Skip to main content
NCBI home page
International Journal for Parasitology: Parasites and Wildlife logoLink to International Journal for Parasitology: Parasites and Wildlife
. 2026 Jan 14;29:101186. doi: 10.1016/j.ijppaw.2026.101186

Morphological and molecular characterisation of Henneguya pallida n. sp. from the gills of the pale catfish, Rhamdia guatemalensis (Günther, 1864), in southern Mexico

Graciela Colunga-Ramírez a,b, Gábor Cech a, M Leopoldina Aguirre-Macedo c, Kálmán Molnár a, Csaba Székely a,⁎, Boglárka Sellyei a
PMCID: PMC12854871  PMID: 41624444

Abstract

During a survey on myxozoan parasites in fish from southern Mexico, myxospores from the genera Henneguya and Myxobolus were detected in the gills and mesentery of the pale catfish (Rhamdia guatemalensis). Identification of a Henneguya sp. in the gills was supported by histology, myxospore morphology, and molecular analyses of the 18S rDNA and 28S gene sequences. Histopathological examination revealed that the myxospore-forming plasmodia of Henneguya sp. were associated with the gill filaments. Phylogenetic analyses placed this species within a clade of Henneguya species infecting Siluriformes. In contrast, scattered myxospore aggregates found in the mesentery were examined solely through morphological criteria. Four different myxospore morphotypes belonging to the family Myxobolidae were identified in a single specimen of R. guatemalensis; however, molecular identification was unsuccessful; therefore, only brief taxonomic descriptions are provided. Based on morphological and molecular evidence, the Henneguya sp. from the gills is described as a new species, Henneguya pallida n. sp. Further samplings are needed to fully characterise the myxospores found in the mesentery.

Keywords: Cnidaria, Fish parasites, Gill infection, Myxobolidae, Siluriformes

Graphical abstract

Image 1

Open in a new tab

Highlights

  • •

    Henneguya pallida n. sp. infects the gills of Rhamdia guatemalensis.

  • •

    Plasmodia of H. pallida n. sp. are located in the middle zone of the hemibranchs.

  • •

    Histology shows H. pallida n. sp. in multilayered epithelium of gill filaments.

  • •

    The 18S and 28S rDNA sequences of H. pallida n. sp. were analysed.

  • •

    Four myxospore morphotype were found in the mesentery.

1. Introduction

Catfishes (Order Siluriformes) are among the most species-rich and diverse teleost fish (Kappas et al., 2016), with over 4100 valid species currently recognised across 41 families (Ferraris, 2007; Eschmeyer et al., 2025). The geographical distribution of the highest catfish diversity is concentrated in the tropical regions of South America, Africa, and Asia. Fourteen of these families, including the family Heptapteridae, are exclusively distributed on the American continent (Malabarba and Malabarba, 2020). The genus Rhamdia (Pimelodidae) comprises 27 valid species (Eschmeyer et al., 2025), seven of which are present in Mexico (Miller et al., 2005). The pale catfish, Rhamdia guatemalensis (Günther, 1864), is a Neotropical freshwater species that inhabits the waters of the Pacific and Atlantic slopes, extending from southern Mexico to the Colombian Pacific region (Hernández et al., 2015; Julián-Caballero et al., 2024).

Taxonomic records of parasites associated with R. guatemalensis have been based mainly on molecular data. These predominantly describe helminths (Kritsky et al., 2013; García-Vásquez et al., 2023), with a single report of an apicomplexan coccidian in the liver and gallbladder (Colunga-Ramírez et al., 2025a). The report on myxozoan parasites in R. guatemalensis (Alama-Bermejo et al., 2023) is limited to DNA sequences of the small subunit ribosomal RNA gene (18S rDNA), obtained from intestine and kidney specimens collected in Veracruz City (located in the east-central part of Mexico). Notably, no myxospores were observed in these organs, leaving the presence of the myxozoans unconfirmed at the molecular level. The phylogenetic analysis places these sequences in a clade that includes Henneguya jundiai and Henneguya novaerae in the catfish, Rhamdia quelen (Quoy and Gaimard, 1824) (Alama-Bermejo et al., 2023).

The genus Henneguya Thélohan, 1892 is the second-largest group of myxozoan parasites belonging to class Myxosporea Bütschli, 1881, with more than 254 valid species described to date, and mostly in freshwater fishes, with the gills being the primary site of infection (Eiras and Adriano, 2012; Rangel et al., 2023).

American neotropics are understudied regarding myxozoans; most of the descriptions have been reported in Brazil, with over 57 documented species (Eiras and Adriano, 2012; Velasco et al., 2025). The present study examines the diversity of myxozoan species in R. guatemalensis from two water springs in Yucatán, Mexico, resulting in the identification of a newly identified Henneguya species that parasitizes the gills of this host. Additionally, it provides a brief taxonomic description of different myxospore morphotypes found in the mesentery of R. guatemalensis.

2. Materials and methods

2.1. Sample collection

From October to November 2023, a total of five specimens of R. guatemalensis were collected from two locations on the Yucatán Peninsula in southern Mexico: San Crisanto (n = 3) (21°34′ 77′ N, 89°18′ 10′ W) and Muuch water springs (n = 2) (21°21′ 82′ N, 89° 87′ 84′ W). The fish were stored alive in tanks with artificial aeration and subsequently transported to the Aquatic Pathology Laboratory at the Centro de Investigación y de Estudios Avanzados, Unidad Mérida (CINVESTAV-Mérida). The fish were maintained in separate aerated aquariums until necropsy.

All procedures were conducted in accordance with the Guidelines for Care and Manipulation of Laboratory Animals of Cinvestav, and the Mexican Official norm NOM-062-ZOO-199 (www.fmvz.unam.mx/fmvz/principal/archivos/062ZOO.PDF).

The fish were dissected to detect myxozoans under a light microscope by examining the smears and fresh squash preparations of all organs. A piece of infected organ was placed in either 10 % neutral buffered formalin for histological analysis and three samples from the gills with myxozoan plasmodia and a sample from the mesentery with scattered myxospore aggregates were stored in 96 % ethanol for morphological and molecular characterisation.

For morphometric measurements, plasmodia from the ethanol-preserved gills were carefully isolated using a fine needle and pressed to release the myxospores. Simultaneously, myxospores from the mesentery were detached and isolated from the tissue by means of puncturing. Subsequently, the isolated myxospore samples were collected and suspended individually in sterile distilled water. Subsequently, two types of preparations (unstained and Lugol-stained) were mounted on a glass slide and covered with a coverslip for morphological descriptions following the guidelines of Lom and Arthur (1989). Myxospore measurements were performed using ImageJ software (http://imagej.nih.gov/ij). For histopathological observations, the neutral buffered formalin (10 %) fixed gills were gradient-dehydrated in increasing concentrations of ethanol (70–100 % v/v) and embedded in paraffin wax blocks that were cut into 4−5 μm sections, stained with haematoxylin and eosin (H&E), and examined under a light microscope.

Photomicrographs of unstained, and Lugol-stained myxospores were taken under an Olympus BX53 light microscope equipped with an Olympus DP74 digital camera (Olympus Corporation, Japan). All measurements are expressed in micrometres (μm) unless otherwise stated.

2.2. Molecular characterisation

Plasmodia from the ethanol-fixed gills were removed using surgical needles and thoroughly rinsed three times in Tris-HCl buffer (10 mM Tris-HCl, pH 8.5). Following this, 50 μl of nuclease-free water was added, and the plasmodia were then crushed with a micropestle. The total genomic DNA was then isolated using the Genomic DNA Mini Kit (Geneaid Biotech Ltd., Taiwan), according to the manufacturer's instructions. The 18S rDNA and large subunit ribosomal DNA gene (28S rDNA) of Henneguya samples were amplified in short overlapping fragments by polymerase chain reaction (PCR) using combinations of specific myxozoan primers (Table 1). All PCRs were performed in a final volume of 25 μl, containing 1 × DreamTaq buffer (10 × ; Thermo Scientific), 0.2 mM dNTP mix (10 mM; Thermo Scientific), 10 pmol of each primer, 0.5 U DreamTaq polymerase (5 U; Thermo Scientific), 1 μl of template DNA, and nuclease-free water. Amplification conditions for the 18S rDNA consisted of an initial denaturation at 94 °C for 3 min, followed by 35 cycles of three steps: 94 °C for 45 s, 55 °C for 50 s, 72 °C for 1 min; and a final extension at 72 °C for 10 min. For the 28S rDNA, amplification conditions included an initial denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C for 45 s, 60 °C for 1 min, and 72 °C for 1 min 15 s, with a final extension at 72 °C for 7 min. DNA amplicons were electrophoresed through a 1 % agarose 1 × tris-acetate-EDTA buffer (TAE) gel stained with ethidium bromide (0.5 μl/ml) and examined under UV light. The appropriate-sized bands were purified with the DNA Fragment Purification Kit (Invitek, Berlin, Germany). Each PCR product was sequenced in both directions (Table 1) using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA) and run on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

Table 1.

Primers used for the amplification and sequencing of the 18S rDNA of the novel species, Henneguya pallida n. sp. F: forward, and R: reverse.

Gene Primer Application Sequence (5′–3′) References
18S rDNA
 F: Myx1F1 PCR and sequencing GTGAGACTGCGGACGGCTCAG Hallett and Diamant (2001)
F: ACT1F Sequencing TTGGGTAATTTGCGCGCCTGCTGCC Hallett and Diamant (2001)
R: ACT1Fr Sequencing TTGGGTAATTTGCGCGCCTGCTGCC Hallett and Diamant (2001)
R: SphR1
 PCR and Sequencing
 GTTACCATTGTAGCGCGCGT
 Eszterbauer and Székely (2004)
28S rDNA F: NLF10502 PCR and sequencing AATCGAACCATCTAGTAGCTGG Bartošová et al. (2009)
F: Myxo28S1F3 PCR and sequencing AGTAACTGCGAGTGAAGYG (Whipps et al., 2003)
R: NLR31132,3 PCR and Sequencing GTCTAAACCCAGCTCACGTTCCCT Van Der Auwera et al. (1994)
R: NLR1270 Sequencing TTCATCCCGCATCGCCAGTTC Bartošová et al. (2009)
NLR1694 Sequencing TCTYAGGAYCGACTNAC Bartošová et al. (2009)
R: 28S3R2,3 PCR GAGCACTGGGCAGAAATC Whipps et al. (2004)
Open in a new tab

The primer pair combinations employed for PCR are indicated by numbers in the superscripts.

2.3. Phylogenetic analyses

The assemblies and alignments of the three partial 18S rDNA and one of the 28S rDNA gene sequences were constructed in MEGA11 (Tamura et al., 2021). To establish the phylogenetic relationship, the 18S rDNA and 28S rDNA sequences were analysed separately. Each alignment was performed using MAFFT v. 11 online servers (Katoh et al., 2019), which include newly generated sequences, plus the closest related myxozoan sequences and Chloromyxum trilineatum LC417364 (18S rDNA) and Chloromyxum leydigi FJ417055 (28S rDNA) as outgroups, retrieved from GenBank (NCBI). The best-fit nucleotide substitution model for both trimmed alignments indicated by jModelTest 2.1, was the general time-reversible model with gamma-distributed rate (GTR + G + I) (Darriba et al., 2012). The phylogenies were constructed using Maximum Likelihood (ML) and Bayesian inference (BI). The ML analysis was performed in MEGA11 with bootstrap confidence values calculated from 1000 replicates. The BI analysis was conducted in MrBayes v. 3.2 (Ronquist et al., 2012). Posterior probability distributions were generated using the Markov chain Monte Carlo (MCMC) method, in which four chains were run simultaneously for five million generations every 1000 generations, with burn-in set at 25 %. The ML phylogenetic tree was visualised in MEGA11, while the BI phylogenetic tree was visualised in FigTree v. 1.4.4 (Rambaut, 2018). All phylogenetic trees were edited in CorelDRAW Graphics Suite 2019 v. 21.3.0.755. The genetic distance was calculated using the p-distance model in MEGA11.

3. Results

Myxozoan infection was detected in three out of five specimens of R. guatemalensis. At Muuch water spring, two out of three fish had plasmodia in the gills, and one possessed scattered myxospore aggregates on the mesentery. At San Crisanto water springs, one out of two specimens exhibited plasmodia in the gills (Fig. 1−3). Plasmodia were observed in all four pairs of holobranchs, each containing five to ten, distributed along the gill filaments. The mesentery of a single specimen exhibited scattered myxospore aggregates throughout the tissue, comprising a total of four different myxospore morphotypes: one assigned to the genus Henneguya (distinct from that infecting the gills), and the remaining three to the genus Myxobolus (Fig. 4).

Fig. 1.

Fig. 1

Open in a new tab

Henneguya pallida n. sp. in the gills of Rhamdia guatemalensis. (A) Small, rounded plasmodium (black arrow); (B) Several plasmodia of varying size and shape (black arrows).

Fig. 4.

Fig. 4

Open in a new tab

Phylogenetic trees inferred by Bayesian inference of the 18S rDNA (A) and 28S rDNA (B) sequences of Henneguya pallida n. sp. in Rhamdia guatemalensis, with related myxosporean species. In 18S rDNA and 28S rDNA analyses, Chloromyxum trilineatum and C. leydigi were used as outgroups, respectively. Posterior probabilities (PP)/maximum likelihood bootstrap (BS) values are shown above the nodes. GenBank accession numbers are indicated next to the species names. Scale bars represent nucleotide substitutions per site.

3.1. Descriptions

3.1.1. Henneguya pallida n. sp. (Gills)

Plasmodia (n = 8): Brownish and polymorphic in shape (elongated, ellipsoidal, or oval); 519 ± 146 (251−784) μm length, and 245 ± 82 (120−365) μm width (Fig. 1).

Myxospores (n = 41): The myxospore body is ellipsoidal in frontal view, biconvex in the sutural view and two elliptical shell valves with two tapering caudal appendages (Fig. 2), measuring 27.8 ± 3.9 (20.1–35.4) μm total length, 8.7 ± 0.5 (7.7–9.7) μm body length, 4.2 ± 0.3 (3.4–4.9) μm width, 2.8 ± 0.2 (2.2–3.2) μm thickness (n = 32), two caudal appendages measuring 18.9 ± 3.9 (12.4–26.0) μm length (Fig. 2). The two elongated polar capsules are ellipsoidal, equal or slightly different in size, measuring 4.5 ± 0.5 (3.8–5.9) μm length, and 1.1 ± 0.1 (0.8–1.4) μm width. Polar tubule coiling 7−8 times (Figs. 2F), and 20.5 ± 3.4 (15.0–26.7) μm long (n = 28) when extruded (Fig. 2B). In the sporoplasm, two nuclei were detected frequently close to the capsules (Fig. 2F−G).

Fig. 2.

Fig. 2

Open in a new tab

Light photomicrographs and drawings of mature myxospores of Henneguya pallida n. sp. (A) Lugol-stained myxospores; (B) Myxospores in frontal view with two polar capsules (pc), and two long caudal appendages (black arrow). Inset: polar capsules showing the coiled polar tubules (pt); (C) Myxospore with extruded the polar tubules (pt); (D, E) Myxospores in sutural view; (F) Schematic line drawing of the myxospore in frontal view; and (G) sutural view. Note: Fig. 2A–C and E are Lugol-stained myxospores.

3.2. Taxonomic summary

Type host: Rhamdia guatemalensis (Günther, 1864) (Family Heptapteridae).

Type locality: San Crisanto water spring (21°34′ 77′ N, 89°18′ 10′ W), and Muuch water spring (21°21′ 82′ N, 89° 87′ 84′ W), Yucatán, Mexico.

Infection site: histozoic, plasmodia located in and at the tips of the gill filaments.

Prevalence of infection: 3/5 (60 %)

Material deposited: Phototypes and histological slide preparations were deposited in the parasitological collection of the Zoological Department, Hungarian Natural History Museum, Budapest, Coll. No. HNMPCC-HNHM-PAR-72094.

Representative sequences: Three sequences of the 18S rDNA gene (accession numbers: PX447049- PX447051) and one sequence of the 28S rDNA gene (accession number: PX44699) of Henneguya pallida n. sp. were deposited in GenBank.

Etymology: The species designation “pallida” is derived from the common name of pale catfish, Rhamdia guatemalensis.

Remarks: The myxospore body of H. pallida n. sp. is smaller than those of other Henneguya species described in the genus Rhamdia, H. jundiai being the closest in spore length (8.7 vs. 9.5 μm) (Table 2). H. pallida n. sp. exhibits slightly longer caudal appendages (19.0 vs. 17.3 μm) in total length (27.8 vs. 26.9 μm). Furthermore, the site of infection differs: plasmodia of H. pallida n. sp. are found in the gill filaments, whereas plasmodia of H. jundiai are adjacent to the gill arch. The measurements of the polar capsules and the coil numbers of the polar tubule of H. pallida n. sp. overlap with all Henneguya species reported in R. quelen (when data are available). Comparing H. pallida n. sp. with Henneguya sp. in the mesentery, the length of the myxospore body and the total length of H. pallida n. sp. are shorter than those of Henneguya sp. observed in the mesentery (8.7 vs. 12.3 μm; 27.8 vs. 28.9 μm, respectively) (Table 2).

Table 2.

Morphological comparison of myxospores dimensions of Henneguya pallida n. sp. of the gills, myxospore morphotypes on the mesentery, of Rhamdia guatemalensis and related species. Dimension are given in micrometres and expressed as the mean followed by the range in parentheses.

Henneguya sp. Host Type locality and locality Infection site Spores
 Polar capsules
 References
Length Width Thickness Caudal appendage length Total length Length Width Polar tubule coiled Polar tubule length
H. pallida n. sp. R. guatemalensis Water springs
Yucatán, Mexico		 Gill filaments (Intrafilamental) 8.7 ± 0.5 (7.7–9.7) 4.2 ± 0.3 (3.4–4.9) 2.8 ± 0.2 (2.2–3.2) 19.0 ± 4.0 (12.4–26.0) 27.8 ± 3.9 (20.1–35.4) 4.5 ± 0.5 (3.8–5.9) 1.1 ± 0.1 (0.8–1.4) 7–8 20.5 ± 3.4 (15.0–26.7) This study
Henneguya sp. R. guatemalensis Water springs
Yucatán, Mexico		 Mesentery 12.3 4.7 – 16.4 28.9 4.7 1.1 – – This study
Myxobolus sp. Type 1 R. guatemalensis Water springs
Yucatán, Mexico		 Mesentery 10.0 ± 0.5 (8.9–10.7) 5.0 ± 0.7 (3.5–5.8) – – – 4.5 ± 0.7 (3.1–5.7) 1.2 ± 0.42 (0.8–1.4) – – This study
Myxobolus sp. Type 2 R. guatemalensis Water springs
Yucatán, Mexico		 Mesentery 10.7 ± 0.5 (10.0–11.1) 4.9 ± 0.1 (4.8–5.0) – – – 5.0 ± 0.2 (4.7–5.3) 1.4 ± 0.1 (1.2–1.5) 6–7 – This study
Myxobolus sp. Type 3 R. guatemalensis Water springs
Yucatán, Mexico		 Mesentery 15.2 ± 0.1 (15.1–15.2) 6.8 ± 0.1 (6.8–6.9) 3.0 – – 3.6 ± 0.3 (3.3–3.8) 2.0 ± 0.3 (1.8–2.2) – – This study
H. bagre R. quelen River
São Paulo, Brazil		 Gill filament 11.2 ± 0.5 (10.5–12.4) 5.1 ± 0.3 (4.6–6.1) 3.8 ± 0.2 (3.6–4.1) 9.8 ± 0.9 (8.2–11.1) 20.9 ± 0.9 (19.2–21.8) 5.9 ± 0.6 (4.9–6.7) 1.6 ± 0.1 (1.4–1.8) 7 – Vieira et al. (2022)
H. breviscauda R. quelen São Paulo River, Brazil Gill filament 10.7 ± 0.4 (9.6–10.8) 5.3 ± 0.5 (4.4–6.1) 3.7 ± 0.1 (3.6–3.9) 7.2 ± 0.8 (5.8–8.2) 17.1 ± 0.9 (15.9–18.7) Larger: 5.4 ± 0.2 (5.1–5.6)
Smaller: 4.6 ± 0.3 (4.2–5.0)		 Larger: 1.5 ± 0.1 (1.2–1.6)
Smaller:
1.2 ± 0.1 (1.1–1.3)		 7 – Vieira et al. (2022)
H. jundiai R. quelen São Paulo River, Brazil Gill filaments 9.5 ± 0.4 (8.8–10.0) 4.6 ± 0.4 (4.1–5.5) – 17.3 ± 1.8 (14.1–19.8) 26.9 ± 1.9 (22.9–29.2) 4.9 ± 0.3 (4.6–5.5) 1.4 ± 0.2 (1.2–1.7) 6–7 – Negrelli et al. (2019)
H. novaerae R. quelen São Paulo River, Brazil Gill filaments 10.7 ± 0.5 (10.1–11.6) 3.8 ± 0.3 (3.2–4.2) 3.5 ± 0.3 (3.1–4.0) 14.7 ± 1.4 (11.5–16.1) 24.9 ± 0.9 (23.3–26.8) 4.8 ± 0.4 (3.8–5.5) 1.3 ± 0.2 (1.1–1.7) 6 – Vieira et al. (2022)
H. quelen R. quelen Paracauari River, Brazil Kidney 15.6 ± 0.8 (14.3–16.4) 4.1 ± 0.3 (3.9–4.4) – 24.3 ± 2.2 (21–26.5) 40.0 ± 2.8 (37.0–42.8) 5.5 ± 0.5 (5.2–6.0) 1.6 ± 0.2 (1.4–1.8) – – Abrunhosa et al. (2018)
H. rhamdia R. quelen Brazil Gills 13.1 ± 1.1 5.2 ± 0.5 – 36.9 ± 1.6 50.0 ± 1.8 4.7 ± 0.4 1.1 ± 0.2 10–11 – Matos et al. (2005)
Myxobolus arariensis R. quelen Arari River, Brazil Musculature 11.4 (10.7–12.6) 7.2 (6.4–7.9) – – – 4.0 ± 0.7 (3.6–4.3) 1.9 ± 0.36 (1.7–2.2) – – Abrunhosa et al. (2018)
Myxobolus marajoensis Rhamdia quelen Paracauri River, Brazil Muscular layer of the intestine 10.9 (10.0–11.6) 5.1 (4.2–5.4) – – – 5.3 ± 0.6 1.6 ± 0.36 – – Abrunhosa et al. (2017)
Open in a new tab

Histopathology: Longitudinal section of hemibranchia showed that plasmodia were located within the multi-layered epithelium of the gill filaments. Most plasmodia were situated in the middle zone of the hemibranchs (Fig. 1). However, some plasmodia were observed at the end of the filaments submerging in the multi-layered epithelium (Fig. 3C−F), and the epithelium over plasmodia became thinner, reducing its thickness. A single layer of connective tissue bordered the relatively thick eosinophilic wall of each plasmodium (Fig. A–F). The afferent branchial artery is located between the plasmodia and extracellular cartilaginous matrix produced by chondrocytes at the centre of the gill ray (Fig. 3A−B). Extension of the gill filaments indicated disruption of the normal lamellar architecture. Few plasmodia were found containing with different stages of Henneguya myxospores, the matured in the centre and semi-matured in the periphery (Fig. 3E−F). No inflammatory response was evident.

Fig. 3.

Fig. 3

Open in a new tab

Histological sagittal sections of the gill filaments of Rhamdia guatemalensis. (A, B) Mature plasmodia (p) located in the filament with a thick plasmodial wall (black arrow). Afferent branchial artery (af), chondrocytes (c), extracellular cartilaginous matrix (arrowhead), and efferent branchial artery filled with erythrocytes (e) are visible. Epithelium (ep) on the opposite site of the filament is visible. (C, D) Mature plasmodia (p) situated at the end of the filament; (E, F) Immature plasmodium (ip) at the end of the filament showing peripheral sporogonic stages (white arrows) and centrally located mature myxospores (asterisk). Note: All plasmodia are enclosed by thick plasmodial wall (black arrow).

3.3. Molecular and phylogenetic analyses

Three nucleotide sequences of the 18S rDNA with a total length of 1501 bp, 1590 bp, and 1603 bp, and one sequence of the 28S rDNA (1164 bp) were obtained from the infected specimens of R. guatemalensis. The phylogenetic ML and BI trees of the 18S rDNA and 28S rDNA showed similar topologies; therefore, the Bayesian trees were employed to represent the genetic relationships (Fig. 4). In the tree of the 18S rDNA phylogeny (Fig. 4A), the three sequences of Henneguya pallida n. sp. were grouped in a well-supported clade (PP = 0.97 and BS = 96 %), and these sequences are sister to a clade that includes two candidate myxozoan species (OMsCVII species 15 and OMsCVII species 16) from R. quelen gall bladder collected in the southwest of the Mexican Pacific region, Mexico (PP = 0.76 and BS = 54 %). In turn, these two clades form a well-supported monophyletic clade (PP = 1.0 and BS = 97 %) with all Henneguya species reported from R. quelen from Brazil and Mexico, as well as two sequences of one candidate myxozoan species (OMsCVII species 18) collected from the intestine and kidney of R. guatemalensis in Mexico.

In the case of the 28S rDNA phylogeny (Fig. 4B), there are no records of Henneguya species for R. guatemalensis or R. quelen. The H. pallida n. sp. consensus sequence is within a clade that includes the genus Henneguya of various species (PP = 1.0 and BS = 100 %). However, H. pallida n. sp. showed no close relationship with any species. Due to the lack of 28S rDNA sequences associated with myxozoan species reported for R. guatemalensis and R. quelen, the genetic distance was calculated with the 18S rDNA sequences. The three nucleotide sequences of the 18S rDNA of H. pallida n. sp. show genetic distances from 0.33 % to 0.80 % among each other, and 1.90−9.68 % with the species reported in R. guatemalensis and R. quelen. The genetic distance with the rest of the species included in the Henneguya species clade from R. quelen ranged from 4.11 % to 10.06 % (Table 3).

Table 3.

Genetic p-distance values in percentage of Henneguya pallida n. sp. and closely related species based on the 18S rDNA sequence data.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
1. Henneguya pallida n. sp. (PX477049)
2. Henneguya pallida n. sp. (PX477050) 0.53
3. Henneguya pallida n. sp. (PX477051) 0.80 0.33
4. Myxozoa sp. OMsCVII species 16 (OQ888262) 1.90 1.90 2.14
5. Myxozoa sp. OMsCVII species 15 (OQ888265) 2.97 2.97 3.21 2.62
6. Myxozoa sp.OMsCVII species 18 (OQ888281) 3.17 3.17 3.43 4.10 4.77
7. Myxozoa sp.OMsCVII species 18 (OQ888264) 3.44 3.44 3.68 4.39 4.88 0.13
8. Henneguya jundiai (MK796405) 4.76 4.11 5.01 3.57 3.70 4.91 5.01
9. Henneguya quelen (MH230064) 5.33 4.93 6.85 6.29 7.26 6.35 7.25 5.97
10. Henneguya bagre (OP070161) 5.54 5.16 6.36 5.82 6.43 6.35 6.66 6.15 6.91
11. Henneguya novaerae (OP070160) 5.84 5.50 7.36 5.15 5.28 4.41 4.92 5.99 6.22 7.52
12. Henneguya novaerae (OP070158) 5.84 5.50 5.87 5.15 5.28 4.41 4.92 5.95 6.17 7.43 0.00
13. Henneguya novaerae (OP070159) 5.84 5.51 5.87 5.16 5.28 4.41 4.92 5.94 6.16 7.42 0.00 0.00
14. Henneguya sp. (MT436270) 8.64 8.11 9.77 8.08 8.81 8.20 8.92 8.85 2.04 9.88 9.16 9.03 9.03
15. Myxobolus marajoensis (KX857727) 9.20 8.86 9.19 11.01 12.10 11.41 11.03 10.09 9.13 10.28 9.58 9.58 9.59 10.11
16. Henneguya breviscauda (OP070162) 9.68 9.19 10.06 9.62 9.29 10.45 10.11 9.13 9.48 8.13 10.72 10.67 10.67 12.26 13.41
17. Myxobolus arariensis (MG572219) 25.85 25.49 25.27 34.15 33.90 37.37 34.96 25.58 25.08 25.49 25.50 25.50 25.53 25.85 26.97 25.63
Open in a new tab

3.4. Description of myxospore morphotypes in the mesentery

Four distinct morphotypes were observed in scattered aggregates of a few myxospores throughout the mesentery (Fig. 5A). Based on taxonomic characters, one morphotype was found to belong to the genus Henneguya, and morphotype is distinguished from H. pallida n. sp. by exhibiting sutural markings (Fig. 5B). The remaining three morphotypes belong to the genus Myxobolus, differing in shape and size. The Myxobolus morphotypes were designated as follows: Myxobolus morphotype 1 (Fig. 5C−D), Myxobolus morphotype 2 (Fig. 5E−F, and Myxobolus morphotype 3 (Fig. 5G−H). Myxobolus morphotype 1 and morphotype 2 were the most abundant myxospores in the mesentery, and a few and dispersed myxospores of Henneguya sp. and Myxobolus morphotype 3 were observed. During molecular procedures, only double peaks and poor-quality sequences were obtained. Consequently, only morphological descriptions would be reported:

Fig. 5.

Fig. 5

Open in a new tab

Morphotypes of myxospores found in the mesentery of Rhamdia guatemalensis. (A) Aggregate of myxospores in the mesentery; (B) Henneguya sp., (C, D) Myxobolus morphotype 1, (E, F) Myxobolus morphotype 2, (G, H) Myxobolus morphotype 3. Note: and sutural marks are indicated with arrowheads, and Fig. 5B–D and F are Lugol-stained myxospores.

Henneguya sp. (n = 1): Myxospores are elongated with ellipsoidal or slightly spindle-shaped in frontal view, with two tapering caudal appendages. The sutural ridge presents sutural markings. 12.3 μm length, 4.7 μm width, and two caudal appendages measuring 16.4 μm length. The two polar capsules were equal or slightly different in size, measuring 4.7 μm length and 4.1 μm width (Fig. 5B).

Myxobolus morphotype 1 (n = 9): Oval spore with two pyriform polar capsules slightly equal in size, and the sutural ridge presents sutural markings; 10.0 ± 0.5 (8.9–10.7) μm length, 5.0 ± 0.7 (3.5–5.8) μm width. The two polar capsules were equal or slightly different in size, with 4.5 ± 0.7 (3.1–5.7) μm length, and 1.2 ± 0.42 (0.8–1.4) μm width (Fig. 5C−D).

Myxobolus morphotype 2 (n = 5): The posterior end of the polar capsules slightly extends beyond the middle of the spore, 10.7 ± 0.5 (10.0–11.1) μm length, 4.9 ± 0.1 (4.8–5.0) μm width. The two polar capsules were equal or slightly different in size, measuring 5.0 ± 0.2 (4.7–5.3) μm length and 1.4 ± 0.1 (1.2–1.5) μm width. Polar tubule coiled 6−7 times (Fig. 5E−F).

Myxobolus morphotype 3 (n = 2): Oval shape with two ovoid polar capsules equal in size. The posterior end of the polar capsules is less than half the size of the body spore. 15.2 ± 0.1 (15.1–15.2) μm length, 6.8 ± 0.1 (6.8–6.9) μm width, and 3.0 μm thickness. The two polar capsules were equal or slightly different in size, 3.6 ± 0.3 (3.3–3.8) μm length, and 2.0 ± 0.3 (1.8–2.2) μm width (Fig. 5G−H).

4. Discussion

The genera Myxobolus and Henneguya belong to the family Myxobolidae (order Bivalvulida), representing approximately 50 % of the total diversity of described myxozoan species (Eiras et al., 2021; Rangel et al., 2023). Henneguya differs from Myxobolus by the presence of two caudal appendages of the myxospore valves (Lom and Dyková, 2006; Liu et al., 2019). However, in some cases, the genus Myxobolus has been described to exhibit atypical myxospores that bear Henneguya-like caudal appendages (Liu et al., 2010; Rangel et al., 2023). Phylogenetic studies have demonstrated that caudal appendages within the family Myxobolidae have emerged multiple times throughout evolution, resulting in a polyphyletic group (Andree et al., 1999; Kent et al., 2001; Fiala et al., 2015; Liu et al., 2019; Rangel et al., 2023). Therefore, considerable emphasis is placed on describing myxozoan diversity based on an integrative taxonomy approach, incorporating host preference, tissue tropism, morphological characters, and molecular data (Atkinson et al., 2015; Molnár and Eszterbauer, 2015).

In the context of an integrative taxonomic approach, only Henneguya infecting the gills of R. guatemalensis was properly described in this study. In contrast, the observation of four distinct myxospore morphotypes in the mesentery of a single host, due to a limited number of myxospores, allowed merely a brief description based on taxonomic characters. However, the recognition of a new myxozoan species cannot rely solely on morphology or genetic sequences (Molnár, 2002; Molnár et al., 2009). In our case, given the limited sample size, it is not possible to rule out the possibility that Myxobolus morphotype 1 and morphotype 2 represent the same species, and that Henneguya sp. and Myxobolus morphotype 3 may be aberrant myxospores. Reports of phenotypic plasticity and cryptic speciation events in myxozoans are well documented (Cech et al., 2012; Guo et al., 2018; Rocha et al., 2019; Colunga-Ramírez et al., 2024, 2025b), highlighting the complexity of species delimitation. Nevertheless, the observed morphological diversity in the present study suggests that R. guatemalensis may harbour more than one myxozoan species, offering valuable insights for future myxozoan studies.

No previous studies have reported infection of the siluriform gills by Henneguya in Mexico. Here, Henneguya pallida n. sp. parasitizing the gills of R. guatemalensis is well described based on histological, morphological, and molecular procedures. Morphometrically, myxospores of H. pallida n. sp. are smaller than those of the rest of the species described for R. quelen, which is the closest species to R. guatemalensis. In the case of R. quelen, in myxospore-forming plasmodia species of H. bagre, H. breviscauda, H. novaerae, and H. rhamdia were found in the gills (Matos et al., 2005; Vieira et al., 2022), However, in the case of H. jundiai, a large plasmodium was observed in the epithelial tissue adjacent to the gill arch (Negrelli et al., 2019). The histological analyses showed that plasmodia of H. pallida n. sp. are distributed throughout the filaments. In the centre of some plasmodia mature Henneguya myxospores were situated, and premature ones were at the periphery. Similar observations have been reported for H. quelen in the gills of R. quelen (Abrunhosa et al., 2018), suggesting an asynchronous development, in which the immature myxospores are arranged along the periphery of the plasmodia, and the mature myxospores are found in the central zone (Manrique et al., 2017; Abrunhosa et al., 2018).

Phylogenetically, the 18S rDNA phylogenetic tree revealed that H. pallida n. sp. belongs to a clade comprising all Henneguya species reported from the order Siluriformes, which include a subclade of myxozoan species described in R. quelen and R. guatemalensis (Fig. 4), excepting Henneguya sp. MT436270 (sequence from GenBank without any publication) from the kidney of the cichlid, Etroplus suratensis Bloch, 1970, reported in India. The overall genetic distance among the sequences of H. pallida n. sp. is less than 1 % (from 0.33 % to 0.80 %) (Table 3), which is widely accepted as a normal intraspecific variation for myxozoans (Fiala and Bartošová, 2010; Patra et al., 2018; Whipps and Kent, 2006; Colunga-Ramírez et al., 2025b). These sequences form a sister group to a clade that includes two candidate myxozoan species (OMsCVII species 15 and 16) in R. quelen from Mexico reported by Alama-Bermejo et al. (2023). Henneguya pallida n. sp. is, in turn, placed in a subclade where the sequences for potential myxozoan species are clustered together with H. novaerae. The genetic distance between the 18S rDNA sequences of H. pallida n. sp. with Myxozoa sp. OMsCVII species 16 ranged from 1.90 % to 2.14 %, and from 2.62 % to 2.97 % with OMsCVII species 15. On the other hand, the genetic distance of H. pallida n. sp. from Myxozoa sp. OMsCVII species 18 range from 3.14 % to 3.68 %. Unfortunately, the authors did not report any record about microscopy examinations to confirm whether these candidate species belong to the genus Henneguya, and molecular taxonomy based on the ribosomal genes does not support the classical spore-based taxonomic classification of Myxobolidae (Kent et al., 2001; Fiala and Bartošová, 2010). In most phylogenetic analyses of myxobolids, the positions of many species often disagree with the expected relationships deduced from the taxonomy based on the myxospore morphology. Based on the phylogenetic 28S rDNA tree, the position of H. pallida n. sp. is grouped with the Henneguya species reported from Siluriformes. Unfortunately, to date, no available sequences of myxozoan species reported in Rhamdia spp. are available for molecular comparison. The morphological and molecular analysis based on the 18S rDNA is adequate and enough to determine that the parasite in the gills of R. guatemalensis belongs to a new species.

Rhamdia guatemalensis is currently classified as “Least Concern” by the IUCN (Arroyave, 2019). However, in Mexico, it is listed as ‘subject to special protection’ (Pr) under the Official Mexican Legislation NOM-ECOL-059-SEMARNAT-2010 (DOF, 2010). This status is the consequence of its vulnerability due to its endemism, habitat specificity, and limited distribution (Julián-Caballero et al., 2024). As the global climate continues to warm, rising temperatures may also represent an additional threat to this fish species, and consequently disrupt its associated parasite diversity (Marick et al., 2023), particularly in Mexico, where the increase in temperature is 3.2 °C per century, which is higher than the global average of 2.0 °C (Estrada, 2025). This phenomenon is consistent with recent findings indicating a striking decline of parasites with complex life cycles over recent decades (Sures et al., 2023). The diversity, prevalence, and abundance of myxozoans on fish may be determined by the presence of a suitable host, given that they are host-specific to fish and have heteroxenous life cycles (Lymbery and Smit, 2023; Sures et al., 2023). Nevertheless, the impact of the decline of the host populations and their myxozoans remains unclear. The description of H. pallida n. sp. in R. guatemalensis not only expands our understanding of their associated parasite diversity, but also offers an overview of parasites that have the potential to trigger pathogenic effects.

5. Conclusion

The present study provides morphological and molecular evidence of a new Henneguya species infecting the gills of R. guatemalensis from Mexico. In contrast, the identification of four different morphotypes of myxospores infecting the mesentery is uncertain, since they could not be accurately classified at the species level based solely on morphological characters. However, despite the limited information available about myxozoan diversity in Mexico, preliminary morphological descriptions provide relevant insights into the parasitic fauna of an endemic and protected fish species in Mexico.

CRediT authorship contribution statement

Graciela Colunga-Ramírez: Writing – original draft, Visualization, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Gábor Cech: Writing – review & editing, Supervision, Resources, Methodology, Conceptualization. M. Leopoldina Aguirre-Macedo: Writing – review & editing, Resources, Conceptualization. Kálmán Molnár: Writing – review & editing. Csaba Székely: Writing – review & editing, Supervision, Resources, Project administration, Funding acquisition, Conceptualization. Boglárka Sellyei: Writing – review & editing, Supervision, Methodology, Conceptualization.

Declaration of generative AI and AI-assisted technologies in the writing process

During the preparation of this work the author(s) used Grammarly in order to check the grammar, spelling and readability of captions. After using this tool/service, the author(s) reviewed and edited the content as needed and take (s) full responsibility for the content of the publication.

Funding

This study was funded by the Stipendium Hungaricum Program (GC). Graciela Colunga-Ramírez is supported by SECIHTI, Mexico (grant number: CVU 769732).

Declaration of competing interest

The authors declare that they have no competing interests.

Acknowledgements

The authors thank to Francisco de Atocha Puc Itza and Arturo Centeno Chalé for fish collection and maintenance. We are grateful to Gregory Arjona Torres for the histological slides, Clara Vivas Rodríguez for the fish dissection laboratory support, and J. Mirella Hernández de S. for identifying the fish species.

References

  1. Abrunhosa J., Sindeaux-Neto J.L., dos Santos Â.K., Hamoy I., Matos E. Myxobolus marajoensis sp. n. (Myxosporea: Myxobolidae), parasite of the freshwater catfish Rhamdia quelen from the Brazilian amazon region. Rev. Bras. Parasitol. Vet. 2017;26:465–471. doi: 10.1590/s1984-29612017067. [DOI] [PubMed] [Google Scholar]
  2. Abrunhosa J., Sindeaux-Neto J.L., Hamoy I., Matos E.R. A new species of myxosporea, Henneguya quelen, from silver catfish Rhamdia quelen (Siluriforme: Pimelodidae) in the Amazonian region. Parasitol. Res. 2018;117:3809–3820. doi: 10.1007/s00436-018-6086-1. [DOI] [PubMed] [Google Scholar]
  3. Alama-Bermejo G., Hernández-Orts J.S., García-Varela M., Oceguera-Figueroa A., Pecková H., Fiala I. Diversity of myxozoans (Cnidaria) infecting neotropical fishes in southern Mexico. Sci. Rep. 2023;13 doi: 10.1038/s41598-023-38482-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Andree K.B., Székely C., Molnár K., Gresoviac S.J., Hedrick R.P. Relationships among members of the genus Myxobolus (Myxozoa: Bilvalvulidae) based on small subunit ribosomal DNA sequences. J. Parasitol. 1999;85:68–74. [PubMed] [Google Scholar]
  5. Arroyave J. Rhamdia guatemalensis. The IUCN red list of threatened species 2019: e.T138525825A138525831. 2019. [DOI]
  6. Atkinson S.D., Bartošová-Sojková P., Whipps C.M., Bartholomew J.L. In: Myxozoan Evolution, Ecology and Development. Okamura B., Gruhl A., Bartholomew J.L., editors. Springer International Publishing; Cham: 2015. Approaches for characterising myxozoan species; pp. 111–123. [DOI] [Google Scholar]
  7. Bartošová P., Fiala I., Hypsa V. Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide an effective tool for their molecular phylogenetics. Mol. Phylogenet. Evol. 2009;53:81–93. doi: 10.1016/j.ympev.2009.05.018. [DOI] [PubMed] [Google Scholar]
  8. Cech G., Molnár K., Székely C. Molecular genetic studies on morphologically indistinguishable Myxobolus spp. infecting cyprinid fishes, with the description of three new species, M. alvarezae sp. nov., M. sitjae sp. nov. and M. eirasianus sp. nov. Acta Parasitol. 2012;57 doi: 10.2478/s11686-012-0045-2. [DOI] [PubMed] [Google Scholar]
  9. Colunga-Ramírez G.E., Cech G., Aguirre-Macedo M.L., Molnár K., Székely C., Casal G., Sellyei B. The first report of a fish coccidian parasite, Calyptospora mexicanus n. sp. (Eimeriorina: Calyptosporidae), in Mexico. Acta Trop. 2025;268 doi: 10.1016/j.actatropica.2025.107687. [DOI] [PubMed] [Google Scholar]
  10. Colunga-Ramírez G.E., Sellyei B., Molnár K., Székely C., Cech G. Morphological and phylogenetic comparison of two myxozoan parasites infecting the gills of pikeperch (Sander lucioperca L.): henneguya gigantea and Henneguya creplini. Int. J. Parasitol.: Parasites Wildl. 2025;27 doi: 10.1016/j.ijppaw.2025.101087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Colunga-Ramírez G.E., Suhaimi N.S., Cech G., Molnár K., Székely C., Sellyei B. Morphological and molecular characterisation of two closely related species: myxobolus tihanyensis n. sp. and Myxobolus sandrae Reuss, 1906. Int. J. Parasitol.: Parasites Wildl. 2024;23 doi: 10.1016/j.ijppaw.2024.100909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Darriba D., Doallo R., Posada D. jModelTest 2: more methods, new heuristics and parallel computing. Nat. Methods. 2012;8:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. DOF Norma Oficial Mexicana NOM-059-SEMARNAT-2010. 2010. http://www.gob.mx/profepa/documentos/norma-oficial-mexicana-nom-059-semarnat-2010 [WWW Document] gob.mx. URL. 8.2.25.
  14. Eiras J.C., Adriano E.A. A checklist of new species of Henneguya Thélohan, 1892 (Myxozoa: myxosporea, Myxobolidae) described between 2002 and 2012. Syst. Parasitol. 2012;83:95–104. doi: 10.1007/s11230-012-9374-7. [DOI] [PubMed] [Google Scholar]
  15. Eiras J.C., Cruz C.F., Saraiva A., Adriano E.A. Synopsis of the species of Myxobolus (Cnidaria, Myxozoa, Myxosporea) described between 2014 and 2020. Folia Parasitol. 2021;68 doi: 10.14411/fp.2021.012. [DOI] [PubMed] [Google Scholar]
  16. Eschmeyer W.N., Fricke R., Van der Laan R. Catalog of fish: Genera, species, references. 2025. https://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp [WWW Document]. URL. 7.23.25.
  17. Estrada P.F. Mexico warming faster than the global average, Newsletter (UNAM) 2025. https://newsletter.unam.mx/index.php/2025/05/17/mexico-warming-faster-than-the-global-average/ URL. 7.31.25.
  18. Eszterbauer E., Székely C. Molecular phylogeny of the kidney-parasitic Sphaerospora renicola from common carp (Cyprinus carpio) and Sphaerospora sp. from goldfish (Carassius auratus auratus) Acta Vet. Hung. 2004;52:469–478. doi: 10.1556/avet.52.2004.4.9. [DOI] [PubMed] [Google Scholar]
  19. Ferraris C.J. Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of siluriform primary morphotypes. Zootaxa. 2007;1418 doi: 10.11646/zootaxa.1418.1.1. [DOI] [Google Scholar]
  20. Fiala I., Bartošová P. History of myxozoan character evolution on the basis of rDNA and EF-2 data. BMC Evol. Biol. 2010;10:228. doi: 10.1186/1471-2148-10-228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fiala I., Bartošová-Sojková P., Okamura B., Hartikainen H. In: Myxozoan Evolution, Ecology and Development. Okamura B., Gruhl A., Bartholomew J., editors. Springer; Cham: 2015. adaptive radiation and evolution within the myxozoa. [DOI] [Google Scholar]
  22. García-Vásquez A., Pinacho-Pinacho C.D., Guzmán-Valdivieso I., Calixto-Rojas M., Rubio-Godoy M. Neotropical sisterhood: new species of Gyrodactylus von Nordmann, 1832 (Platyhelminthes: Monogenea) infecting Rhamdia guatemalensis and Rhamdia laticauda (Siluriformes: Heptapteridae) in Mexico. J. Helminthol. 2023;97 doi: 10.1017/s0022149x22000918. [DOI] [PubMed] [Google Scholar]
  23. Guo Q., Huang M., Liu Y., Zhang X., Gu Z. Morphological plasticity in Myxobolus Bütschli, 1882: a taxonomic dilemma case and renaming of a parasite species of the common carp. Parasites Vectors. 2018;11:399. doi: 10.1186/s13071-018-2943-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hallett S.L., Diamant A. Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Dis. Aquat. Org. 2001;46:197–212. doi: 10.3354/dao046197. [DOI] [PubMed] [Google Scholar]
  25. Hernández C.L., Ortega-Lara A., Sánchez-Garcés G.C., Alford M.H. Genetic and morphometric evidence for the recognition of several recently synonymized species of trans-andean Rhamdia (Pisces: Siluriformes: Heptapteridae) Copeia. 2015;103:563–579. doi: 10.1643/CI-14-145. [DOI] [Google Scholar]
  26. Julián-Caballero C.C., Martínez-Ramírez E., Gómez-Ugalde R.M., Cruz-Arenas E. Trophic ecology and niche overlap of two sympatric species of Rhamdia (Siluriformes, Heptapteridae) from northeast Oaxaca, Mexico. Neotrop. Biol. Conserv. 2024;19:67–86. doi: 10.3897/neotropical.19.e119908. [DOI] [Google Scholar]
  27. Kappas I., Vittas S., Pantzartzi C.N., Drosopoulou E., Scouras Z.G. A time-calibrated mitogenome phylogeny of catfish (Teleostei: Siluriformes) PLoS One. 2016;11 doi: 10.1371/journal.pone.0166988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Katoh K., Rozewicki J., Yamada K.D. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings Bioinf. 2019;20:1160–1166. doi: 10.1093/bib/bbx108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kent M.L., Andree K.B., Bartholomew J.L., El-Matbouli M., Desser S.S., Devlin R.H., Feist S.W., Hedrick R.P., Hoffmann R.W., Khattra J., Hallett S.L., Lester R.J.G., Longshaw M., Palenzeula O., Siddall M.E., Xiao C. Recent advances in our knowledge of the myxozoa. J. Eukaryot. Microbiol. 2001;48:395–413. doi: 10.1111/j.1550-7408.2001.tb00173.x. [DOI] [PubMed] [Google Scholar]
  30. Kritsky D.C., Boeger W.A., Mendoza-Franco E.F., Vianna R.T. Neotropical Monogenoidea. 57. Revision and phylogenetic position of Scleroductus Jara & Cone, 1989 (Gyrodactylidae), with descriptions of new species from the Guatemalan chulin Rhamdia guatemalensis (Günther) (Siluriformes: Heptapteridae) in Mexico and the barred sorubim Pseudoplatystoma fasciatum (Linnaeus) (Siluriformes: Pimelodidae) in Brazil. Syst. Parasitol. 2013;84:1–15. doi: 10.1007/s11230-012-9387-2. [DOI] [PubMed] [Google Scholar]
  31. Liu Y., Whipps C.M., Gu Z.M., Zeng L.B. Myxobolus turpisrotundus (Myxosporea: Bivalvulida) spores with caudal appendages: investigating the validity of the genus Henneguya with morphological and molecular evidence. Parasitol. Res. 2010;107:699–706. doi: 10.1007/s00436-010-1924-9. [DOI] [PubMed] [Google Scholar]
  32. Liu Y., Lövy A., Gu Z., Fiala I. Phylogeny of myxobolidae (Myxozoa) and the evolution of myxospore appendages in the Myxobolus clade. Int. J. Parasitol. 2019;49:523–530. doi: 10.1016/j.ijpara.2019.02.009. [DOI] [PubMed] [Google Scholar]
  33. Lom J., Arthur J.R. A guideline for the preparation of species descriptions in Myxosporea. J. Fish. Dis. 1989;12:151–156. doi: 10.1111/j.1365-2761.1989.tb00287.x. [DOI] [Google Scholar]
  34. Lom J., Dyková I. Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitol. 2006;53:1–36. doi: 10.14411/fp.2006.001. [DOI] [PubMed] [Google Scholar]
  35. Lymbery A.J., Smit N.J. Conservation of parasites: a primer. Int. J. Parasitol.: Parasites Wildl. 2023;21:255–263. doi: 10.1016/j.ijppaw.2023.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Malabarba L.R., Malabarba M.C. In: Biology and Physiology of Freshwater Neotropical Fish. Baldisserotto B., Urbinati E.C., Cyrino J.E.P., editors. Academic Press; 2020. Phylogeny and classification of neotropical fish; pp. 1–19. [DOI] [Google Scholar]
  37. Manrique W.G., Figueiredo M.A.P., de Andrade Belo M.A., Martins M.L., Molnár K. Myxobolus sp. and Henneguya sp. (Cnidaria: Myxobolidae) natural co-infection in the kidney of Piaractus mesopotamicus (Characiformes: Serrasalmidae) Parasitol. Res. 2017;116:2853–2860. doi: 10.1007/s00436-017-5571-2. [DOI] [PubMed] [Google Scholar]
  38. Marick J., Patra B.K., Ash A. Loss of biodiversity and ecosystem services: told and untold stories from parasite world. Proc. Zool. Soc. 2023;76:216–223. doi: 10.1007/s12595-023-00483-4. [DOI] [Google Scholar]
  39. Matos E., Tajdari J., Azevedo C. Ultrastructural studies of Henneguya rhamdia n. sp. (Myxozoa) a parasite from the amazon teleost fish, Rhamdia quelen (Pimelodidae) J. Eukaryot. Microbiol. 2005;52:532–537. doi: 10.1111/j.1550-7408.2005.00063.x. [DOI] [PubMed] [Google Scholar]
  40. Miller R.R., Minckley W.L., Norris S.M. University of Chicago Press; Chicago: 2005. Freshwater Fishes of México. [Google Scholar]
  41. Molnár K. Site preference of fish myxosporeans in the gill. Dis. Aquat. Org. 2002;48:197–207. doi: 10.3354/dao048197. [DOI] [PubMed] [Google Scholar]
  42. Molnár K., Eszterbauer E. In: Myxozoan Evolution, Ecology and Development. Okamura B., Gruhl A., Bartholomew J.L., editors. Springer International Publishing; Cham: 2015. Specificity of infection sites in vertebrate hosts; pp. 295–313. [DOI] [Google Scholar]
  43. Molnár K., Székely C., Hallett S.L., Atkinson S.D. Some remarks on the occurrence, host-specificity and validity of Myxobolus rotundus Nemeczek, 1911 (Myxozoa: Myxosporea) Syst. Parasitol. 2009;72:71–79. doi: 10.1007/s11230-008-9161-7. [DOI] [PubMed] [Google Scholar]
  44. Negrelli D.C., Vieira D.H.M.D., Tagliavini V.P., Abdallah V.D., De Azevedo R.K. Molecular and morphological analysis of Henneguya jundiai n. sp. (Cnidaria: Myxosporea), a new parasite of the gills of Rhamdia quelen in Brazil. Acta Trop. 2019;197 doi: 10.1016/j.actatropica.2019.105053. [DOI] [PubMed] [Google Scholar]
  45. Patra S., Bartošová-Sojková P., Pecková H., Fiala I., Eszterbauer E., Holzer A.S. Biodiversity and host-parasite cophylogeny of Sphaerospora (sensu stricto) (Cnidaria: Myxozoa) Parasites Vectors. 2018;11:347. doi: 10.1186/s13071-018-2863-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rambaut A. University of Edinburgh; Edinburgh: 2018. FigTree: Tree Figure Drawing Tool.http://tree.bio.ed.ac.uk/ [WWW Document]. URL. 7.23.25. [Google Scholar]
  47. Rangel L.F., Santos M.J., Rocha S. Synopsis of the species of Henneguya Thélohan, 1892 (Cnidaria: Myxosporea: Myxobolidae) described since 2012. Syst. Parasitol. 2023;100:291–305. doi: 10.1007/s11230-023-10088-2. [DOI] [PubMed] [Google Scholar]
  48. Rocha S., Azevedo C., Oliveira E., Alves Â., Antunes C., Rodrigues P., Casal G. Phylogeny and comprehensive revision of mugiliform-infecting myxobolids (Myxozoa, Myxobolidae), with the morphological and molecular redescription of the cryptic species Myxobolus exiguus. Parasitology. 2019;146:479–496. doi: 10.1017/S0031182018001671. [DOI] [PubMed] [Google Scholar]
  49. Ronquist F., Teslenko M., van der Mark P., Ayres D.L., Darling A., Höhna S., Larget B., Liu L., Suchard M.A., Huelsenbeck J.P. MrBayes 3.2: efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012;61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sures B., Nachev M., Schwelm J., Grabner D., Selbach C. Environmental parasitology: stressor effects on aquatic parasites. Trends Parasitol. 2023;39:461–474. doi: 10.1016/j.pt.2023.03.005. [DOI] [PubMed] [Google Scholar]
  51. Tamura K., Stecher G., Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021;38:3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Van der Auwera G., Chapelle S., De Wachter R. Structure of the large ribosomal subunit RNA of Phytophthora megasperma, and phylogeny of the oomycetes. FEBS Lett. 1994;338:133–136. doi: 10.1016/0014-5793(94)80350-1. PMID: 8307170. [DOI] [PubMed] [Google Scholar]
  53. Velasco M., Xavier K.C., Furtado A.M.M., Eduard J., Sindeaux-Neto J.L. New Henneguya species cause gill disease of commercial amazonian fish. Acta Parasitol. 2025;70 doi: 10.1007/s11686-024-00980-2. [DOI] [PubMed] [Google Scholar]
  54. Vieira D.H.M.D., Narciso R.B., Silva R.J. Diversity of myxozoans parasitizing the catfish Rhamdia quelen (Siluriformes: Heptapteridae), in Southeastern Brazil, based on morphological and molecular evidence. Sci. Rep. 2022;12 doi: 10.1038/s41598-022-22418-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Whipps C.M., Kent M.L. Phylogeography of the cosmopolitan marine parasite Kudoa thyrsites (Myxozoa: Myxosporea) J. Eukaryot. Microbiol. 2006;53:364–373. doi: 10.1111/j.1550-7408.2006.00114.x. [DOI] [PubMed] [Google Scholar]
  56. Whipps C.M., Grossel G., Adlard R.D., Yokoyama H., Bryant M.S., Munday B.L., Kent M.L. Phylogeny of the Multivalvulidae (Myxozoa: Myxosporea) based on comparative ribosomal DNA sequence analysis. J. Parasitol. 2004;90:618–622. doi: 10.1645/GE-153R. [DOI] [PubMed] [Google Scholar]

Articles from International Journal for Parasitology: Parasites and Wildlife are provided here courtesy of Elsevier

RESOURCES