGGCTTGTTCCAGCCTGAAACATAATGAC	247 (G allele)	70
URB1	OF	CCCAGCCTCCTCCTGTGACATTGGTT	286	72
	OR	CCACACTCACTCAGCAGCTCCCTGACTT		72
	IF	CCATGAACCGCTTCACCGTGAACAAG	161 (C allele)	72
	IR	GGACATCCCTGGTGGACAGCACGATA	177 (del allele)	72

IF = inner forward; IR = inner reverse; OF = outer forward; OR = outer reverse.

Figure 2.

Workflow of the tetra-amplification refractory mutation system (T-ARMS) PCR genotyping for TADA2A, URB1, and POLR1B genes. Outer primers and inner primers were designed based on single-nucleotide polymorphism (SNP). PCR conditions were tested and optimized. Genotypes were determined by visual inspection.

We chose 1 DNA sample from a 12-mo-old Landrace pig to optimize the T-ARMS reaction conditions. The DNA concentration was measured, and a series of dilutions was used to identify the optimal PCR conditions. To validate the primers and protocol developed for the T-ARMS PCR technique, synthetic genes TADA2A (homozygous GG and wild-type AA genotypes), POLR1B (homozygous TT and wild-type GG genotypes), and URB1 (homozygous CC and wild-type del/del genotypes) were manufactured (Invitrogen, Integrated DNA Technologies, ThermoFisher). The products were suspended in 50 µL of nuclease-free water (final concentration of 100 ng/µL) and used as a DNA sample in the PCR assay. The heterozygous genotype for each SNP was assembled by mixing 1.5 µL of homozygous and 1.5 µL of wild-type genotypes. The T-ARMS PCR reaction was performed in a 10-µL mixture containing 1 µL of DNA (10 ng/µL), 5 µL of mastermix (Salagene Cool dry PCR premix; Salagene), 0.4 µL of 10 pM primer, and 2.4 µL of ultrapure water. After thermocycling (T100 thermal cycler, Bio-Rad), 5 µL of the amplified products were analyzed by horizontal electrophoresis on a 1.5% agarose gel. The electrophoresis conditions were 150 V for 30 min using 0.5× Tris-borate-EDTA solution along with a 100-bp molecular weight marker (Salagene) to determine the size of the amplified fragments. Gel images were captured (UVP GelDoc-It2; ThermoFisher).

Several factors can affect the successful use of the T-ARMS PCR assay in SNP detection. We chose annealing temperature and primer concentrations to optimize the T-ARMS PCR assay. A gradient PCR was performed for each SNP separately to ascertain the most suitable annealing temperature. For optimization, the amplification process was carried out with synthetic genes. The reaction temperature conditions for the T-ARMS PCR assay were as follows: pre-incubation at 94°C for 5 min; 35 cycles, including denaturation at 94°C for 30 s; annealing temperature at 62–68°C for 30 s; extension at 72°C for 30 s; 1 cycle of final extension at 72°C for 7 min. We also chose 3 different outer/inner primer concentrations ratios: 1:2, 1:3, and 1:5. Based on the observed bands of genotyping of the 3 SNPs, the optimal annealing temperatures were finalized at 65°C for TADA2A and URB1, and 62°C for PORL1B. For optimization of the primer concentration, the outer/inner primer concentration ratios were 1:2 for TADA2A, and 1:5 for POLR1B and URB1. To verify the accuracy of the developed T-ARMS PCR method in porcine samples, PCR products associated with TADA2A, POLR1B, and URB1 genotypes were purified by ethanol precipitation ⁶ and were sequenced by the Sanger method (Table 2; Genlab, Vietnam).

After optimization of the T-ARMS PCR protocol, we proceeded to genotype porcine samples. Because we could not collect the embryos for DNA extraction, we chose 40 purebred pigs (20 Landrace, 20 Duroc), which were reared and selected from the Binh Duong Pig Farm, Binh Duong Province, Vietnam. Collected blood samples were used only for routine testing purposes of the breeding programs and not specifically for our project. Therefore, approval by an ethics committee was not required. Sample collection and data recording were conducted strictly according to the Vietnamese law on animal protection and welfare. All chosen pigs were healthy and unrelated. Animals were reared in groups of 12–14 individuals under a closed-housing system, with an ambient temperature of 28–30°C and relative humidity of 60–70%. Blood samples were aseptically collected from the jugular vein of the animals as described previously ¹⁸ and stored at −20°C until use.

Genomic DNA was extracted from the 40 blood samples (GeneJet whole blood genomic DNA purification kit; ThermoFisher) according to the manufacturer’s directions. The integrity of extracted DNA was analyzed by agarose electrophoresis, and the concentration of the DNA was determined (Nanodrop 2000 spectrophotometer; Thermo). Samples with a 260:280 ratio of 1.8–2 were diluted to a final concentration of 50 ng/µL and were used for PCR amplification.

As expected, our T-ARMS PCR assays generated different amplicon patterns on the agarose gels that distinguished wild-type and heterozygous genotypes for each gene. The sizes of each amplicon on the gel were easily identified and agreed with our projection (Fig. 1). Sanger sequencing also showed concordance with our T-ARMS PCR results, indicating that the genotyping result from our T-ARMS PCR assay is reliable ( Fig. 3 ). The frequencies of mutant alleles of PORL1B and URB1 in the Landrace breed and TADA2A in the Duroc breed were 75%, 65%, and 35%, respectively ( Table 3 ). Our frequency data were higher than those of a previous study, possibly because of the smaller number of samples in our study (40) than in the previous study (39,000). ⁴

Figure 3.

Sanger sequencing chromatograms showing polymorphisms in the TADA2A, POLR1B, and URB1 genes. A. TADA2A gene chromatograms displaying the homozygous GG genotype (left) and heterozygous GA genotype (right). B. POLR1B gene chromatograms illustrating the homozygous TT genotype (left) and heterozygous TG genotype (right). C. URB1 gene chromatograms depicting the homozygous CC genotype (left) and the heterozygous C/– genotype (right). Colored peaks correspond to specific nucleotides: adenine (green), cytosine (blue), guanine (black), and thymine (red). Heterozygous positions are indicated by overlapping peaks or double signals, confirming the presence of single-nucleotide polymorphisms or indels at the analyzed loci.

Table 3.

Genetic and allele frequencies of 3 genes in Landrace and Duroc pig breeds.

Gene	Breed	n	Genotype frequency (n)			Allele frequency
PORL1B	Landrace		TT	TG	GG
	Boars	10	0.9 (9)	0.1 (1)	NA	0.9	0.1
	Sows	10	0.6 (6)	0.4 (4)	NA	0.6	0.4
	Total	20				0.75	0.25
URB1	Landrace		CC	C/–	–/–
	Boars	10	0.8 (8)	0.2 (2)	NA	0.8	0.2
	Sows	10	0.5 (5)	0.5 (5)	NA	0.5	0.5
	Total	20				0.65	0.35
TADA2A	Duroc		GG	GA	AA
	Boars	10	0.2 (2)	0.8 (8)	NA	0.2	0.8
	Sows	10	0.5 (5)	0.5 (5)	NA	0.5	0.5
	Total	20				0.35	0.65

NA = these genotypes are embryonic lethal, and we could not collect the embryos.