Skip to main content
NCBI home page
Fundamental Research logoLink to Fundamental Research
. 2023 May 15;5(5):2025–2033. doi: 10.1016/j.fmre.2023.04.011

Detection of antibiotic-resistance genes in bacterial pathogens using a Cas12a/3D DNAzyme colorimetric paper sensor

Hua Gao a,b,1, Yanan Li a,1, Yaqiong Li a, Ke Qu d,⁎, Kaixiang Zhang a,⁎, Jinghong Li c
PMCID: PMC12848165  PMID: 41613445

Abstract

The rapid detection of antibiotic-resistant genes in bacterial pathogens is critical in combating global health crises. Herein, we report a CRISPR/Cas12a-based colorimetric paper sensor, where the trans-cleavage activity of Cas12a was post-amplified by rolling circle replication, resulting in the generation of a 3D DNAzyme. The 3D DNAzyme adhered strongly to the paper surface, creating a highly bioactive paper sensor containing high densities of functional DNAzymes. This assay was effective for the rapid detection of the antibiotic-resistant gene, NDM-1, with high sensitivity. In the absence of the NDM-1 gene, the 3D DNAzyme catalyzed a colorimetric reaction, resulting in a blue-colored signal while in the presence of NDM-1, collateral cleavage activity of Cas12a was activated, leading to cleavage of the circle template, thus preventing the generation of the 3D DNAzyme and producing no colorimetric signal. This paper sensor provides rapid and low-cost detection of antibiotic-resistant genes carried by various pathogenic microorganisms with femtomolar-level sensitivity and results that are visible to the naked eye. The entire analysis requires less than 90 minutes of assay time. Due to the highly programmable design of the CRISPR probe, the platform has significant potential for quick responses to new global epidemics.

Keywords: Paper sensor, CRISPR-Cas12a, Antibiotic susceptibility test, 3D DNAzyme, Rolling circle amplification

Graphical abstract

Image, graphical abstract

Open in a new tab

1. Introduction

The emergence of multidrug-resistant (MDR) bacteria seriously challenges current healthcare systems, highlighting the pressing need for the development of rapid and low-cost diagnostic platforms [1], [2], [3], [4]. Several genotypic antibiotic susceptibility tests (ASTs) have been recently developed for the rapid identification of genes associated with drug resistance. For example, assays for the detection of the mecA and mecC genes in methicillin-resistant Staphylococcus aureus (MRSA) have been approved by FDA [5], [6], [7]. Despite their potential benefits, these methods invariably use polymerase chain reaction (PCR) for the amplification of specific sequences, requiring both thermal cycler instruments and well-trained operators and thus limiting their diagnostic applications in resource-constrained developing countries [8], [9], [10].

Recent advances in CRISPR-based diagnostics provide promising and powerful tools for the construction of rapid, sensitive, and low-cost biosensing systems [[11], [12]]. For example, Cas12a derived from Lachnospiraceae bacteria (LbaCas12a) displays targeted double-stranded DNA (dsDNA) recognition and subsequent indiscriminate single-stranded DNA (ssDNA) hydrolysis activity (collateral cleavage) [13], [14], [15], [16], [17]. Once Cas12a binds to its dsDNA target, its collateral cleavage activity is activated, allowing it to cleave nearby ssDNA at a turnover rate of approximately 120 cleavages per second [[13], [18], [19], [20], [21]]. In combination with loop-mediated isothermal amplification (LAMP) [22] or recombinase polymerase amplification (RPA) [23], Cas12a has been used for the development of various biosensors, including fluorescence-based, lateral flow-based, and electrochemical-based assays [[19], [24], [25]]. Moreover, since the target recognition relies on complementary base pairing between the target dsDNA and the CRISPR RNA (crRNA) sequence, Cas12a-based detection can be highly programmable [26].

Rapid and cost-effective paper-based colorimetric readouts are preferred for point-of-care testing (POCT) diagnostics [27]. However, the paper itself does not contain intrinsic chemical or physical properties for the facile immobilization of nucleic acid probes, requiring further engineering to construct high-performance paper sensors [28]. In addition, there is great demand for the development of a sensitive detection platform for the analysis of antibiotic-resistant genes that requires only low DNA concentrations for actuation. When combined with lateral flow detection strategies, CRISPR-based paper sensors can utilize the intensity of biotin/FITC-labeled single-stranded reporter nucleotides for target detection and measurement [29], [30], [31]. Additionally, enzyme-catalyzed luminescent reactions based on CRISPR systems have been developed recently to improve the sensitivity of detection [[32], [33]].

In this study, a Cas12a/3D DNAzyme colorimetric paper sensor was developed for the rapid and high-sensitive detection of antibiotic-resistant genes in various pathogenic microorganisms. By using a highly bioactive paper sensor with a high density of functional DNAzyme sequences [[28], [34], [35]], the developed sensor was found to detect the presence of an important gene associated with antibiotic resistance, NDM-1, with remarkable sensitivity at the femtomolar level. The sensor is affordable, and the results are visible to the naked eye, making it a promising tool in the rapid response to new global epidemics [36], [37], [38], [39], [40].

The NDM-1 gene, which encodes a metallo-β-lactamase that can hydrolyze most β-lactam antibiotics [[41], [42]], was selected as a model system for the test. NDM-1 is one of the most significant genes associated with antibiotic resistance in bacteria, as it can lead to carbapenem resistance which has few treatment options and leads to high mortality rates [[43], [44]]. Therefore, the detection of the presence of the NDM-1 gene is essential for guiding the appropriate use of antimicrobials and the successful treatment of infected patients.

In the design of the paper sensor, a Cas12a/crRNA complex targeting the NDM-1 gene was utilized to trans-cleave the circle template, leading to the generation of 3D DNA nanostructures that encode a peroxidase-mimicking DNAzyme (3D DNAzyme). The 3D DNAzyme catalyzes the oxidation of 2, 2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) by H2O2, generating a blue colorimetric signal. The addition of material containing NDM-1 to the test zone of the paper sensor induces activation of Cas12a/crRNA and subsequent cleavage of the circle template of the 3D DNAzyme, resulting in no visible colorimetric signal. Conversely, if the analyte does not contain NDM-1, the 3D DNAzyme retains its peroxidase-mimicking activity, leading to the appearance of a visible colorimetric signal on the paper sensor (Scheme 1).

Scheme 1.

Scheme 1

Open in a new tab

Design of the Cas12a/3D DNAzyme paper sensor for the colorimetric detection of the NDM-1 gene in bacterial pathogens. The Cas12a/crRNA complex was specifically designed to target the NDM-1 gene. In the absence of NDM-1 gene, the circle template can be used for rolling circle amplification to generate a 3D DNA nanostructure encoding peroxidase-mimicking DNAzyme (3D DNAzyme), which can adhere strongly to the nitrocellulose paper in the test zone. The 3D DNAzyme can catalyze the oxidation of ABTS by H2O2, generating a blue colorimetric signal on the paper sensor, which can be monitored by the naked eye or a smartphone camera. In the presence of the NDM-1 gene, Cas12a/crRNA collateral cleavage activity is induced to cleave the circle template of the 3D DNAzyme, leading to the lack of an obvious colorimetric signal on the paper sensor.

2. Materials and methods

2.1. Materials

All oligonucleotides were purchased from Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). LbaCas12a (Cpf1), Taq DNA polymerase, exonuclease I (E. coli), exonuclease III (E. coli), T4 DNA ligase, T4 polynucleotide kinase, Phi29 DNA polymerase, the HiScribeTM T7 Quick High Yield RNA Synthesis Kit, and dNTP Mix were purchased from New England Biolabs (NEB; Ipswich, MA, USA). The TwistAmp Liquid Basic kit was purchased from TwistDx (Cambridge, UK) and 2, 2′-azinobis (3-ethylbenzothiozoline)-6-sulfonic acid (ABTS) was purchased from Sigma-Aldrich (St Louis, MO, USA). A NanoDrop 2000 UV–vis spectrophotometer (Thermo Fisher, Waltham, MA, USA) was used to measure nucleic acid concentrations, and Synergy H1 (BioTek, Winooski, VT, USA) was used to measure the absorbances of different test solutions.

2.2. Methods

2.2.1. Preparation of the DNA circle

A template-assisted ligation method with a 5ʹ-phosphorylated linear padlock probe, a ligation template, and T4 DNA ligase was used to prepare the DNA circle. Specifically, 200 pmol of the padlock probe and 200 pmol of the ligation template were mixed in 200 µL 1 × T4 DNA ligase buffer (40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 500 µM ATP, pH 7.8 at 25 °C). After heating at 90 °C for 5 min, the mixture was allowed to cool slowly to room temperature. Next, 10 U of T4 DNA ligase was added, and the resultant mixture was incubated at room temperature overnight. After heating at 65 °C for 20 min to denature the ligase, the ligated DNA circle was concentrated by ethanol precipitation and stored at -20 °C for subsequent experiments.

The DNA circles were analyzed by polyacrylamide gel electrophoresis in response to Cas12a trans cleavage activity. The specific reaction system involved the pre-assembly of the Cas12a/crRNA RNP complexes by incubation of 50 nM Cas12a with 75 nM crRNA in a solution containing 1 × reaction buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9) at 37 °C for 10 min. The reaction was initiated by the addition of 50 nM NDM-1 dsDNA and 1 µM DNA circle or Padlock in a 20 µL reaction volume. After incubating at 37 °C for 30 min, samples were analyzed using 12% polyacrylamide gels.

2.2.2. Preparation of the 3D DNAzyme

A 50 µL reaction volume containing 100 nM ligated DNA circle, 1 mM dNTP mix, 5 U Phi 29 DNA polymerase, and 100 nM Primer in 1 × Phi29 polymerase buffer (50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 0.1 mg/mL BSA, 1 mM DTT) was incubated at 37 °C for different times (30 min, 60 min, or 300 min) followed by heat inactivation at 95 °C for 5 min. Hemin was then added to the reaction at a final concentration of 5 µM and incubated for 1 h at room temperature. The 3D DNAzyme was then analyzed by agarose gel electrophoresis, transmission electron microscopy (TEM), scanning electron microscopy (SEM), and atomic force microscopy (AFM). The prepared 3D DNAzyme was stored at room temperature for subsequent experiments.

2.2.3. crRNA preparation

The crRNA was transcribed in vitro using a T7 transcription kit (HiScribeTM T7 Quick High Yield RNA Synthesis Kit). Briefly, transcription templates encoding the T7 promoter and crRNA sequence for the targeting of different sequences were prepared by PCR amplification. All the primers used in this study are listed in Table S3. The transcription reaction was performed at 37 °C overnight. The resultant crRNAs were purified by TRIzol and quantified using the NanoDrop UV–Vis spectrophotometer. The crRNAs were stored at -80 °C until further use.

2.2.4. Bacterial strains and Ethics statement

All the clinical carbapenem-resistant Escherichia coli isolates were recovered from a teaching hospital of Zhengzhou University, and this study was approved by the Ethics Review Committee of Life Sciences of Zhengzhou University (202001315). In accordance with the ethical principles outlined in the Declaration of Helsinki, all participants provided informed consent before participating in the study. The patient cohort was chosen due to their high vulnerability to infections and likelihood of benefiting from rapid diagnosis and appropriate antibiotic treatment. The samples and clinical isolates were generated as part of routine hospital laboratory procedures, including urine and blood. PCR and sequencing were performed to screen for the presence of blaNDM gene. The patient’s next of kin provided written, informed consent for details that were included in the manuscript.

2.2.5. Fabrication of the paper sensor

Nitrocellulose membranes and black waterproof paper were used to fabricate the paper sensor. First, the black waterproof paper was perforated with a series of equidistant 0.3-cm holes. Next, small squares of nitrocellulose membrane were placed on the back of the black paper, leaving most of the nitrocellulose membrane exposed. The resulting assembly was then attached to another waterproof paper. Finally, 1 µL of RCA products were added to the nitrocellulose membrane test zone to complete the fabrication process.

2.2.6. Recombinase polymerase amplification (RPA) reaction

The TwistAmp Liquid Basic kit was used to perform the RPA reactions. The applied primers were listed in Table S6. The concentrations of the forward and reverse primers were both 480 nM. The total reaction volume was 20 µL, containing a final concentration of 8 mM dNTP Mix and 14 mM magnesium acetate. All RPA reactions were carried out at 37 °C for 15 min.

2.2.7. Paper sensor test reactions

Bacterial cultures were grown in lysogeny broth (LB) until they reached the mid-log phase, after which they were centrifuged and their DNA were extracted and purified using a Genomic DNA Purification Kit. For detection assays, a 10 µL reaction mixture containing 50 nM LbaCas12a and 200 nM crRNA in 1 × NEB 2.1 buffer was pre-incubated at 37 °C for 10 min. Then, 1 µL of the purified NDM-1 gene was added, and the mixture was dripped onto the test zone of the paper sensor and incubated at 37 °C for 30 min. Afterward, 1 µL of 40 mM H2O2 and 1 µL of 2.5 mM ABTS were added to the test zone and incubated for 2 min to allow the development of the colorimetric reaction. Finally, photographs were taken using a smartphone and analyzed using Image J software.

For the circle cleavage-based test, 1 µL of the NDM-1 gene and 2 µL of 500 nM circle + primer were added to 10 µL of the Cas12a/crRNA reaction mixture and incubated at 37 °C for 30 min, followed by heating at 98 °C for 2 min to denature the enzymes. Then, 1 µL of 10 U/µL Phi29 polymerase and 1 µL of 10 mM dNTP mix were added to the reaction mixture to initiate the RCA reaction and were incubated for 30 min. This was followed by dripping 5 µL of the RCA products onto the test zone of the paper sensor, which was then allowed to dry at room temperature for 5 min. Finally, 1 µL of 40 mM H2O2 and 1 µL of 2.5 mM ABTS were added to the test zone and incubated for 2 min for the development of the colorimetric reaction. The resulting color change was captured using a smartphone and analyzed using ImageJ software.

2.2.8. Clinical sample test

To test clinical urine or blood samples for the presence of the NDM-1 gene, 50 µL of the culture was removed after overnight incubation and heated at 95 °C for 10 min for the extraction of the genomic DNA. The solution was allowed to cool and the NDM-1 gene sequence was amplified using RPA. Two microliters of the RPA products were added to the paper sensor, followed by incubation and color development, as described in Section 2.2.7.

3. Results and discussion

3.1. Construction of the Cas12a/3D DNAzyme paper sensor

To construct the paper sensor using Cas12a/3D DNAzyme, we first evaluated the performance of the 3D DNAzyme, which is a long single-stranded DNA with multiple repeats of DNAzymes synthesized by RCA reactions [[45], [46]]. The DNAzyme in this study contained a G-quadruplex, which mimicked the enzymatic activity of peroxidase when complexing with hemin (Table S1) [47]. The long ssDNA synthesized by RCA self-assembled into a flower-like 3D DNA structure (Fig. 1a) [48]. The success of the preparation was confirmed through agarose gel electrophoresis, with bands representing both the RCA product and the 3D DNAzyme remaining in the gel wells and corresponding to several megadalton sizes or hundreds to thousands of tandem inducer repeats (Fig. S1). The formation of the 3D DNAzyme with different reaction times was monitored using TEM and SEM. The assembly of the 3D DNAzyme was a progressive process. Phi29 DNA polymerase produced both DNA strands and pyrophosphate (PPi4−) ions in a time-dependent manner. As the reaction time extended, long nucleic acid chains with significantly higher local concentrations self-assembled with Mg2PPi precipitation as the core, forming round, flower-shaped nucleic acid particles (Fig. S2a). As shown in Fig. S2b, the average size of the 3D DNAzyme was found to be dependent on the reaction time, where a 30-min reaction produced a 3D DNAzyme of around 200 nm in size, and a 300-min reaction generated a 3D DNAzyme with a size of approximately 500 nm (Fig. S3). The entire colorimetric reaction could be completed in 5 min and the 3D DNAzyme synthesized by different RCA reaction times was able to induce similar color changes after a 5-min ABTS oxidation reaction (Fig. S4 and S5), demonstrating that the synthesized 3D DNAzyme was able to catalyze a rapid colorimetric reaction detectable by the naked eye (Fig. 1b).

Fig. 1.

Fig 1

Open in a new tab

Fabrication of the Cas12a/3D DNAzyme paper sensor using 3D DNAzyme cleavage and circle cleavage assays. (a) Scheme of 3D DNAzyme synthesis. A rolling circle amplification (RCA) reaction was used to generate a long single-stranded DNA sequence encoding a peroxidase-mimicking DNAzyme which could subsequently self-assemble to form a 3D DNA nanostructure. (b) The colorimetric reaction of different components during self-assembly of the 3D DNAzyme. (c) Scheme of the 3D DNAzyme cleavage assay. (d) Agarose gel electrophoresis analysis of 3D DNAzyme degradation by Cas12a/crRNA. (e-f) SEM imaging (e) of nitrocellulose-immobilized 3D DNAzymes of varying sizes generated by different RCA reaction times after cleavage by Cas12a/crRNA. Corresponding paper sensor tests are attached below (f). The images were captured by a smartphone camera at 2 min after the addition of ABTS and H2O2. Corrected color intensity was quantified using Image J software. (g) Scheme of circle cleavage assay. (h) SEM images of the circle cleavage-based paper sensor. Left: without NDM-1; Right: with NDM-1. (i) Paper sensor test using circle cleavage assay. The images were captured by a smartphone camera at 2 min after the addition of all components. Corrected color intensity was quantified using Image J software. Data are mean ± SEM, n = 3 independent experiments.

Since direct cleavage of the 3D DNAzyme would lead to fewer processing steps, we first tested the collateral cleavage activity of Cas12a/crRNA for the direct degradation of the 3D DNAzyme in solution (Fig. 1c). To design the crRNA, we first investigated regions in the NDM-1 gene sequence that were compatible with Cas12a detection. The selected regions were then computationally filtered to eliminate potential homologous sequences between the human gene and those in a panel of related bacteria. These steps led to the identification of seven sequences in the NDM-1 gene that were compatible with the downstream sensing application (Table S2), and the Target-1 sequence (5’- TTTCCGCCAGCTCGCACCGAATGT -3’) was used for subsequent experiments. The degradation of the 3D DNAzyme by activated Cas12a/crRNA was first characterized by agarose gel electrophoresis. As shown in Fig. 1d, the length of the PCR-amplified NDM-1 gene was around 500 bp, whereas the 3D DNAzyme exhibited a molecular weight of over 10 kb. The addition of Cas12a/crRNA without NDM-1 did not alter the 3D DNAzyme band significantly. However, when the NDM-1 gene sequence was added to the Cas12a/3D DNAzyme mixture, the 3D DNAzyme band disappeared, leaving only the band of the PCR-amplified NDM-1 gene. Furthermore, Cas12a-induced degradation of the 3D DNAzyme was also evaluated by its ability to catalyze the colorimetric reaction (Fig. S6). Collectively, these results confirm that the designed Cas12a system could cleave the 3D DNAzyme in response to NDM-1 dsDNA triggers.

We subsequently evaluated the ability of the 3D DNAzyme to non-covalently adsorb to nitrocellulose for the fabrication of the paper sensor. 3D DNAzymes of different sizes were deposited on nitrocellulose and their retention under lateral flow was compared with a control consisting of the monomeric counterpart (1D single-stranded DNAzyme). As shown in Fig. S7, the 3D DNAzymes remained immobilized at their initial positions on the nitrocellulose paper after lateral flow and could catalyze localized colorimetric reactions, whereas the 1D-DNAzyme was completely delocalized. The retention efficiency of 3D DNAzymes of different sizes (synthesized by different RCA reaction times) showed that the larger 3D DNAzymes bound to nitrocellulose behaved better than the smaller versions. These results collectively demonstrated that 3D DNAzymes can adhere strongly to paper surfaces, enabling the generation of colorimetric signals. Considering the colorimetric signal and time cost, we chose an RCA time of 30 min for the preparation of the 3D DNAzyme, shown by SEM and AFM to have a particle size on paper of approximately 500 nm with a height of 200 nm (Fig. S8). After the addition of H2O2 and ABTS, the colorimetric signal produced by the 3D DNAzyme remained stable for 5 min before gradually decreasing to around 30% after 30 min of incubation. Therefore, the signal of the Cas12a/3D DNAzyme paper sensor should be read within 5 min to ensure the accuracy of the assay results (Fig. S9).

We then evaluated the direct degradation of the paper-immobilized 3D DNAzyme by activated Cas12a/crRNA (Fig. 1d) [[25], [49], [50]]. As shown in Fig. 1e, after incubation with activated Cas12a/crRNA for 30 min at 37 °C, 3D DNAzymes synthesized by different RCA reaction times were degraded, as seen by obvious structural alterations on SEM (Fig. 1e). As shown in Fig. 1f, in the absence of the NDM-1 gene sequence, the 3D DNAzymes attached to the paper sensors generated obvious blue-colored signals. When the NDM-1 gene was added to the paper sensor, smaller-sized 3D DNAzymes (synthesized by a 30-min RCA reaction) were cleaved, resulting in a weaker color signal. However, due to incomplete cleavage, the color changes for all the 3D DNAzymes (synthesized by 30 min, 60 min, or 300 min RCA reactions) were not all discernable.

Since small amounts of the NDM-1 gene are only able to activate a specific amount of Cas12a/crRNA, which may not be sufficient for the complete cleavage of the 3D DNAzymes on the paper sensor, we then designed a “circle cleavage” strategy for the construction of the Cas12a/3D DNAzyme paper sensor. This strategy used activated Cas12a/crRNA for the cleavage of the circular DNAs, which were then used for RCA. The mechanism is shown in Fig. 1g. In the event of all the circular DNA being cleaved, no 3D DNAzyme could be generated using the RCA reaction and there would thus be no colorimetric signal. As shown in Fig. S10, the Padlock and DNA Circle bands disappeared almost completely in the presence of the NDM-1 gene, indicating that the partially hybridized circular DNA was able to respond efficiently to the trans cleavage activity of Cas12a. The 3D DNAzymes generated by 30-min RCA reactions were adsorbed to the paper sensor and their morphology was evaluated using SEM (Fig. 1h). In the absence of the NDM-1 gene sequence, a well-defined flower-like 3D DNAzyme structure could be observed on the nitrocellulose paper, resulting in the generation of a clear blue signal on the paper sensor. However, when the NDM-1 gene was present in the sample, all the circular DNA would be cleaved, resulting in no 3D DNAzyme on the paper. Notably, we found that the “circle cleavage” strategy resulted in a very low background signal compared with the 3D DNAzyme cleavage assay (Fig. 1i), showing significant potential for the sensitive detection of the NDM-1 gene.

3.2. Systematic optimization of the Cas12a/3D DNAzyme paper sensor

After the demonstration of the successful construction of the Cas12a/3D DNAzyme paper sensor, we then systematically optimized the detailed reaction conditions throughout the entire detection system, including the Cas12a concentration, the ratio between Cas12a and crRNA, and the cleavage reaction time (Fig. 2). To evaluate the performance of the colorimetric reaction, we measured the change in absorbance (ΔA) with and without the NDM-1 gene in a buffer system. As shown in Fig. 2a, the △A increased in proportion to the concentration of the 3D DNAzyme, demonstrating a clear relationship between the 3D DNAzyme concentration and the colorimetric signal (Fig. 2a).

Fig. 2.

Fig 2

Open in a new tab

Optimization of the Cas12a/3D DNAzyme paper sensor for sensitive NDM-1 gene analysis. (a) Colorimetric reaction with different 3D DNAzyme concentrations. (b) Optimization of the circle concentration in the circle-cleavage assay. Cas12a concentration: 50 nM; Cas12a: crRNA=1:4; reaction time: 60 min. (c) Optimization of the Cas12a concentration in the circle cleavage assay. Cas12a: crRNA=1:4; circle concentration: 50 nM; reaction time: 60 min. (d) Optimization of the Cas12a/crRNA ratio in the circle-cleavage assay. Cas 12a concentration: 50 nM; circle concentration: 50 nM; reaction time: 60 min. (e) Optimization of the Cas12a cleavage reaction time in the circle-cleavage assay. Cas12a concentration: 50 nM; Cas12a: crRNA=1:4; circle concentration: 50 nM. (f) Sensitivity of NDM-1 gene detection in a circle-cleavage assay in a tube. Data are mean ± SEM, n = 3 independent experiments.

For optimization of the Cas12a concentration, it was found that increasing the circle and Cas12a concentrations led to a more efficient NDM-1-triggered cleavage (Fig. 2b, 2c), while a too high concentration of Cas12a resulted in non-specific cleavage and increased the total cost. Therefore, 50 nM of circle and Cas12a were chosen for the following test. Besides, it has been widely reported that the ratio between Cas12a and crRNA would also significantly affect the collateral cleavage efficiency [18]. To avoid the issues of non-specific cleavage and increased cost, we used a set concentration of 50 nM Cas12a and systematically evaluated the effects of the varying ratio between Cas12a and crRNA. As shown in Fig. 2d, adjustment of the ratio of Cas12a to crRNA at 1:4 resulted in the greatest △A. Additionally, we optimized the cleavage reaction time to optimize both the sensitivity and speed of the test (Fig. 2e). Based on the findings, a 30-min cleavage reaction was selected as optimal. Following these optimizations, the sensitivity of the 3D DNAzyme cleavage-based colorimetric reaction was investigated (Fig. 2f), showing a limit of detection (LOD, defined as 3σ, σ = standard deviation of the blank samples) of around 100 fM.

3.3. Cas12a/3D DNAzyme paper sensor for sensitive detection of the NDM-1 drug resistance gene

After optimization of the reaction conditions, the sensitivities of two strategies for the detection of the NDM-1 gene targets on the paper sensor were then investigated. To quantify the colorimetric signal on the paper sensor, we used ImageJ software to measure the corrected color intensity. As shown in Fig. 3a, there was no noticeable color change by the 3D DNAzyme cleavage-based paper sensor when the concentration of NDM-1 increased. Consequently, it was difficult to distinguish between samples with and without NDM-1 with the naked eye, although, after Image J-based color quantification, differences between samples with different NDM-1 concentrations could be identified (Fig. 3a). In contrast, the color changes triggered by the presence of NDM-1 were much more apparent when the circle-cleavage strategy was used and could be easily distinguished by the naked eye (Fig. 3b). Moreover, the comparison between the 3D DNAzyme cleavage and the circle-cleavage strategy further demonstrates that direct cleavage of 3D DNAzyme may not be a most efficient approach for constructing a paper sensor, since it would leave some uncleaved 3D DNAzyme to generate a background color signal.

Fig. 3.

Fig 3

Open in a new tab

Cas12a/3D DNAzyme paper sensor coupled with recombinase polymerase amplification (RPA) can be used for femtomolar-level NDM-1 gene detection with the naked eye. (a) Sensitivity of the 3D DNAzyme cleavage-based sensor for NDM-1 gene detection. (b) Sensitivity of the circle cleavage-based sensor for NDM-1 gene detection. (c) Scheme of the Cas12a/3D DNAzyme sensor coupled with RPA. (d) Sensitivity of the 3D DNAzyme cleavage-based sensor coupled with RPA. (e) Sensitivity of the circle cleavage-based sensor coupled with RPA. Data are mean ± SEM, n = 3 independent experiments, assessed by two-tailed Student's t-test; NS, not significant; ****P < 0.0001.

Although the circle-cleavage assay displayed sensitivity down to 100 fM for NDM-1 gene targets, it was unable to analyze clinically relevant antibiotic-resistant genes in bacterial pathogens directly. Accordingly, to further enhance the sensitivity of the Cas12a/3D DNAzyme paper sensor, we incorporated an isothermal DNA amplification technique known as RPA (recombinase polymerase amplification) into our workflow (Fig. 3d). RPA is a rapid and highly sensitive method for the isothermal amplification of target dsDNA sequences at a constant temperature (around 37 °C) [51]. In the RPA reaction, recombinases pair primers with their homologous sequences in dsDNA targets. The single-stranded DNA-binding protein (SSB) then binds to the displaced strands of the dsDNA targets, preventing displacement of the primers. Finally, the strand-displacing polymerase initiates DNA synthesis [52]. By using two opposing primers, the reaction is much like the isothermal polymerase chain reaction. The presence of the target dsDNA thus initiates an exponential DNA amplification reaction without the need for a thermal cycler.

When coupled with RPA, the sensitivity of paper sensors using both 3D DNAzyme cleavage and the circle-cleavage strategy was significantly enhanced (Fig. 3d, 3e). Specifically, the 3D DNAzyme cleavage-based sensor coupled with RPA achieved a LOD of 1 pM accompanied by very low background color signals, which makes it potentially suitable for direct naked-eye identification. Meanwhile, the circle-cleavage sensor exhibited a LOD of approximately 5 fM, which was visible to the naked eye (Fig. 3e). Compared to the 3D DNAzyme cleavage assay, the circle-cleavage assay showed around 103-fold higher sensitivity and could thus be used for fM-level sensitive analysis of NDM-1 gene targets, suggesting its significant potential for clinical applications.

3.4. Cas12a/3D DNAzyme paper sensor for the clinical detection of drug-resistant bacteria

To assess the feasibility of the clinical application of the paper sensor, we investigated its ability to detect NDM-1 gene targets in various bacterial species. Specifically, six species of bacteria (P.r.: Providencia rettgeri; P.m.: Proteus mirabilis; R.s.: Raoultella sp; E.h.: Enterobacter hormaechei; E.c.: Enterobacter cloacae; C.f.: Citrobacter freundii.) all containing the NDM-1 gene were analyzed using the designed paper sensor. As shown in Fig. 4a, the Cas12a/3D DNAzyme paper sensor was able to detect the NDM-1 gene in all the selected bacteria with similar efficiency. To identify the bacterial species responsible for antibiotic resistance, we designed six crRNAs that could specifically recognize the 16S gene in six different bacterial species (Fig. 4b). As shown in Fig. 4c, when challenged with specific 16S sequences from various types of bacteria, the different paper sensors were highly orthogonal to each other, and the results correlated well with the reactions performed in solution (Fig. S7). The quantified orthogonal heatmap (Fig. 4d) also showed no significant cross-interference between each pair of bacteria, indicating that, with rational recognition sequence design, the CRISPR/Cas12a system can be highly specific for target sequences.

Fig. 4.

Fig 4

Open in a new tab

Recognition of the NDM-1 gene in different bacterial species by the Cas12a/3D DNAzyme paper sensor. (a) Recognition of the NDM-1 gene in different bacteria. Top: color intensity; Bottom: colorimetric images. P.r.: Providencia rettgeri; P.m.: Proteus mirabilis; R.s.: Raoultella sp; E.h.: Enterobacter hormaechei; E.c.: Enterobacter cloacae; C.f.: Citrobacter freundii. (b) Sequence information for bacterial identification based on 16S target regions. (c) Typical colorimetric results for orthogonal identification of each bacterial species. (d) Heatmap analysis of the orthogonal identification of each bacterial species based on data from three independent experiments.

The efficacy of the designed Cas12a/3D DNAzyme paper sensor in clinical sample analysis was then investigated. To achieve this goal, a simple, low-cost, and efficient method for bacterial genomic sequence extraction was needed. For this purpose, we investigated the integration of a boiling process in the workflow (Fig. 5a) to break down the bacterial membranes allowing the release of their genomic DNA. As a model system, a clinical isolate of NDM-1 positive E.h., using a series of concentrations from 102 CFU/mL to 108 CFU/mL, was heated to 95 °C for 10 min. The resulting lysates were then immediately used to initiate RPA reactions followed by the “circle cleavage” paper sensor test. As shown in Fig. 5b, the color intensity of the test zone was observed to be proportional to the bacterial concentration, with the entire workflow resulting in a LOD for bacterial detection of around 105 CFU/mL. Of note, the simple heating process circumvented the need for column-based sample preparations and could thus be performed in resource-limited conditions.

Fig. 5.

Fig 5

Open in a new tab

Analysis of clinical samples using the Cas12a/3D DNAzyme paper sensor. (a) Workflow of the analysis of clinical samples by the Cas12a/3D DNAzyme paper sensor. Clinical urine and blood samples were cultured overnight, after which 50 µL of the culture media were removed and heated at 95 °C for 10 min to lyse the bacteria. The NDM-1 gene in the samples was then specifically amplified using RPA and applied to the Cas12a/3D DNAzyme paper sensor. (b) Sensitivity of the Cas12a/3D DNAzyme paper sensor for the detection of NDM-1-positive bacteria. (c) Results of NDM-1 gene detection by the Cas12a/3D DNAzyme paper sensor in 19 clinical samples (top); heatmap analysis of the results (bottom). (d) Confusion matrix of samples tested in (c). (e) Concordance between the Cas12a/3D DNAzyme and qPCR results for 6 patient samples and 13 controls.

Finally, we tested the performance of the paper sensor for the diagnostic detection of antibiotic-resistant bacteria in urine and plasma samples from infected patients (Fig. 5c). Testing of 10 urine and 9 blood samples showed that the optimized Cas12a/3D DNAzyme paper sensor correctly identified six NDM-1-positive patient samples with 100% agreement with the qPCR findings, while 13 previously documented NDM-1-negative samples were free of false positives (Fig. 5d, 5e). Although the volumes of the samples were relatively small, these results indicated that the designed Cas12a/3D DNAzyme paper sensor holds great potential for rapid and highly accurate field-deployable detection of antibiotic-resistant genes.

4. Conclusion

In summary, we designed a colorimetric Cas12a/3D DNAzyme paper sensor for the rapid identification of an important antibiotic-resistant gene (NDM-1) in clinical samples. This novel paper sensor integrated the concepts of the Cas12a system for the detection of a specific antibiotic-resistant gene and signal generation and 3D DNA nanostructure for non-covalent attachment on the paper to prepare a highly bioactive paper sensor. After systematic optimization, the paper sensor was able to detect the NDM-1 gene in clinical samples with a femtomolar-level sensitivity in less than 90 min, and the signal could easily be read by the naked eye or a smartphone. The CRISPR-Cas12a probes used in this paper sensor have high programmability, allowing adaptation of the platform for the detection of other genes and pathogens as needed. The simplicity of the paper sensor matches the requirements for community surveillance testing and can be used in resource-constrained developing countries. Overall, this paper sensor provides a valuable tool for the detection of antibiotic-resistant genes and can thus contribute to the global effort to combat infectious diseases.

Declaration of competing interest

The authors declare that they have no conflicts of interest in this work. The author Jinghong Li is an Associate Editor for Fundamental Research and was not involved in the editorial review or the decision to publish the article.

Acknowledgments

The authors gratefully acknowledge financial supports from the National Natural Science Foundation of China (22122409, U2004197); Henan Province Fund for Cultivating Advantageous Disciplines (222301420019); Program for Science & Technology Innovation Talents in Universities of Henan Province (21HASTIT043).

Biographies

Hua Gao (BRID: 07808.00.99660) is an assistant professor in Department of Pathogenic Biology, Medical College, Zhengzhou University, China. She received her BSc in 2012 from Northeast Agricultural University and her PhD in 2018 from Tsinghua University. Her current research interests include DNA nanotechnology, CRISPR-based genomic engineering and pathogenic biology.

Kaixiang Zhang (BRID: 06567.00.83296) is an associate professor in School of Pharmaceutical Sciences, Zhengzhou University, China. He received his BSc in 2011 from Tongji University and his PhD in 2017 from Tsinghua University. His current research interests include DNA nanotechnology, CRISPR-based nucleic acid analysis and single cell analysis.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.fmre.2023.04.011.

Contributor Information

Ke Qu, Email: quke18@cdut.edu.cn.

Kaixiang Zhang, Email: zhangkx@zzu.edu.cn.

Appendix. Supplementary materials

mmc1.docx (488.6MB, docx)

References

  • 1.Theuretzbacher U., Gottwalt S., Beyer P., et al. Analysis of the clinical antibacterial and antituberculosis pipeline. Lancet Infect. Dis. 2019;19(2):E40–E50. doi: 10.1016/S1473-3099(18)30513-9. [DOI] [PubMed] [Google Scholar]
  • 2.Parks T., Hill A.V., Chapman S.J. The perpetual challenge of infectious diseases. N. Engl. J. Med. 2012;367(1):90–91. doi: 10.1056/NEJMc1204960. [DOI] [PubMed] [Google Scholar]
  • 3.Worthington R.J., Melander C. Combination approaches to combat multidrug-resistant bacteria. Trends Biotechnol. 2013;31(3):177–184. doi: 10.1016/j.tibtech.2012.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Di Y.P., Lin Q., Chen C., et al. Enhanced therapeutic index of an antimicrobial peptide in mice by increasing safety and activity against multidrug-resistant bacteria. Sci. Adv. 2020;6(18):eaay6817. doi: 10.1126/sciadv.aay6817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.van Belkum A., Burnham C.D., Rossen J.W.A., et al. Innovative and rapid antimicrobial susceptibility testing systems. Nat. Rev. Microbiol. 2020;18(5):299–311. doi: 10.1038/s41579-020-0327-x. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang K.X., Qin S.S., Wu S.X., et al. Microfluidic systems for rapid antibiotic susceptibility tests (ASTs) at the single-cell level. Chem. Sci. 2020;11(25):6352–6361. doi: 10.1039/d0sc01353f. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bhattacharyya R.P., Bandyopadhyay N., Ma P., et al. Simultaneous detection of genotype and phenotype enables rapid and accurate antibiotic susceptibility determination. Nat. Med. 2019;25(12):1858–1864. doi: 10.1038/s41591-019-0650-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Akagi T., Takeda Y., Yonemori K., et al. Quantitative genotyping for the astringency locus in hexaploid persimmon cultivars using quantitative real-time PCR. J. Am. Soc. Hortic. Sci. 2010;135(1):59–66. [Google Scholar]
  • 9.Anek-Vorapong R., Sinthuwattanawibool C., Podewils L.J., et al. Validation of the GenoType MTBDRplus assay for detection of MDR-TB in a public health laboratory in Thailand. BMC Infect. Dis. 2010;10:123. doi: 10.1186/1471-2334-10-123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Pholwat S., Liu J., Taniuchi M., et al. Genotypic antimicrobial resistance assays for use on E. coli isolates and stool specimens. PLoS One. 2019;14(5) doi: 10.1371/journal.pone.0216747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Patchsung M., Jantarug K., Pattama A., et al. Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA. Nat. Biomed. Eng. 2020;4(12):1140–1149. doi: 10.1038/s41551-020-00603-x. [DOI] [PubMed] [Google Scholar]
  • 12.Ackerman C.M., Myhrvold C., Thakku S.G., et al. Massively multiplexed nucleic acid detection with Cas13. Nature. 2020;582(7811):277–282. doi: 10.1038/s41586-020-2279-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chen J.S., Ma E., Harrington L.B., et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360(6387):436–439. doi: 10.1126/science.aar6245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wang B., Wang R., Wang D., et al. Cas12aVDet: A CRISPR/Cas12a-based platform for rapid and visual nucleic acid detection. Anal. Chem. 2019;91(19):12156–12161. doi: 10.1021/acs.analchem.9b01526. [DOI] [PubMed] [Google Scholar]
  • 15.Shao N., Han X., Song Y., et al. CRISPR-Cas12a coupled with platinum nanoreporter for visual quantification of SNVs on a volumetric bar-chart chip. Anal. Chem. 2019;91(19):12384–12391. doi: 10.1021/acs.analchem.9b02925. [DOI] [PubMed] [Google Scholar]
  • 16.Yuan C., Tian T., Sun J., et al. Universal and naked-eye gene detection platform based on the clustered regularly interspaced short palindromic repeats/Cas12a/13a system. Anal. Chem. 2020;92(5):4029–4037. doi: 10.1021/acs.analchem.9b05597. [DOI] [PubMed] [Google Scholar]
  • 17.Dai Y., Wu Y., Liu G., et al. CRISPR mediated biosensing toward understanding cellular biology and point-of-care diagnosis. Angew. Chem. Int. Ed. 2020;59(47):20754–20766. doi: 10.1002/anie.202005398. [DOI] [PubMed] [Google Scholar]
  • 18.Gootenberg J.S., Abudayyeh O.O., Kellner M.J., et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science. 2018;360(6387):439–444. doi: 10.1126/science.aaq0179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ding X., Yin K., Li Z., et al. Ultrasensitive and visual detection of SARS-CoV-2 using all-in-one dual CRISPR-Cas12a assay. Nat. Commun. 2020;11(1):4711. doi: 10.1038/s41467-020-18575-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kleinstiver B.P., Sousa A.A., Walton R.T., et al. Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nat. Biotechnol. 2019;37(3):276–282. doi: 10.1038/s41587-018-0011-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ying Z.M., Wang F.L., Chu X., et al. Activatable CRISPR transcriptional circuits generate functional RNA for mRNA sensing and silencing. Angew. Chem. Int. Ed. 2020;59(42):18599–18604. doi: 10.1002/anie.202004751. [DOI] [PubMed] [Google Scholar]
  • 22.Broughton J.P., Deng X.D., Yu G.X., et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat. Biotechnol. 2020;38(7):870–874. doi: 10.1038/s41587-020-0513-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kaminski M.M., Alcantar M.A., Lape I.T., et al. A CRISPR-based assay for the detection of opportunistic infections post-transplantation and for the monitoring of transplant rejection. Nat Biomed Eng. 2020;4(6):601–609. doi: 10.1038/s41551-020-0546-5. [DOI] [PubMed] [Google Scholar]
  • 24.Chen M., Luo R., Li S., et al. Paper-based strip for ultrasensitive detection of OSCC-associated salivary microRNA via CRISPR/Cas12a coupling with IS-primer amplification reaction. Anal. Chem. 2020;92(19):13336–13342. doi: 10.1021/acs.analchem.0c02642. [DOI] [PubMed] [Google Scholar]
  • 25.Dai Y., Somoza R.A., Wang L., et al. Exploring the trans-cleavage activity of CRISPR-Cas12a (cpf1) for the development of a universal electrochemical biosensor. Angew. Chem. Int. Ed. 2019;58(48):17399–17405. doi: 10.1002/anie.201910772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chertow D.S. Next-generation diagnostics with CRISPR. Science. 2018;360(6387):381–382. doi: 10.1126/science.aat4982. [DOI] [PubMed] [Google Scholar]
  • 27.Yang H., Ledesma-Amaro R., Gao H., et al. CRISPR-based biosensors for pathogenic biosafety. Biosens. Bioelectron. 2023;228 doi: 10.1016/j.bios.2023.115189. [DOI] [PubMed] [Google Scholar]
  • 28.Hui C.Y., Liu M., Li Y., et al. A paper sensor printed with multifunctional bio/nano materials. Angew. Chem. Int. Ed. 2018;57(17):4549–4553. doi: 10.1002/anie.201712903. [DOI] [PubMed] [Google Scholar]
  • 29.Kellner M.J., Koob J.G., Gootenberg J.S., et al. SHERLOCK: Nucleic acid detection with CRISPR nucleases. Nat. Protoc. 2019;14(10):2986–3012. doi: 10.1038/s41596-019-0210-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ivanov A.V., Safenkova I.V., Zherdev A.V., et al. DIRECT(2): A novel platform for a CRISPR-Cas12-based assay comprising universal DNA-IgG probe and a direct lateral flow test. Biosens. Bioelectron. 2022;208 doi: 10.1016/j.bios.2022.114227. [DOI] [PubMed] [Google Scholar]
  • 31.Li T., Hu R., Xia J., et al. G-triplex: A new type of CRISPR-Cas12a reporter enabling highly sensitive nucleic acid detection. Biosens. Bioelectron. 2021;187 doi: 10.1016/j.bios.2021.113292. [DOI] [PubMed] [Google Scholar]
  • 32.Wei L., Wang Z., Wang J., et al. Aptamer-based colorimetric detection of methicillin-resistant Staphylococcus aureus by using a CRISPR/Cas12a system and recombinase polymerase amplification. Anal. Chim. Acta. 2022;1230 doi: 10.1016/j.aca.2022.340357. [DOI] [PubMed] [Google Scholar]
  • 33.Gong S., Wang X., Zhou P., et al. AND logic-gate-based CRISPR/Cas12a biosensing platform for the sensitive colorimetric detection of dual miRNAs. Anal. Chem. 2022;94(45):15839–15846. doi: 10.1021/acs.analchem.2c03666. [DOI] [PubMed] [Google Scholar]
  • 34.Liu M., Hui C.Y., Zhang Q., et al. Target-induced and equipment-free DNA amplification with a simple paper device. Angew. Chem. Int. Ed. 2016;55(8):2709–2713. doi: 10.1002/anie.201509389. [DOI] [PubMed] [Google Scholar]
  • 35.Liu M., Wang J., Chang Y., et al. In vitro selection of a DNA aptamer targeting degraded protein fragments for biosensing. Angew. Chem. Int. Ed. 2020;59(20):7706–7710. doi: 10.1002/anie.202000025. [DOI] [PubMed] [Google Scholar]
  • 36.Liu M., Zhang Q., Kannan B., et al. Self-assembled functional DNA superstructures as high-density and versatile recognition elements for printed paper sensors. Angew. Chem. Int. Ed. 2018;57(38):12440–12443. doi: 10.1002/anie.201806489. [DOI] [PubMed] [Google Scholar]
  • 37.Gao H., Zhang K.X., Teng X.C., et al. Rolling circle amplification for single cell analysis and in situ sequencing. Trac-Trend. Anal. Chem. 2019;121(9) [Google Scholar]
  • 38.Zhang K., Deng R., Gao H., et al. Lighting up single-nucleotide variation in situ in single cells and tissues. Chem. Soc. Rev. 2020;49(6):1932–1954. doi: 10.1039/c9cs00438f. [DOI] [PubMed] [Google Scholar]
  • 39.Zhang K., Deng R., Teng X., et al. Direct visualization of single-nucleotide variation in mtDNA using a CRISPR/Cas9-mediated proximity ligation assay. J. Am. Chem. Soc. 2018;140(36):11293–11301. doi: 10.1021/jacs.8b05309. [DOI] [PubMed] [Google Scholar]
  • 40.Zhang K., Gao H., Deng R., et al. Emerging applications of nanotechnology for controlling cell-surface receptor clustering. Angew. Chem. Int. Ed. 2019;58(15):4790–4799. doi: 10.1002/anie.201809006. [DOI] [PubMed] [Google Scholar]
  • 41.Feng H., Liu X., Wang S., et al. The mechanism of NDM-1-catalyzed carbapenem hydrolysis is distinct from that of penicillin or cephalosporin hydrolysis. Nat. Commun. 2017;8(1):2242. doi: 10.1038/s41467-017-02339-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Feng H., Ding J.J., Zhu D.Y., et al. Structural and mechanistic insights into NDM-1 catalyzed hydrolysis of cephalosporins. J. Am. Chem. Soc. 2014;136(42):14694–14697. doi: 10.1021/ja508388e. [DOI] [PubMed] [Google Scholar]
  • 43.Walsh T.R., Weeks J., Livermore D.M., et al. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: An environmental point prevalence study. Lancet Infect. Dis. 2011;11(5):355–362. doi: 10.1016/S1473-3099(11)70059-7. [DOI] [PubMed] [Google Scholar]
  • 44.Nordmann P., Poirel L., Walsh T.R., et al. The emerging NDM carbapenemases. Trends Microbiol. 2011;19(12):588–595. doi: 10.1016/j.tim.2011.09.005. [DOI] [PubMed] [Google Scholar]
  • 45.Zhang K., Deng R., Sun Y., et al. Reversible control of cell membrane receptor function using DNA nano-spring multivalent ligands. Chem. Sci. 2017;8(10):7098–7105. doi: 10.1039/c7sc02489d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Zhang K., Li Y., Liu J., et al. Y-shaped circular aptamer–DNAzyme conjugates for highly efficient in vivo gene silencing. CCS Chem. 2020;2(5):631–641. [Google Scholar]
  • 47.Tang L., Liu Y., Ali M.M., et al. Colorimetric and ultrasensitive bioassay based on a dual-amplification system using aptamer and DNAzyme. Anal. Chem. 2012;84(11):4711–4717. doi: 10.1021/ac203274k. [DOI] [PubMed] [Google Scholar]
  • 48.Zhang K., Liu J., Song Q., et al. DNA nanosponge for adsorption and clearance of intracellular miR-21 and enhanced antitumor chemotherapy. ACS Appl. Mater. Inter. 2019;11(50):46604–46613. doi: 10.1021/acsami.9b18282. [DOI] [PubMed] [Google Scholar]
  • 49.Sun Y., Liu H., Shen Y., et al. Cas12a-activated universal field-deployable detectors for bacterial diagnostics. ACS Omega. 2020;5(24):14814–14821. doi: 10.1021/acsomega.0c01911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li Y., Mansour H., Wang T., et al. Naked-eye detection of grapevine red-blotch viral infection using a plasmonic CRISPR Cas12a assay. Anal. Chem. 2019;91(18):11510–11513. doi: 10.1021/acs.analchem.9b03545. [DOI] [PubMed] [Google Scholar]
  • 51.Daher R.K., Stewart G., Boissinot M., et al. Recombinase polymerase amplification for diagnostic applications. Clin. Chem. 2016;62(7):947–958. doi: 10.1373/clinchem.2015.245829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lobato I.M., O'Sullivan C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trac-Trend. Anal. Chem. 2018;98:19–35. doi: 10.1016/j.trac.2017.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (488.6MB, docx)

Articles from Fundamental Research are provided here courtesy of The Science Foundation of China Publication Department, The National Natural Science Foundation of China

RESOURCES