Abstract
Objective
This study aimed to investigate whether the NLRP3 inflammasome modulates the Th17/Treg cell balance in experimental autoimmune myocarditis (EAM).
Methods
BALB/c mice were immunized subcutaneously with purified cardiac myosin heavy chain-α to induce EAM, injected NLRP3 inhibitor (MCC950) or PBS into the EAM mice by intraperitoneal injection. Splenic CD4+ T cells were isolated for in vitro culture. Myocardial inflammation was evaluated by HE staining. Th17/Treg ratios were analyzed by flow cytometry in cardiac tissue and cultured cells. RORγt and Foxp3 mRNA expression was measured by RT-PCR and IL-17/IL-10 levels by ELISA.
Results
Our study demonstrates that NLRP3 inhibition significantly attenuates myocardial inflammatory cell infiltration and preserves cardiac architecture in EAM mice. The EAM group exhibited significantly increased Th17/Treg ratios and RORγt mRNA expression in myocardial tissue compared to both MCC950-treated and control groups while demonstrating markedly decreased Foxp3 mRNA levels. In vitro experiments using cultured CD4+ T cells revealed substantially higher Th17 cell proportions, RORγt expression, and IL-17 secretion in the EAM group versus MCC950-treated cells, accompanied by significantly reduced Treg cell frequencies, Foxp3 mRNA levels, and IL-10 production.
Conclusion
During the pathogenesis of experimental autoimmune myocarditis (EAM), the NLRP3 inflammasome promotes Th17 cell differentiation while suppressing Treg cell development. Inhibition of the NLRP3 inflammasome restores the Th17/Treg balance and mitigates myocardial injury. These findings suggest that the NLRP3 inflammasome is a critical signaling hub in modulating immune responses in EAM. Targeting NLRP3 may represent a novel immunotherapeutic strategy for myocarditis.
Keywords: Autoimmune myocarditis, NLRP3 inflammasome, Th17, Treg, Balance
Highlights
-
•
NLRP3 inhibition reduces myocardial inflammation and preserves cardiac structure in EAM mice model.
-
•
NLRP3 blockade restores Th17/Treg balance, enhancing Treg cells in EAM mice.
-
•
NLRP3 inhibition modulates ROR-γt/Foxp3, shifting T cell differentiation to Tregs.
-
•
Targeting NLRP3 inflammasome offers novel immunotherapeutic strategy for myocarditis.
1. Introduction
Myocarditis, an inflammatory cardiomyopathy induced by infectious or non-infectious factors, represents a leading cause of sudden cardiac death in adolescents, with viral infections being the most prevalent etiology [1,2]. Even after viral clearance, disease progression often continues due to autoimmune responses. Autoimmune myocarditis, the second phase of post-viral myocarditis, leads to dilated cardiomyopathy (DCM) and chronic heart failure in up to 20 % of patients [3]. Experimental autoimmune myocarditis (EAM) is a widely used animal model for studying autoimmune myocarditis, as it mimics the pathological features of the second phase of viral myocarditis while eliminating potential viral RNA interference. Growing evidence indicates that Th17 cells, rather than Th1 cells, serve as key mediators in various inflammatory and autoimmune diseases, including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), psoriasis, and inflammatory bowel disease [[4], [5], [6]]. In contrast to Th17 cells, Treg cells maintain immune homeostasis and promote tissue repair following inflammatory responses. The Th17/Treg balance plays a pivotal role in immune regulation, particularly in cardiac pathology. Therapeutic strategies targeting this imbalance by suppressing Th17 cell differentiation while enhancing Treg cell development may offer novel interventions for autoimmune-mediated diseases.
The NLRP3 inflammasome is a cytoplasmic multiprotein complex involved in innate immune responses. Emerging evidence demonstrates its pivotal role as a molecular mediator in regulating Th17/Treg balance across various immune disorders, including arthritis and autoimmune prostatitis [[7], [8], [9]]. The NLRP3 inflammasome detects cellular damage through damage-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs), initiating a signaling cascade to exert its biological effects. Upon activation by pattern recognition receptors (PRRs) and secondary signals (e.g., LPS or pathogenic microorganisms), NLRP3 oligomerizes and recruits downstream components. This leads to the cleavage of pro-caspase-1 into its active form, which subsequently processes IL-1β and IL-18 into their mature forms. These cytokines are then released through pores formed by the cytoplasmic protein gasdermin D (GSDMD), simultaneously mediating pyroptosis. [10,11]. Recent studies reveal that NLRP3 inflammasome activation promotes sterile myocardial inflammation in cardiometabolic diseases like atherosclerosis and cardiomyopathy by amplifying immune responses [12]. Importantly, NLRP3-mediated IL-1 signaling critically regulates early Th17 stabilization and Treg-to-Th17 conversion. [10,13,14]. Furthermore, the NLRP3 inflammasome modulates Treg cell stability by regulating their apoptotic process. [15,16]. Studies demonstrate concurrent NLRP3 inflammasome activation and Th17 cell elevation in EAM, with Spearman correlation analysis confirming their close association in viral myocarditis (VMC) [17,18]. Experimental studies confirm NLRP3 inflammasome activation in both EAM and VMC. Mechanistically, viral RNA triggers TLR3/TLR4-mediated NF-kB signaling to upregulate NLRP3 and pro-IL-1β expression, while mitochondrial dysfunction promotes calpain-1 activation and ROS accumulation, collectively activating the NLRP3 inflammasome. [[19], [20], [21]]. However, whether activated NLRP3 inflammasome directly induces myocardial inflammation by disrupting Th17/Treg balance in EAM remains unclear. As IL-1β bridges innate and adaptive immunity, the regulatory role of its upstream activator NLRP3 in Th17/Treg differentiation during EAM requires further investigation.
In this study, we established an EAM mouse model by immunizing mice with purified cardiac myosin heavy chain-α (MyHC-α614-629) emulsified in complete Freund's adjuvant [22]. We investigated NLRP3 inflammasome's regulatory role in Th17/Treg balance by comparing MCC950-treated mice (a specific NLRP3 inhibitor) with EAM controls through comprehensive assessments of myocardial inflammation severity, Th17/Treg cell ratios, and expression levels of their characteristic transcription factors RORγt and Foxp3.
2. Materials and methods
2.1. Experimental animals
Male BALB/c mice (4–6 weeks old) were obtained from Charles River Laboratory Animal Technology Limited (Beijing, China). All experimental procedures were conducted in strict accordance with the protocols approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Guangxi Medical University, China (No:202006030), and were performed following the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals.
2.2. Groups
To induce experimental autoimmune myocarditis (EAM), BALB/c mice received subcutaneous injections of 200 μl MyHC-ɑ614-629 (1 g/ml) emulsified 1:1 with complete Freund's adjuvant (CFA) on days 0 and 7 (day 0 = initial immunization). Control mice were injected with PBS instead. For NLRP3 inflammasome inhibition, mice were intraperitoneally administered MyHC-ɑ614-629 alongside MCC950 (10 mg/kg) immunization. All mice were randomly assigned to 14-day or 21-day observation groups.
2.3. Histological analysis
Cardiac tissues were fixed in 10 % phosphate-buffered formalin, paraffin-embedded, and sectioned at 5 μm thickness. Sections were stained with hematoxylin and eosin (H&E) following standard protocols. Histopathological evaluation was performed using light microscopy (400 × magnification).
2.4. Myocardial and splenic tissues mononuclear cell preparation
The harvested hearts and spleens were immediately placed in cold PBS, minced, and digested with 0.1 % collagenase II (Sigma-Aldrich, St. Louis, MO, USA) at 37 °C for 30 min. The tissue homogenate was filtered through a nylon mesh to obtain single-cell suspensions, followed by red blood cell lysis. After PBS washing, cells were resuspended in RPMI 1640 (1.0 × 106 cells/mL) and viability was assessed using eFluor 780 (eBioscience, San Diego, CA, USA).
2.5. Flow cytometric analysis
Cardiac single-cell suspensions were prepared as described above. Cells were incubated with fluorescently labeled monoclonal antibodies at 4 °C for 30 min in the dark, fixed and permeabilized following the manufacturer's instructions (BD Biosciences, San Diego, CA, USA). Simultaneously, Isotype control antibodies (eBioscience, San Diego, CA, USA) were used to account for nonspecific antibody binding and minimize background staining. The following antibodies were added: mouse anti-CD4 FITC-conjugated mAbs, anti-CD4 APC-Cyanine 7-conjugated mAbs, anti-CD25 FITC-conjugated mAbs, anti-IL-17 PE-A-conjugated mAbs and anti-Foxp3 APC-conjugated mAbs (all eBioscience, San Diego, CA, USA). Following a final wash, samples were analyzed on a BD FACSCanto II flow cytometer (BD Biosciences) and were analyzed using FlowJo 7.6 software.
2.6. RT-qPCR
Total RNA was extracted from cardiac tissues and cells using TRIzol® (Invitrogen) followed by cDNA synthesis with a reverse transcription kit. RT-qPCR was performed on an ABI 7500 system using TB Green® Premix EX Taq™ II (TaKaRa, Japan) with the following conditions: pre-denaturation at 95 °C for 30 s, 40 cycles of 95 °C for 5 s, 55 °C for 30 s, and 72 °C for 30 s. All primers were designed as follows: GAPDH (forward: 5′- TGTGTCCGTCGTGGATCTGA -3′, reverse: 5′- TTGCTGTTGAAGTCGCAGGAG -3′), RORγt (forward: 5′- TCTGCAAG ACTCATCGACAAGG -3′, reverse:5′- CACATGTTGGCTGCACAGG -3′), Foxp3 (forward: 5′- CACCCAGGAAAGACAGCAACC-3′, reverse: 5′- GCA AGAGCTCTTGTCCATTGA-3′) (all Sangon Biotech, Shanghai). GAPDH was used as the internal reference gene, and relative gene expression was calculated using the 2-ΔΔCT method.
2.7. Cell culture and grouping
Mice from the EAM and MCC950 groups were sacrificed at day 21, and splenic single-cell suspensions were prepared as described in section 2.4. Naive CD4+ T cells were isolated using the specific naive CD4+ T cell isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany)and cultured in 24-well plates at 1 × 106 cells/well in complete DMEM medium supplemented with 10 % FBS and 1 % penicillin-streptomycin. The cells were divided into four experimental groups: Th17-polarized EAM group, Th17-polarized MCC950 group, Treg-polarized EAM group, and Treg-polarized MCC950 group. All cells were stimulated with anti-CD3 (5 μg/mL) and anti-CD28 (2 μg/mL). The 24-well plate was divided into four experimental groups and cultured with their respective polarization factors. The differentiation conditions were as follows: Th17:IL-2 (10 ng/m L)、IL - 1 β (10 ng/m L)、IL - 6 (20 ng/m L)、IL - 23 (20 ng/m L)、TGF - β (2 ng/m L)、Anti -IL - 4 mAb (10 μg/m L)、Anti –IFN - γ mAb (10 μg/m L); Treg:TGF - β1 (3 ng/ml) and IL - 2 (2 ng/ml) (all eBioscience, San Diego, CA, USA). The cells were cultured at 37 °C with 5 % CO2 for 5 days before analysis.
2.8. ELISA
The protein levels of IL-17 and IL-10 in cell culture supernatants were quantified using enzyme-linked immunosorbent assay (ELISA) with specific antibodies (eBioscience, USA). Samples' absorbance readings were taken at 450 nm following the manufacturer's protocol. Protein concentrations were determined by extrapolation from standard curves.
2.9. Statistical analysis
Data were analyzed using GraphPad Prism 9.0 software. All data are presented as mean ± standard deviation (SD). Comparisons between two groups were performed using the student's t-test, while one-way ANOVA was used to compare the three groups, followed by Tukey's post hoc test for pairwise analysis. A p-value <0.05 was defined as statistically significant.
3. Results
3.1. NLRP3 inflammasome inhibition attenuates EAM progression
HE staining of myocardial sections revealed a time-dependent progression of pathology in EAM mice. Initial focal inflammation in subepicardial and perivascular areas was evident at day 14, which progressed to widespread infiltration, necrosis, and structural damage by day 21 (Fig. 1). In MCC950-treated mice, the onset of early inflammation was prevented, and late-stage infiltration was significantly mitigated, with myocardial structure largely maintained at both time points (Fig. 1). These results demonstrate that NLRP3 inflammasome inhibition alleviates EAM-induced myocardial injury.
Fig. 1.
Inhibition of the NLRP3 inflammasome effectively suppresses myocardial inflammatory cell infiltration and cardiac injury. HE-stained sections of different groups at weeks 2 and 3. All sections are from myocardial tissue, magnification 400×.
3.2. NLRP3 inflammasome inhibition ameliorates Th17/Treg imbalance in EAM
We next analyzed Th17 and Treg populations in mouse hearts by flow cytometry. On day 14, EAM mice exhibited a significant Th17/Treg imbalance compared to controls, characterized by an increased Th17 cell frequency (P < 0.05) and a decreased Treg proportion (P < 0.05; Fig. 2a and b). This dysregulation persisted through day 21 (P < 0.05; Fig. 2c and d). Longitudinal analysis revealed that MCC950 treatment induced a trend toward reduced Th17 cells (P < 0.05) and a significant increase in Tregs (P < 0.01; Fig. 2e). Collectively, these data demonstrate that NLRP3 inflammasome inhibition rectifies the Th17/Treg imbalance in EAM by suppressing Th17 and promoting Treg expansion.
Fig. 2.
Th17/Treg cell imbalance in the EAM mouse model is alleviated by NLRP3 inflammasome inhibition, reducing Th17 levels and increasing Treg cell numbers. (a) Flow cytometry plots identifying Th17 and Treg populations at day 14; (b) Bar graphs quantifying Th17 and Treg frequencies at day 14; (c) Flow cytometry plots identifying Th17 and Treg populations at day 21; (b) Bar graphs quantifying Th17 and Treg frequencies at day 21; (e) Comparison of Th17 and Treg cell proportions across groups at both time points. Data are presented as mean ± SD, n = 10. NS indicates no statistical significance; ∗p < 0.05, ∗∗p < 0.01.
3.3. NLRP3 inflammasome regulates transcription factors for Th17/Treg cells
We next analyzed the dynamics of Th17/Treg cell-specific transcription factors. Compared to controls, RORγt mRNA levels were significantly elevated in EAM mice at both day 14 and day 21 (P < 0.05), an increase that was suppressed by MCC950 treatment (Fig. 3a and b). In contrast, Foxp3 mRNA expression in the EAM group was elevated at day 14 but returned to baseline by day 21. MCC950 treatment not only enhanced Foxp3 expression at day 14 but also sustained its high expression at day 21 (Fig. P < 0.05; 3a-b). Dynamic profiling from day 14–21 revealed a trajectory of increasing RORγt and declining Foxp3 in the EAM group, whereas the MCC950 group maintained near-normal RORγt and sustained high Foxp3 levels (Fig. 3c). These results demonstrate that the NLRP3 inflammasome influences the expression of these lineage-defining transcription factors.
Fig. 3.
Effects of NLRP3 inflammasome inhibition on Th17/Treg cell-specific transcription factors. (a) Expression levels of ROR-γt mRNA and Foxp3 mRNA in the 14-day subgroup; (b) Expression levels of ROR-γt mRNA and Foxp3 mRNA in the 21-day subgroup across different groups; (c) Comparison of ROR-γt mRNA and Foxp3 mRNA expression levels across groups at both time points. Data are presented as mean ± SD, n = 10. NS indicates no statistical significance; ∗p < 0.05, ∗∗p < 0.01.
3.4. NLRP3 inflammasome polarizes naive CD4+ T cells toward Th17 lineage
Considering that the EAM disease environment may shape the intrinsic characteristics of immature CD4+ T cells, we directly performed in vitro polarization using naive CD4+ T cells isolated from EAM and MCC950-treated mice. After 5-day culture, MCC950-treated cells showed significantly lower Th17 frequencies (p < 0.01) and higher Treg proportions (p < 0.01) compared to EAM controls (Fig. 4a and b). Functional assessment revealed a concurrent shift in the cytokine milieu, with lower IL-17 (p < 0.01) and higher IL-10 levels in the MCC950 group (Fig. 4c). At the transcriptional level, MCC950 treatment significantly downregulated RORγt and upregulated Foxp3 mRNA (p < 0.01 for both; Fig. 4d), consistent with in vivo findings. These results demonstrate that the NLRP3 inflammasome intrinsically regulates the Th17/Treg lineage choice in naive CD4+ T cells. MCC950 treatment appears to interrupt the reprogramming that confers a heightened propensity for Th17 differentiation.
Fig. 4.
Inhibition of NLRP3 shifted the differentiation of naïve CD4+ T cells toward a Treg phenotype in vitro. (a) Flow cytometry plots identifying Th17 and Treg populations in EAM versus MCC950-treated groups; (b) Bar graphs quantifying Th17 and Treg frequencies in EAM versus MCC950-treated groups; (c) Secreted IL-17 and IL-10 protein levels in culture supernatants; (d) RORγt and Foxp3 mRNA expression levels. Data are presented as mean ± SD, n = 3. NS indicates no statistical significance; ∗p < 0.05, ∗∗p < 0.01.
4. Discussion
Our data indicate that the NLRP3 inflammasome modulates the Th17/Treg balance during EAM progression, influencing their specific transcription factors and cytokines.
In autoimmune diseases, the NLRP3 inflammasome acts as a key intermediary in regulating the Th17/Treg balance. The inflammasome promotes inflammatory cell infiltration, primarily mediated by its downstream product IL-1β, which recruits inflammatory cells [23,24]. In viral myocarditis, NLRP3-derived IL-1β promotes the proliferation of autoreactive effector T cells and enhances Th17 differentiation via the precursor IL-1β activation [18]. Furthermore, exogenous IL-1β supplementation has been shown to impair the function and thymic development of FoxP3+Tregs, thereby suppressing both their population and suppressive activity [25,26]. Our data demonstrate that direct NLRP3 inflammasome inhibition not only significantly attenuated inflammatory cell infiltration in the myocardium but also preserved cardiac structural integrity during the acute phase (weeks 2–3) of EAM. To further explore the mechanism, we assessed the Th17/Treg balance following NLRP3 inhibition during EAM progression. The treatment effectively corrected the Th17/Treg imbalance by reducing myocardial Th17 cell infiltration and elevating Treg cell levels, with the most pronounced effect observed at week three. This shift facilitated the progressive restoration of balance, as Th17 cells declined and Treg cells expanded over time. Thus, the NLRP3 inflammasome contributes to the Th17/Treg imbalance in EAM and may influence myocardial repair and remodeling.
Th17 and Treg cells regulate immune and inflammatory responses through antigen-dependent activation and cytokine-driven differentiation [5,[27], [28], [29]]. The polarization of naive CD4+ T cells depends on TCR signals and lineage-specific cytokines, and is transcriptionally regulated by the key factors RORγt (Th17) and Foxp3 (Treg), which have antagonistic effects on differentiation [[30], [31], [32]]. To determine the NLRP3 inflammasome's impact on Th17/Treg differentiation, we quantified the mRNA levels of the key transcription factors RORγt and Foxp3. Although initially activated, their expression patterns diverged during disease progression (RORγt increased, Foxp3 decreased). MCC950 treatment inhibited RORγt mRNA to a healthy level and enhanced Foxp3 expression, thereby restoring the Th17/Treg balance. While prior work has explored the NLRP3 inflammasome's influence on RORγt/Foxp3 in conditions like asthma [9]—including its role in impairing Foxp3 activity via Kpna2 and reducing Tregs [33]—its function in EAM was not defined. Our research uncovers a differential regulatory effect of the NLRP3 inflammasome on the decisive transcription factors of the Th17 and Treg lineages in EAM.
Despite sharing a common CD4+ T cell precursor and core signaling pathways, Th17 and Treg cells retain developmental plasticity, allowing for their dependent interconversion in response to specific inflammatory microenvironmental cues [29,34]. Naive CD4+ T cells were isolated from the spleens of EAM and MCC950-treated mice to assess the impact of NLRP3 inhibition. We found that NLRP3 inflammasome activity influences the differentiation fate of these precursors and their cytokine profiles. Under identical polarization conditions, naive CD4+ T cells from the MCC950-treated group exhibited a bias toward Treg differentiation, with a significantly higher level of IL-10 than IL-17. Accordingly, the expression of key transcription factors shifted toward a profile of high Foxp3 and low RORγt compared to the EAM control group. While most previous studies on myocarditis have ascribed NLRP3 functions to innate immune cells like macrophages, its impact on T cells has hitherto been considered an indirect effect mediated by cytokines. In experimental autoimmune prostatitis, the NLRP3 inflammasome disrupts the Th17/Treg balance primarily by promoting the conversion of intermediate 17+Treg cells into Th17 cells, a process mediated via IL-1β-dependent STAT3 phosphorylation [8]. Our experiment indicates that NLRP3 inflammasome activation can reprogram T cells in vivo, conferring a predisposition for Th17 differentiation. Our study is the first to identify naive CD4+ T cells as a direct cellular target of the NLRP3 inflammasome in myocarditis, thereby shifting the mechanistic paradigm from an indirect role mediated by innate immune cells to a direct intrinsic regulation within the adaptive immune system. Nevertheless, the mechanisms sustaining this reactive state and the potential involvement of epigenetic regulation in genes such as Rorc, Il17a, and Foxp3 remain to be elucidated.
Several limitations should be considered. While our findings provide strong indirect evidence of on-target effects for the NLRP3 inflammasome inhibitor, definitive confirmation requires direct measurement of downstream outputs, such as caspase-1 activation and mature IL-1β levels, to fully elucidate the specific activation mechanism of NLRP3 in this model and the molecular efficacy of the inhibitor. Furthermore, future work incorporating functional hemodynamic measurements would help to correlate the observed cellular and structural improvements with actual cardiac performance. Future studies should build upon these findings to further evaluate the impact of this therapeutic strategy on cardiac contractility and long-term prognosis.
5. Conclusion
In summary, our work identifies the NLRP3 inflammasome as a key driver of Th17/Treg imbalance and immune pathology in EAM. These results underscore the therapeutic potential of NLRP3 inhibition in recalibrating the immune response, offering tangible translational promise for the clinical management of autoimmune myocarditis.
Statement
This article was translated with the assistance of DeepSeek.
Funding
This research was funded by the Natural Science Foundation of Guangxi Province, China (2020JJB140049 and 2022JJA140143).
CRediT authorship contribution statement
Lijun Su: Data curation, Investigation, Visualization, Writing – original draft. Nan Qu: Formal analysis, Investigation, Visualization. Lili Chen: Data curation, Formal analysis, Investigation, Visualization. Yuying Lin: Data curation, Investigation. Huiwen Mo: Data curation, Investigation. Yanlan Huang: Funding acquisition, Methodology, Project administration, Supervision, Writing – review & editing.
Declaration of competing interest
The authors have no relevant financial or non-financial interests to disclose.
Data availability
Data will be made available on request.
References
- 1.Tschöpe C., Ammirati E., Bozkurt B., Caforio A.L.P., Cooper L.T., Felix S.B., Hare J.M., Heidecker B., Heymans S., Hübner N., Kelle S., Klingel K., Maatz H., Parwani A.S., Spillmann F., Starling R.C., Tsutsui H., Seferovic P., Van Linthout S. Myocarditis and inflammatory cardiomyopathy: current evidence and future directions. Nat. Rev. Cardiol. 2021 doi: 10.1038/s41569-020-00435-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lasrado N., Reddy J. An overview of the immune mechanisms of viral myocarditis. Rev. Med. Virol. 2020 doi: 10.1002/rmv.2131. [DOI] [PubMed] [Google Scholar]
- 3.Zhang Y., Zhou X., Chen S., Sun X., Zhou C. Immune mechanisms of group B coxsackievirus induced viral myocarditis. Virulence. 2023 doi: 10.1080/21505594.2023.2180951. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Berry S.P.D., Dossou C., Kashif A., Sharifinejad N., Azizi G., Hamedifar H., Sabzvari A., Zian Z. The role of IL-17 and anti-IL-17 agents in the immunopathogenesis and management of autoimmune and inflammatory diseases. Int. Immunopharmacol. 2022 doi: 10.1016/j.intimp.2021.108402. [DOI] [PubMed] [Google Scholar]
- 5.Yasuda K., Takeuchi Y., Hirota K. The pathogenicity of Th17 cells in autoimmune diseases. Semin. Immunopathol. 2019 doi: 10.1007/s00281-019-00733-8. [DOI] [PubMed] [Google Scholar]
- 6.Zhu S., Qian Y. IL-17/IL-17 receptor system in autoimmune disease: mechanisms and therapeutic potential. Clin. Sci. (Lond.) 2012 doi: 10.1042/cs20110496. [DOI] [PubMed] [Google Scholar]
- 7.Pan Y., Wu Y., Liu Y., Wang P., Huang H., Jin J., Fang Y., Huang S., Fan Z., Yu H. Immunologic Research; 2024. Long Non-coding RNA ENSMUST00000197208 Promotes a Shift in the Th17/Treg Ratio via the P2X7R-NLRP3 Inflammasome Axis in collagen-induced Arthritis. [DOI] [PubMed] [Google Scholar]
- 8.Liu X., Chen J., Yue S., Zhang C., Song J., Liang H., Liang C., Chen X. NLRP3-mediated IL-1β in regulating the imbalance between Th17 and Treg in experimental autoimmune prostatitis. Sci. Rep. 2024 doi: 10.1038/s41598-024-69512-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chen L., Hou W., Liu F., Zhu R., Lv A., Quan W., Mao S. Blockade of NLRP3/Caspase-1/IL-1β regulated Th17/Treg immune imbalance and attenuated the neutrophilic airway inflammation in an ovalbumin-induced murine model of asthma. J. Immunol. Res. 2022 doi: 10.1155/2022/9444227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Evavold C.L., Kagan J.C. How inflammasomes inform adaptive immunity. J. Mol. Biol. 2018 doi: 10.1016/j.jmb.2017.09.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fu J., Wu H. Structural mechanisms of NLRP3 inflammasome assembly and activation. Annu. Rev. Immunol. 2023 doi: 10.1146/annurev-immunol-081022-021207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cho S., Ying F., Sweeney G. Sterile inflammation and the NLRP3 inflammasome in cardiometabolic disease. Biomed. J. 2023 doi: 10.1016/j.bj.2023.100624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Chung Y., Chang S.H., Martinez G.J., Yang X.O., Nurieva R., Kang H.S., Ma L., Watowich S.S., Jetten A.M., Tian Q., Dong C. Critical regulation of early Th17 cell differentiation by interleukin-1 signaling. Immunity. 2009 doi: 10.1016/j.immuni.2009.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Deng J., Yu X.Q., Wang P.H. Inflammasome activation and Th17 responses. Mol. Immunol. 2019 doi: 10.1016/j.molimm.2018.12.024. [DOI] [PubMed] [Google Scholar]
- 15.Chang L., Wu H., Huang W., Li Y., Chen Y., Li X., Yao Z., Chen X., Lai X., Zheng R., Huang Z., Wu X., Zhang G. IL-21 induces pyroptosis of Treg cells via Akt–mTOR–NLRP3–caspase 1 axis in eosinophilic chronic rhinosinusitis. J. Allergy Clin. Immunol. 2023 doi: 10.1016/j.jaci.2023.04.013. [DOI] [PubMed] [Google Scholar]
- 16.Wang K., Liu J., Yue J., Zhou L., Mao H., Li J., Sun Z., Chen Z., Zhang L. Nlrp3 inflammasome drives regulatory T cell depletion to accelerate periapical bone erosion. Int. Endod. J. 2024 doi: 10.1111/iej.14062. [DOI] [PubMed] [Google Scholar]
- 17.Liang W., Xie B.K., Ding P.W., Wang M., Yuan J., Cheng X., Liao Y.H., Yu M. Sacubitril/valsartan alleviates experimental autoimmune Myocarditis by inhibiting Th17 cell differentiation independently of the NLRP3 inflammasome pathway. Front. Pharmacol. 2021 doi: 10.3389/fphar.2021.727838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chen J., Yang F., Shi S., Liu X., Qin F., Wei X., Huang Y., Liang W., Miao L., Andrukhov O. The severity of CVB3-Induced myocarditis can be improved by blocking the orchestration of NLRP3 and Th17 in Balb/c mice. Mediat. Inflamm. 2021 doi: 10.1155/2021/5551578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Wang Y., Gao B., Xiong S. Involvement of NLRP3 inflammasome in CVB3-induced viral myocarditis. Am. J. Physiol. Heart Circ. Physiol. 2014 doi: 10.1152/ajpheart.00441.2014. [DOI] [PubMed] [Google Scholar]
- 20.Bao J., Sun T., Yue Y., Xiong S. Macrophage NLRP3 inflammasome activated by CVB3 capsid proteins contributes to the development of viral myocarditis. Mol. Immunol. 2019 doi: 10.1016/j.molimm.2019.07.012. [DOI] [PubMed] [Google Scholar]
- 21.Liu X., Li M., Chen Z., Yu Y., Shi H., Yu Y., Wang Y., Chen R., Ge J. Mitochondrial calpain-1 activates NLRP3 inflammasome by cleaving ATP5A1 and inducing mitochondrial ROS in CVB3-induced myocarditis. Basic Res. Cardiol. 2022 doi: 10.1007/s00395-022-00948-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Massilamany C., Gangaplara A., Steffen D., Reddy J. Identification of novel mimicry epitopes for cardiac myosin heavy chain-α that induce autoimmune myocarditis in A/J mice. Cell. Immunol. 2011 doi: 10.1016/j.cellimm.2011.08.013. [DOI] [PubMed] [Google Scholar]
- 23.Payne F.M., Dabb A.R., Harrison J.C., Sammut I.A. Inhibitors of NLRP3 inflammasome formation: a cardioprotective role for the gasotransmitters carbon monoxide, nitric oxide, and hydrogen sulphide in acute myocardial infarction. Int. J. Mol. Sci. 2024 doi: 10.3390/ijms25179247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kawaguchi M., Takahashi M., Hata T., Kashima Y., Usui F., Morimoto H., Izawa A., Takahashi Y., Masumoto J., Koyama J., Hongo M., Noda T., Nakayama J., Sagara J., Taniguchi S., Ikeda U. Inflammasome activation of cardiac fibroblasts is essential for myocardial ischemia/reperfusion injury. Circulation. 2011 doi: 10.1161/circulationaha.110.982777. [DOI] [PubMed] [Google Scholar]
- 25.Nikolouli E., Elfaki Y., Herppich S., Schelmbauer C., Delacher M., Falk C., Mufazalov I.A., Waisman A., Feuerer M., Huehn J. Recirculating IL-1R2+ tregs fine-tune intrathymic treg development under inflammatory conditions. Cell. Mol. Immunol. 2021 doi: 10.1038/s41423-019-0352-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.O'Sullivan B.J., Thomas H.E., Pai S., Santamaria P., Iwakura Y., Steptoe R.J., Kay T.W., Thomas R. IL-1 beta breaks tolerance through expansion of CD25+ effector T cells. J. Immunol. 2006 doi: 10.4049/jimmunol.176.12.7278. [DOI] [PubMed] [Google Scholar]
- 27.Stockinger B., Veldhoen M., Martin B. Th17 T cells: linking innate and adaptive immunity. Semin. Immunol. 2007 doi: 10.1016/j.smim.2007.10.008. [DOI] [PubMed] [Google Scholar]
- 28.Veldhoen M., Hocking R.J., Atkins C.J., Locksley R.M., Stockinger B. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 2006 doi: 10.1016/j.immuni.2006.01.001. [DOI] [PubMed] [Google Scholar]
- 29.Bettelli E., Carrier Y., Gao W., Korn T., Strom T.B., Oukka M., Weiner H.L., Kuchroo V.K. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006 doi: 10.1038/nature04753. [DOI] [PubMed] [Google Scholar]
- 30.Yamane H., Paul W.E. Early signaling events that underlie fate decisions of naive CD4(+) T cells toward distinct T-helper cell subsets. Immunol. Rev. 2013 doi: 10.1111/imr.12032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zhu X., Zhu J. CD4 T helper cell subsets and related human immunological disorders. Int. J. Mol. Sci. 2020 doi: 10.3390/ijms21218011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Tosiek M.J., Fiette L., El Daker S., Eberl G., Freitas A.A. IL-15-dependent balance between Foxp3 and RORγt expression impacts inflammatory bowel disease. Nat. Commun. 2016 doi: 10.1038/ncomms10888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Park S.-H., Ham S., Lee A., Möller A., Kim T.S. NLRP3 negatively regulates Treg differentiation through Kpna2-mediated nuclear translocation. J. Biol. Chem. 2019 doi: 10.1074/jbc.RA119.010545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhou L., Lopes J.E., Chong M.M., Ivanov I.I., Min R., Victora G.D., Shen Y., Du J., Rubtsov Y.P., Rudensky A.Y., Ziegler S.F., Littman D.R. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature. 2008 doi: 10.1038/nature06878. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on request.




