Abstract
Food-producing animals are key reservoirs of zoonotic Campylobacter species, mainly C. jejuni and C. coli, causing human gastroenteritis and animal reproductive issues. Epidemiological data on these pathogens in Nigeria are scarce, limiting control efforts. This study reports the first molecular epidemiology and clonal analysis of Campylobacter from humans and animals in Enugu State, Nigeria. Isolates were obtained using standard microbiological methods. Molecular identification employed conventional PCR, while genetic relatedness was assessed via ERIC-PCR. Campylobacter coli (61.1%) was the predominant species isolated in this study. The overall prevalence of Campylobacter species infections (CSI) was 18.5% (224/1,212). The host-specific prevalence were 16.5% (67/406), 20.4% (85/416) and 18.5% (72/390) for slaughtered cattle, poultry, and humans, respectively. In slaughtered cattle, CSI was significantly [χ2 (1) = 5, p = 0.032] associated with seasons but not with breed, age, sex and location. The infection was significantly [χ2 (1) = 8.9, p = 0.003] higher in broilers (26.2%, 56/214) when compared to other poultry types. Human CSI was higher in those aged ≥ 18 years (19.9%, 48/241), males (20.5%, 34/166) and slaughterhouse workers (25.2%, 26/103). In children, Campylobacter infection was prevalent in males (23.8%) than in females (10.5%). In pregnant women, CSI increased with both age and parity levels. The prevalence of Campylobacter infections was significantly higher (P < 0.05) during the rainy/wet season than in the dry/hot season in all three species studied. The ERIC-PCR fingerprinting provided evidence of inter-species and geospatial genetic relatedness in the 20 C. coli isolates tested. The findings warrant a One Health control approach against CSI in Enugu State, Nigeria, to mitigate the potential public health and socioeconomic consequences.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-34067-3.
Keywords: Campylobacter species infections, ERIC-PCR, Food-producing animals, Genetic relatedness, Molecular epidemiology, Humans, Nigeria
Subject terms: Diseases, Microbiology, Molecular biology
Introduction
The Campylobacter organisms were first identified in 1886 by Theodor Escherich, a German-Austrian paediatrician, who reported that some unknown spiral-shaped bacteria from stool samples of children caused gastrointestinal disorders in the patients1,2. He named the condition “summer complaint” and called the aetiological agent “Cholera infantum”1–3. Since then, thermophilic Campylobacter species (TCS), particularly C. jejuni and C. coli, have remained the leading causes of human bacterial foodborne gastroenteritis globally4,5. Recently, gastroenteritis caused by TCS in humans and animals has surpassed that caused by traditional enteric bacteria like E. coli, Salmonella, and Shigella species in some parts of the world6–8. Even though all warm-blooded animals are susceptible to Campylobacter species colonisation or infection, food-producing animals (FPA) and pets (cats and dogs) harbour the organism much more than other animals and are, therefore, the primary reservoirs of TCS for human infection via the food chain and occupational exposure9,11. Zoonotic Campylobacter infections (ZCI) are common in children (< 5 years), immune-compromised individuals, occupationally at-risk persons and haemoglobinopathy patients compared to other human populations12,13.
Campylobacter infections are primarily transmitted via the faecal-oral route. Human infection occurs through the ingestion of contaminated food or water, particularly poultry products (chicken and eggs), beef, unpasteurized milk, and untreated ground water5,14–16. The ZCI can also ensue through occupational exposure among animal health workers, animal handlers and livestock farmers, particularly if infection control measures at workplaces, such as the use of personal protective equipment (PPE), are jettisoned17–20. Infected animals, including FPA, wild birds and pets (dogs and cats) can contaminate food or drinking water sources with faecal matter, resulting in ZCI21,22. In addition to the faecal-oral route, Campylobacter species can be transmitted via coitus, such as breeding with infected animals or community bull syndrome23,24. Reverse zoonotic transmission of Campylobacter species can also occur, leading to the spread of human Campylobacter infections to animals (especially pets), and even contamination of the environment25.
The public health significance of animal Campylobacter infections, particularly poultry, is that food-producing animals and pets are major reservoirs of the human infection9,26,27. Nevertheless, a new species of Campylobacter species, known as C. hepaticus, has been discovered to cause spotty liver disease, particularly in free-range laying birds, causing up to 15% mortality and a 35% decrease in egg lay28. Of all Campylobacter species, C. jejuni and C. coli are responsible for 95–98% of campylobacteriosis cases worldwide29,30. The TCS cause significant economic losses yearly due to the cost of treating human Campylobacter-related illnesses, and production losses in humans and animals21. Globally, the two species alone cause over 500 million cases of human campylobacteriosis annually with untoward health and economic consequences31. Therefore, it is crucial to understand the epidemiology of CSI in humans and animals in Nigeria, considering the public health importance of TCS and the roles of FPA in the transmission of zoonotic pathogens. This study is particularly important because Nigeria currently lacks national surveillance program or database information on zoonotic CSI32–34. Without this epidemiological data, it could be very challenging to develop effective national health action plans and targeted public health interventions to control the spread of these zoonoses in human and animal populations.
To effectively address this challenge and frontally combat the spread of CSI in Nigeria, it is crucial to track the molecular epidemiology and genetic relatedness of Campylobacter isolates from diverse hosts and locations. The Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) genotyping, though not the gold standard, provides a simple, fast, reproducible and cost-effective means of differentiating bacterial genomes across various bacteria, including Campylobacter species31,35. This technique detects the similarities or diversities in the banding patterns of Campylobacter species, to determine their genetic relatedness using various bioinformatics software. The moderate-resolution power, simplicity, cost-effectiveness, rapid nature, and reproducibility of ERIC-PCR fingerprinting make it a very useful genotyping tool, particularly in resource-limited settings31,35. Consequently, this study determined the molecular epidemiology and genetic relatedness of Campylobacter species from human and food-producing animal sources in Nigeria, using the ERIC-PCR technique.
Materials and methods
Ethical approval, study area, study population and study design
Ethical approval for this work was granted by the Research Ethics Committee of the Enugu State Ministry of Health, with reference number MH/MSD/REC21/232. All methods and procedures were performed in accordance with the relevant guidelines and regulations, particularly as stipulated in the Helsinki declaration of the World Medical Association.
The study was conducted in Enugu State, Nigeria, located on latitude 6° 27’10” N and longitude 7° 30’40 “E with an estimated human population of six million36. The state contains three senatorial zones, each comprising at least five Local Government Areas (LGAs). Ecologically, Enugu lies within the derived savannah–tropical rainforest transition belt, characterized by warm, humid conditions that enhance the survival and transmission of zoonotic pathogens. The state experiences two distinct seasons: a wet season (May–November) and a dry season (December–April), with annual rainfall exceeding 1,500 mm and relative humidity of 60–80%.
Cattle and poultry slaughtered for human consumption at major slaughterhouses as well as at-risk-individuals (slaughterhouse workers, pregnant women and children less than five years of age) in Enugu State constituted the study population.
The study adopted a cross-sectional study design comprising (1) isolation and phenotypic identification of members of the genus, Campylobacter, from slaughtered cattle, poultry, and humans; (2) molecular speciation of selected phenotypically identified Campylobacter by Polymerase Chain Reaction (PCR); and (3) determination of the genetic relatedness of the PCR-confirmed Campylobacter species.
Selection of slaughterhouses and health facilities
Two of the three senatorial zones in Enugu State, namely, Enugu North and Enugu East zones, were purposively selected for this study. The selection was based on the availability of major slaughterhouses and Primary Healthcare Centres (PHCs) in these zones as well as the proximity of the two selected zones to the Animal Health Antimicrobial Resistance Surveillance Sentinel Laboratory, Veterinary Teaching Hospital, University of Nigeria, Nsukka - where the bacterial isolation was done. In each selected senatorial zone, three slaughterhouses where cattle or poultry are slaughtered, as well as three PHCs, were purposively selected based on the slaughter capacities and patient turnover, respectively. Consequently, six slaughter facilities and six PHCs across two senatorial zones and six LGAs were included in this study. The senatorial zones and LGAs where the selected slaughterhouses and PHCs were located are shown in Fig. 1.
Fig. 1.
Enugu State in Nigeria, showing the senatorial zones and local government areas where the selected slaughterhouses and primary healthcare centres surveyed are located (Created with ArcMap software version 10.8.2 available at https://desktop.arcgis.com).
Sample size determination, research visits and faecal sample collection
The minimum sample size (MSS) for each study population included in the work was calculated using Roasoft sample size calculator® software available online at http://www.raosoft.com/samplesize.html. Summarily, 1,212 faecal samples, which comprised 416 from poultry, 406 from cattle, and 390 from humans, were collected for isolation of Campylobacter species.
Familiarisation visits were made to the management of the health facilities and the leadership of the slaughterhouse workers’ associations in each of the selected PHCs and slaughterhouses, respectively, to solicit their support during faecal sample collection. Each of the selected slaughterhouses and PHCs was visited once per month for eight months, comprising four months during the dry season and another four months during the wet/rainy season. Through the staff of the PHCs, oral informed consent was requested and obtained from all the human subjects sampled at the health facilities for each research visit. For minors (children ≤ five years old), oral informed consent was obtained through either their parents or the guardians. Gastroenteritis patients who willingly consented to provide their stool samples were selected by simple random sampling method (SRSM) - toss of a coin. For each selected participant, a sterile swab stick moistened with peptone water (CMO009B, Oxoid, UK) was provided for the sample collection. The services of the nurses and laboratory scientists at the PHCs were employed in the stool sample collection from human subjects. Before sample collection, the staff members on duty were briefed on the method of faecal sample collection and packaging. At the selected slaughterhouses, 3 cm2 of the carcass processors’ palms (who had diarrhoea) were swabbed as there were no restrooms to permit faecal sample collection. In all human subjects sampled, the gender, location (Enugu or Nsukka), age (adult or children), risk group (slaughterhouse workers, pregnant women, children ≤ 5 years), the parity level of women participants (< 3 kids or ≥ 3 kids) and the season were determined by observation or oral interview and recorded against each sample collected.
At the slaughterhouses, rectal swabs were aseptically collected from slaughtered cattle chosen by SRSM. The age of the cattle was determined using the dentition method37. Similarly, the sex, breed, slaughterhouse location and season of the year were noted and recorded against each of the samples. For poultry, three slaughter points in each selected slaughterhouse were chosen by SRSM. Thereafter, cloaca swabs were collected from every other poultry slaughtered in each of the selected slaughter points. The poultry type, season, and location were noted and recorded against each sample. The samples were transported to the laboratory (on ice packs) and processed within three to five hours of collection for Campylobacter isolation and phenotypic identification.
Isolation and identification of Campylobacter species
The isolation and identification of the Campylobacter species were performed following previously reported standard procedures6. From a total of 224 phenotypically identified Campylobacter species, 56 isolates were selected by systematic random sampling (one in four) for molecular confirmation and speciation by multiplex PCR (m-PCR) using three specific oligonucleotide primer sequence types for simultaneous detection of Campylobacter genus, C. jejuni, and C. coli earlier reported6. The 56 selected isolates were proportionally representative of the overall number of Campylobacter species isolated per study population.
Molecular confirmation of phenotypic Campylobacter species and ERIC-PCR typing
The multiplex PCR confirmation and speciation of phenotypic Campylobacter species isolates were performed as reported by6. The oligonucleotide primer sequence used and m-PCR reaction conditions were presented as supplementary material (Supplementary file 1).
The genetic relatedness of 20 PCR-positive C. coli from different hosts and locations was determined using ERIC-PCR typing, following the procedure outlined38. The genomic DNA were amplified using the ERIC primer sets R1: ATGAAGCTCCTGGGGATTCAC and R2: AAGTAAGTGACTGGGGTGAGCG, with the following thermo-cycling conditions: initial denaturation at 95 °C for 5 min, 40 cycles of final denaturing at 95 °C for 5 s, annealing at 51 °C for 45 s, extension at 72 °C for 60 s, and final extension at 72 °C for 5 min. Thereafter, the PCR reactions were verified by resolving them in 3% agarose gel in a 5x TBE buffer stained with 5 µl of SafeView® red and electrophoresed at 120 volts for 45 min. The DNA banding patterns obtained from the ERIC-PCR were analysed to determine the genetic relatedness of the 20 C. coli isolates by constructing a dendrogram using the unweighted pair group method with arithmetic mean (UPGMA) to identify the similarity between the isolates.
Data management, analyses and presentation
The Pearson Chi-square test was used to ascertain the possible associations between CSI and the species, gender/sex, season, and geographical location. The statistical analyses were performed using GraphPad Prism®, version 8.0.2 (GraphPad Inc., San Diego, California, USA). The significance level was set at p < 0.05. Comprehensive listing of the null and alternative hypotheses tested in this study is detailed in supplementary file 2.
Results
Prevalence and distribution of Campylobacter species
Campylobacter species were isolated from 224 of the 1,212 samples processed, giving an overall prevalence rate of 18.5%. The host-specific prevalence was 16.5% (67/406), 20.4% (85/416) and 18.5% (72/390) for slaughter cattle, poultry, and humans, respectively (Table 1). There was no significant association [χ2 (2) = 2.1, p = 0.389] between Campylobacter infections and the host species (Table 1).
Table 1.
Prevalence of phenotypic Campylobacter species infections in slaughter cattle, poultry and at-risk individuals in Enugu State, Nigeria.
| Host | Number sampled |
Number infected (%) |
Number not infected (%) |
Prevalence (%) | χ2-value | P-value |
|---|---|---|---|---|---|---|
| Cattle | 406 | 67 (16.5) | 339 (83.5) | 16.5 | 2.1 | 0.389 |
| Poultry | 416 | 85 (20.4) | 331(79.6) | 20.4 | ||
| Humans | 390 | 72 (18.5) | 318 (81.5) | 18.5 | ||
| Total | 1,212 | 224 (18.5) | 988 (81.5) | 18.5 |
Pearson’s Chi-square test using GraphPad Prism®, version 8.0.4 (GraphPad Inc., San Diego, CA, USA).
The distribution of CSI according to various epidemiological factors in the slaughtered cattle, poultry and at-risk individuals are presented in Tables 2, 3 and 4, respectively. In slaughtered cattle, the infections were higher in animals less than four years old (20.3%, 25/123), male (21.2%, 29/137) and during the rainy season (20.5%, 43/210) (Table 2). The infection was significantly associated with seasons [χ2 (1) = 5, p = 0.032] but not with breed, age, sex and slaughterhouse location (Table 2).
Table 2.
Distribution of phenotypic Campylobacter species infections in slaughter-cattle (n = 406) in Enugu State, Nigeria, according to various epidemiological variables.
| Epidemiological variables |
Levels | Number sampled |
Number infected (%) |
Number not infected (%) |
χ2 -value | P-value |
|---|---|---|---|---|---|---|
| Breed | White Fulani | 338 | 55 (16.3) | 283 (83.7) | 0.78 | 0.858 |
| Others† | 68 | 12 (17.6) | 56 (82.4) | |||
| Age | < 4 years | 123 | 25 (20.3) | 98 (79.7) | 1.9 | 0.191 |
| ≥ 4 years | 283 | 42 (14.8) | 241(85.2) | |||
| Sex | Male | 137 | 29 (21.2) | 108 (78.8) | 3.3 | 0.089 |
| Female | 269 | 38 (14.1) | 231(85.9) | |||
| Season | Rainy season | 210 | 43 (20.5) | 167 (79.5) | 5 | 0.032* |
| Dry season | 196 | 24 (12.2) | 172 (87.8) | |||
| Location | Nsukka | 221 | 39 (17.6) | 182 (82.4) | 0.46 | 0.506 |
| Enugu | 185 | 28 (15.1) | 157 (84.9) |
* = significant p-value; CI = Confidence interval; Pearson’s Chi-square test (GraphPad Prism®, version 8.0.4, GraphPad Inc., San Diego, CA, USA); Others† = Muturu, Red Bororo and Sokoto Gudali.
Table 3.
Distribution of phenotypic Campylobacter species infections in poultry (n = 416) in Enugu State, Nigeria, according to various epidemiological variables.
| Epidemiological variables |
Levels | Number sampled |
Number infected (%) |
Number not infected (%) |
χ2 -value | P-value |
|---|---|---|---|---|---|---|
| Poultry types | Broilers | 214 | 56 (26.2) | 158 (72.8) | 8.9 | 0.003* |
| Others† | 202 | 29 (14.4) | 173 (85.6) | |||
| Season | Rainy/wet | 221 | 54 (24.4) | 167 (75.6) | 4.6 | 0.038* |
| Dry/hot | 195 | 31 (15.9) | 164 (84.1) | |||
| Location | Nsukka | 219 | 48 (21.9) | 171 (78.1) | 0.63 | 0.428 |
| Enugu | 197 | 37 (18.8) | 160 (81.2) |
* = significant p-value; CI = Confidence interval; Pearson’s Chi-square test (GraphPad Prism®, version 8.0.4, GraphPad Inc., San Diego, CA, USA). Others† = layers, indigenous chicken and turkey.
Table 4.
Distribution of Campylobacter species infection in humans (n = 390) in Enugu State, Nigeria, according to various epidemiological factors.
| Epidemiological variables |
Levels | Number sampled |
Number infected (%) |
Number infected (%) |
χ2 -value | P-value |
|---|---|---|---|---|---|---|
| Age | ≥ 18 years | 241 | 48 (19.9) | 193 (80.1) | 0.89 | 0.421 |
| < 18 years | 149 | 24 (16.1) | 125 (83.9) | |||
| Gender | Female | 224 | 38 (17) | 186 (83) | 0.78 | 0.792 |
| Male | 166 | 34 (20.5) | 132 (79.5) | |||
| Season | Wet/rainy | 181 | 42 (23.2) | 139 (76.8) | 5.0 | 0.027* |
| Dry/hot | 209 | 30 (14.4) | 179 (85.6) | |||
| Location | Nsukka | 215 | 41(19.1) | 174 (80.9) | 0.56 | 0.794 |
| Enugu | 175 | 31(17.7) | 144 (82.3) | |||
|
Risk group |
Butchers | 103 | 26 (25.2) | 77 (74.8) | 4.3 | 0.039* |
| Others† | 287 | 46 (16) | 241 (84) |
* = significant p-value; CI = Confidence interval; Pearson’s Chi-square test (GraphPad Prism®, version 8.0.4, GraphPad Inc., San Diego, CA, USA). Others† = pregnant women and children (< 5 years old).
In poultry, CSI was significantly associated with breed [χ2 (1) = 8.9, p = 0.003], with broilers having a higher prevalence (26.2%, 56/214) compared to other poultry breeds (Table 3). There were significant associations between Campylobacter infection and season [χ2 (1) = 4.6, p = 0.038]. The isolation of TCS in poultry was more frequent during the rainy season (24.4%, 54/221) than in the dry season (Table 3). Similarly, CSI was higher in Nsukka (21.9%, 48/219) than in Enugu (18.8%, 37/197). However, the association between the infections and slaughterhouse location did not reach significance [χ2 (1) = 0.63, p = 0.428] (Table 3).
In humans, CSI was more in people who were aged ≥ 18 years (19.9%, 48/241), males (20.5%, 34/166), butchers (25.5%, 26/103) and during the rainy season (23.2%, 42/181) (Table 4). Campylobacter infection was significantly [χ2 (1) = 5, p = 0.027] associated with the season and risk group (butchers) [χ2 (1) = 4.3, p = 0.039] but not with age, gender and location (Table 4).
The distribution of CSI in pregnant women showed that the infection increased with both age and parity level (Fig. 2). The prevalence of Campylobacter infection in pregnant women aged ≥ 30 years was 20% and these were approximately twice more likely to be infected than those < 30 years old (Fig. 2). Similarly, the prevalence of CSI in pregnant women who have had ≥ 3 children was 24.3% and the odds of the infection is three times more in this population than those that had < 3 kids (Fig. 2). Significant association (p = 0.021) existed between CSI and parity level.
Fig. 2.
Distribution of Campylobacter species infection among pregnant women (n = 138) in Enugu State, Nigeria, according to age categories and parity levels.
In children, Campylobacter infection was common in males (23.8%) than in females (10.5%) as shown in Fig. 3. The infection was significantly (p = 0.041) associated with the male gender in children than in their female counterparts (Fig. 3). In terms of age, Campylobacter infection was higher (18.2%) in infants, less than one year old, than in children between the ages of one and five years (13.9%). There was no significant association (p = 0.511) between CSI and age (Fig. 3).
Fig. 3.
Distribution of Campylobacter species infection among children (n = 149) in Enugu State, Nigeria, according to gender and age categories.
Molecular characterisation of Campylobacter species
Of the 56 phenotypically identified Campylobacter isolates selected and subjected to PCR, 64.3% (36/56) were confirmed to be Campylobacter species. The PCR-positive Campylobacter isolates showed amplifications with amplicon sizes of 857 bp, 589 bp and 462 bp for the genus Campylobacter, C. jejuni and C. coli, respectively (Supplementary file 3). The species distributions of the 36 PCR-positive Campylobacter isolates were as follows: C. coli (22/36, 61.1%), C. jejuni (3, 8.3%), C. coli and C. jejuni mixed infection (8, 22.2%) and Other Campylobacter species [not C. coli and C. jejuni (3, 8.3%)]. Slightly more Campylobacter species were confirmed from animal isolates (67.9%, 19/28) than from human isolates (60.7%, 17/28). In animals, the number of Campylobacter species confirmed from poultry isolates (68.8%, 11/16) was slightly higher than that of cattle (66.7%, 8/12). Details of the distributions of PCR-confirmed Campylobacter species from various hosts are presented in Fig. 4. There was no significant association (p = 0.998) between the occurrence of PCR-confirmed Campylobacter species and the hosts (Fig. 4).
Fig. 4.
Distribution of the 36 PCR-confirmed Campylobacter species from animal and human populations sampled in Enugu State, Nigeria.
Genetic relatedness of Campylobacter isolates
The gel image of the banding pattern produced by 20 selected Campylobacter coli used for the ERIC-PCR fingerprinting is presented in Supplementary file 4. The UPGMA dendrogram clustering image grouped the 20 isolates into four ERIC clusters and one singleton (Fig. 5). Cluster-1 had two sub-clusters with 98.5% genetic similarity (Fig. 5). In all four clusters, evidence of geospatial or inter-species (humans and animals) genetic relatedness were present in the C. coli isolates analysed. There were overlaps of Campylobacter infections between animal (cattle) and human (slaughterhouse workers, pregnant women and children) populations in cluster 1. In clusters 1 and 2, there were also overlaps of Campylobacter infections that were maintained within animal hosts (cattle and poultry) alone, while in cluster 4, the infections were maintained within the human hosts - pregnant women and children only (Fig. 5).
Fig. 5.
Dendrogram of 20 Campylobacter coli constructed based on their banding pattern as determined by ERIC-PCR. The genetic similarity indices were estimated from the arch coefficient of UPGMA. Note: Isolate identification codes with the letter “e” were sourced from Enugu while those without the letter “e” were obtained from Nsukka. Isolates’ alphabet codes “H”, “B”, “C”, “PW” and “CH” were sourced from slaughterhouse workers, poultry, cattle, pregnant women and children, respectively.
Discussion
Prevalence of Campylobacter infections in food-producing animals
The overall phenotypic prevalence of 18.5% and the host-specific prevalence of 16.5% and 20.4% in slaughtered cattle and poultry, respectively, are of great significance for public health and food safety. The public health significance is premised on the fact that C. jejuni and C. coli are zoonotic and highly infective, to the extent that 360–800 colony-forming units (CFU) of C. jejuni can elicit disease in any susceptible host29. C. jejuni and C. coli cause economically important diseases in livestock, particularly cattle, leading to substantial economic losses in dairy and beef cattle production23,39. Poultry and beef are widely consumed in Nigeria40,41, and these could constitute sources of human Campylobacter infections via the food chain. Of all the FPAs, poultry and cattle are the major reservoirs of Campylobacter species for onward transmission to humans via the food chain or occupational exposure6. Incidentally, there has been a surge in subsistence poultry and cattle rearing in Nigeria, and this may enhance the odds of human CSI through occupational exposure and animal-human cohabitation, which still subsist in most developing countries. The findings underscore the need for immediate public health action to ensure that edible animal products are not contaminated with TCS in the study area.
The 16.6% prevalence in cattle reported in this study is higher than the 4.7% and 12.9% reported in Plateau42 and Sokoto43 States, Nigeria, respectively. However, the prevalence reported in this study is lower than the 23% reported in Oyo State, Nigeria44. At the international level, the prevalence in this study is lower than the 30.9% and 33.3% reported in Bangladesh45 and Malaysia46, respectively, but higher than the 13.5% and 17.2% reported in Ethiopia47 and Egypt48, respectively. In poultry, the 20.4% overall prevalence documented is close to 22% reported in Ogun49, higher than the 5.3% documented in Lagos50, but lower than 40% and 30% reported in Plateau42 and Sokoto51 States, Nigeria, respectively. When compared globally, the 20.4% prevalence is lower than the 36.2%, 43.1%, 79.2%, 70% and 25.1% reported in Peru52, Ghana53, the UK54, Ethiopia55 and Iran56, respectively. The disparities in the findings could be due to differences in the detection procedures, diagnostic competence of the researchers, farm biosecurity/hygienic practices, and some epidemiological factors that may influence the infection dynamics at the various study locations.
The higher prevalence of TCS in poultry as compared to cattle may be due to the similitude in the physiological temperature (42 ± 1 °C) of poultry and the temperature growth requirement of TCS (42 ± 1 °C)27,32. Additionally, Hakeem and Lu57 postulated that since Campylobacter species generate glucose from non-carbohydrate sources (amino acids) via gluconeogenesis, the organisms usually find the digested protein-rich broiler ration in the gut good enough for their survival and multiplication. Therefore, the synergy of the physiological temperature (42 ± 1 °C) of poultry (which is favourable for the growth of Campylobacter species) and the presence of digested protein-rich feed in the gut may be responsible for the predominance of Campylobacter infection in poultry.
Prevalence of Campylobacter infection in humans
The 18.5% prevalence of human Campylobacter infections reported in this study is very significant given the numerous health problems associated with CSI, including gastroenteritis, diarrhoea, dysentery, GBS, reactive arthritis, irritable bowel syndrome, ulcerative colitis, and haemolytic uremic syndrome58. Furthermore, the 18.5% prevalence recorded in this study is higher than 9% reported in Plateau State42 but lower than 68%, 43.8%, 54.8% and 62.7% reported in Oyo59, Osun60, Sokoto51 and Kebbi61 States, respectively. At the international level, the 18.5% prevalence is lower than the 50.7%, 85.7%, 54.6%, 48% and 55.3% reported in Ghana62, China63, Pakistan64, Egypt65 and Ethiopia66, respectively. The dichotomy in the prevalence could be due to differences in diagnostic methods, health and physiological status of the humans sampled, sociocultural differences, food culture habits, climatic factors and other epidemiological variables capable of influencing the infection dynamics. Djennad et al.67. and Kuhn et al.68. reported that climatic factors such as short duration of sunlight and high relative humidity or rainfall predicted a high prevalence of human Campylobacter infections.
The 18.5% prevalence observed in this study represents a 10.2% increase from 8.3% reported in Enugu State in earlier studies69. This represents more than a two-fold increase in the prevalence of CI in the state in just about a decade. The surge in human infection could be due to poor slaughterhouse hygiene in most slaughterhouses in Nigeria70,71, as well as a significant increase in consumption of poultry products (chicken), which is being relished and preferred over other meat types due to its low cholesterol content72. Consumption of contaminated and undercooked chicken and other poultry products remains a major risk factor for ZCI globally73.
The preponderance of CSI in women who have had three or more children and the resultant significant association between the infection and parity level suggest that bearing more children could be a risk factor for Campylobacter infection for women in the study area. Increased parity may heighten physiological vulnerability to enteric pathogens, as multiparous women are often subject to cumulative nutritional depletion and immune modulation, including reduced cell-mediated and mucosal immunity, which facilitate bacterial colonization and persistence. Furthermore, repeated exposure to contaminated food, water, or animal products during successive pregnancies, particularly in resource-limited settings, can amplify infection risk. Hormonal and gastrointestinal changes accompanying multiple pregnancies may also disrupt gut microbial homeostasis, thereby creating a favourable niche for Campylobacter survival and proliferation. The fact that C. jejuni bacteraemia caused miscarriage in pregnant women due to the affinity of the pathogen for foetal tissues74, and that asepsis may not be guaranteed during delivery in most developing countries, supporting the finding of the present study, which suggests that CSI may increase with parity level in pregnant mothers. Similarly, the predominance of the CSI in male children and the significant association of the infection with gender in kids presuppose that male children are at greater risk of the infection than their female counterparts. This corroborates the findings of Samie et al.10. who found a higher prevalence of CSI in males among South African children (54.9%) than in females (45.1%).
Seasonality in Campylobacter infection across the species
The prevalence of CSI was significantly higher across all three species during the rainy/wet season compared to the dry season. This is expected as flooding usually occurs during the rainy season, leading to contamination of pastures, fruits, vegetables, and natural water bodies that serve as food/feed and drinking water sources for humans and animals. The higher prevalence of CSI in all three species during the rainy season is attributable to the contamination of drinking water sources, pasture lands, fruits, and vegetable gardens with animal and human faeces. This is mainly due to extensive livestock production and open defecation that persist in some developing countries. The seasonality observed in Campylobacter infections across the three species offers valuable epidemiological information that could be useful in controlling animal and human diseases. To lower the prevalence of Campylobacter infection in animals, precautionary measures such as preventing flooding of poultry pens and pasture lands, treating drinking water with water sanitizer, and improving farm biosecurity measures, especially during the rainy season, should be prioritised. Similarly, to reduce the odds of human infections, treatment of drinking water and proper washing of fruits and vegetables before consumption could be worthwhile, particularly during the rainy season.
Molecular confirmation and speciation of phenotypic Campylobacter species
The PCR confirmation of 64.3% (36/56) of the phenotypically identified TCS, selected for molecular characterisation, as Campylobacter species is higher than 22% reported from poultry in Abeokuta, Ogun State, Nigeria by Kehinde et al.49. Similarly, Samie et al.10. reported that out of 564 ELISA-positive Campylobacter isolates from South Africa, 257 (45.6%) were confirmed to have the universal 16 S rRNA gene for Campylobacter species during PCR. The differences in the prevalence of confirmed Campylobacter species in these studies may be due to discrepancies in the standard and stringency of the isolation protocols, the sensitivity of the PCR machines and the methodology used.
ERIC-PCR typing (proof of epidemiological link)
The grouping of the 20 C. coli isolates analysed into only four clusters and one singleton by the ERIC-PCR shows the high genetic relatedness of the TCS, despite their heterogeneous sources. The high clonality implies that Campylobacter species sharing very close genetic makeup were responsible for the infections in the study area. The inter-species relatedness noted in all the clusters indicates that there are animal-animal and animal-human cross-Campylobacter infections in the state, and this further lends credence to the One Health and zoonotic importance of Campylobacter infection in Nigeria and Enugu State in particular. Of particular interest in the clonality of the isolates is the 100% genetic relatedness shown by the organisms in cluster-1, despite being isolated from various hosts and locations. This points to the intricacy and interconnectivity of Campylobacter infections between food-producing animals (poultry and cattle) and humans, irrespective of geographical locations, human demographics or physiological status, and therefore underscores the need for a coordinated One Health approach to the infection control.
This calls for a collaborative public health action between the veterinary and medical professions to control Campylobacter infections in animal and human populations. One of the best ways to control zoonotic human infections is to limit the infection in the animal host(s). Since poultry and cattle are reservoirs of human Campylobacter infection, controlling the animal infections at the farm and slaughterhouse levels is of paramount importance in reducing human infection. A combination of strict biosecurity practices and hygienic carcass/meat processing practices can significantly reduce Campylobacter colonisation and meat contamination at the farm and slaughterhouse levels75,76. At the slaughterhouse level, routine cleaning, sanitation, disinfection of carcass/meat processing equipment, carcass denomination (treatment with 2% lactic acid) and eggshell disinfection can reduce Campylobacter contamination of meats and other edible animal products76.
Conclusion
Campylobacter species, predominantly C. coli, were detected across slaughtered cattle, poultry, and humans in Enugu State, Nigeria, with a markedly higher burden in animals, particularly broiler chickens, than in humans. Vulnerable populations, especially children under five years, exhibited greater susceptibility compared with pregnant women and slaughterhouse workers. Seasonal variation significantly influenced prevalence, with higher infection rates recorded during the rainy season. ERIC-PCR fingerprinting revealed inter-species and geospatial genetic relatedness among isolates, underscoring zoonotic transmission dynamics and cross-sectorial spread. These findings highlight the urgent need for integrated One Health surveillance and control strategies to mitigate the zoonotic and economic impacts of Campylobacter infections in endemic settings.
Limitation of the study
The study has a limitation in that only 56 of the 224 phenotypically identified Campylobacter isolates were subjected to molecular confirmation, using the PCR. Nevertheless, the findings remain robust and provide valuable insights that contribute meaningfully to the molecular epidemiology of zoonotic Campylobacter infections and transmission in the study area. It also provides information that could guide policy formulation for global One Health advancement, particularly in LMICs.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
The authors express their gratitude to Late Prof. J. A. Nwanta for his priceless supervisory role during the study. Prof. O.J. Awoyomi, Dr. E. O. Ngbede and Dr. S. S. Ngulukun are gratefully acknowledged for their invaluable assistance during the study.
Author contributions
EON: Conceptualisation, Investigation, Methodology, Visualisation, Original Manuscript Draft and Manuscript reviewKFC: Investigation, Methodology, Supervision, and Manuscript reviewJWO: Resources and Manuscript review.
Funding
This work was partly funded by the Tertiary Education Trust Fund (TETFUND), University of Nigeria, Nsukka, under the NEEDs Assessment Intervention Fund 2018 - Institutional-based Research (IBR) component.
Data availability
Data generated in this study are available within this paper and the supplementary information.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Kist, M. Who discovered Campylobacter jejuni/coli? A review of hitherto disregarded literature. Zentralblatt Bakteriol. Mikrobiol. Hygiene Ser. A: Med. Microbiol. Infect. Dis. Virol. Parasitol.261 (2), 177–186 (1986). [PubMed] [Google Scholar]
- 2.Flamm, H. The Austrian paediatrician theodor Escherich as bacteriologist and social hygienist: the 100th anniversary of his death on February 15th, 1911. Wien. Klin. Wochenschr.123 (5–6), 157–171. 10.1007/s00508-011-1533-3 (2011). [DOI] [PubMed] [Google Scholar]
- 3.Same, R. G. & Tamma, P. D. Campylobacter infections in children. Pediatr. Rev.39 (11), 533–541. 10.1542/pir.2017-0285 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Njoga, E. O. et al. Campylobacter colonisation of poultry slaughtered at Nigerian slaughterhouses: Prevalence, antimicrobial Resistance, and risk of zoonotic transmission. Trop. Med. Infect. Dis.10 (9), 265. 10.3390/tropicalmed10090265 (2025a). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Njoga, E. O. et al. Fecal carriage and multidrug resistance profiles of zoonotic Campylobacter species isolated from broilers in Nsukka. Nigeria Vet. World. 18 (11), 3409–3419. 10.14202/vetworld.2025.3409-3419 (2025b). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Njoga, E. O., Nwanta, J. A. & Chah, K. F. Detection of multidrug-resistant Campylobacter Species from food-producing animals and humans in Nigeria: public health implications and One Health control measures. Compar. Immunol. Microbiol. Infect. Dis.10.1016/j.cimid.2023.102083 (2023). [DOI] [PubMed]
- 7.Okafor, U. C. et al. Detection of multidrug-resistant Staphylococci in beef processing line. Veterinary Sci. Pract.18 (1), 25–30. 10.5152/VetSciPract.2023.222644 (2023). [Google Scholar]
- 8.Anyanwu, M. U. et al. Mobile colistin resistance (mcr) Gene-Containing organisms in poultry sector in Low- and Middle-Income countries: Epidemiology, Characteristics, and one health control strategies. Antibiot. (Basel Switzerl.)12 (7), 1117. 10.3390/antibiotics12071117 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Szczepanska, B., Andrzejewska, M., Spica, D. & Klawe, J. J. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from children and environmental sources in urban and suburban areas. BMC Microbiol.17, 1. 10.1186/s12866-017-0991-9 (2017). [DOI] [PMC free article] [PubMed]
- 10.Skarp, C. P. A., Hänninen, M. L. & Rautelin, H. I. K. Campylobacteriosis: the role of poultry meat. Clin. Microbiol. Infect.22, 103–109 (2016). [DOI] [PubMed] [Google Scholar]
- 11.Thépault, A., Rose, V., Queguiner, M., Chemaly, M. & Rivoal, K. Dogs and cats: reservoirs for highly diverse Campylobacter jejuni and a potential source of human exposure. Animals10 (5), 838. 10.3390/ani10050838 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Liu, F., Ma, R., Wang, Y. & Zhang, L. The clinical importance of Campylobacter concisus and other human hosted Campylobacter species. Front. Cell. Infect. Microbiol.8, 243. 10.3389/fcimb.2018.00243 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Samie, A. et al. Epidemiology of Campylobacter infections among children of 0–24 months of age in South Africa. Arch. Public. Health80, 107. 10.1186/s13690-022-00850-1 (2022). [DOI] [PMC free article] [PubMed]
- 14.Ugboma, A. M., Salihu, M. D., Magaji, A. A. & Abubakar, M. B. Prevalence of Campylobacter species in groundwater in Sokoto, Sokoto state. Nigeria Vet. World. 6, 285–287 (2013). [Google Scholar]
- 15.Davys, G., Marshall, J. C., Fayaz, A., Weir, R. P. & Benschop, J. Campylobacteriosis associated with the consumption of unpasteurised milk: findings from a Sentinel surveillance site, epidemiology and infection. Epidemiol. Infect.148, e16. 10.1017/S0950268819002292 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Myintzaw, P., Jaiswal, A. K. & Jaiswal, S. A review on campylobacteriosis associated with poultry meat consumption. Food Rev. Int.10.1080/87559129.2021.1942487 (2021). [Google Scholar]
- 17.Abonyi, F. O. et al. Gut balance booster as a viable alternative to antibiotic growth promoter in swine production: evaluation of the effects on growth and health parameters. Notulae Sci. Biol.14 (1), 11115. 10.15835/nsb14111115 (2022). [Google Scholar]
- 18.Ajibo, F. E., Njoga, E. O., Azor, N., Idika, K. I. & Nwanta, J. A. Epidemiology of infections with zoonotic pig parasites in Enugu State, Nigeria. Vet. Parasitol.: Reg. Stud. Rep.20, 100397. 10.1016/j.vprsr.2020.100397 (2020). [DOI] [PubMed] [Google Scholar]
- 19.Njoga, E. O. et al. Antimicrobial drug usage. Vet. Italiana57 (1), 5–12 (2021). [DOI] [PubMed]
- 20.Bernard, S. N. et al. Epidemiology of Gastrointestinal worm infections in pigs reared in Enugu State, Nigeria. J. Parasitic Dis.2021, 45. 10.1007/s12639-021-01377-y (2021). [DOI] [PMC free article] [PubMed]
- 21.World Health Organization. Key facts about Campylobacter (2020). https://www.who.int/news-room/fact-sheets/detail/campylobacter.
- 22.Ansarifar, E., Riahi, S. M., Tasara, T., Sadighara, P. & Zeinali, T. Campylobacter prevalence from food, animals, human and environmental samples in Iran: a systematic review and meta-analysis. BMC Microbiol.23 (1), 126. 10.1186/s12866-023-02879-w (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Sahin, O., Yaeger, M., Zuowei, W. & Zhang, Q. Campylobacter-associated diseases in animals. Annu. Rev. Anim. Biosci.5, 21–42. 10.1146/annurev-animal-022516-022826 (2017). [DOI] [PubMed] [Google Scholar]
- 24.Hoque, N. et al. Investigation of Campylobacter fetus in breeding bulls of private farms in Bangladesh. Vet. Med. Sci.9 (1), 417–428. 10.1002/vms3.831 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Anderson, B. D. et al. Reverse zoonotic transmission zooanthroponosis: an increasing threat to animal health. In Zoonoses: Infections Affecting Humans and Animals (ed Sing, A.) (Springer, 2023). 10.1007/978-3-030-85877-3_59-1.
- 26.Workman, S. N., Mathison, G. E. & Lavoie, M. C. Pet dogs and chicken meat as reservoirs of Campylobacter spp. In Barbados. J. Clin. Microbiol.43 (6), 2642–2650. 10.1128/JCM.43.6.2642-2650.2005 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Njoga, E. O., Ezenduka, E. V. & Nwanta, J. A. Surveillance of Campylobacter infection in Indigenous poultry reared at Nsukka. Nigeria Notulae Scientia Biol.12, 242–250 (2020). [Google Scholar]
- 28.Courtice, J. M., Mahdi, L. K., Groves, P. J. & Kotiw, M. Spotty liver disease: a review of an ongoing challenge in commercial free-range egg production. Vet. Microbiol.227, 112–118. 10.1016/j.vetmic.2018.08.004 (2018). [DOI] [PubMed] [Google Scholar]
- 29.Kaakoush, N. O., Castaño-Rodríguez, N., Mitchell, H. M. & Man, S. M. Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev.28 (3), 687–720. 10.1128/CMR.00006-15 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gahamanyi, N., Mboera, L., Matee, M. I., Mutangana, D. & Komba, E. Prevalence, risk factors, and antimicrobial resistance profiles of thermophilic Campylobacter species in humans and animals in sub-saharan Africa: a systematic review. Int. J. Microbiol.2020, 2092478. 10.1155/2020/2092478 (2020). [DOI] [PMC free article] [PubMed]
- 31.Igwaran, A. & Okoh, A. I. Human campylobacteriosis: a public health concern of global importance. Heliyon5 (11), e02814. 10.1016/j.heliyon.2019.e02814 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Njoga, E. O., Nwankwo, I. O. & Ugwunwarua, J. C. Epidemiology of thermotolerant Campylobacter infection in poultry in Nsukka agricultural zone, Nigeria. Int. J. One Health. 5, 92–98 (2019). [Google Scholar]
- 33.Njoga, E. O., Zakariya, Y. F., Jaja, I. F., Okoli, C. E., & Mshelbwala, P. P. Global epidemiology of coronavirus disease 2019. International J. One Health7 (1), 78–87 (2021).
- 34.Bikom, P. M. et al. Prevalence and distribution of bovine tuberculosis among slaughtered cattle in cross river State, Nigeria. Anim. Res. Int.18 (1), 3977–3989 (2021). [Google Scholar]
- 35.Ahmed, H. A., Hofy, E., Ammar, F. I., Tawab, A. M. A. E., Hefny, A. A. & A. A., & ERIC-PCR genotyping of some Campylobacter jejuni isolates of chicken and human origin in Egypt. Vector Borne Zoonotic Dis.15 (12), 713–717. 10.1089/vbz.2015.1836 (2015). [DOI] [PubMed] [Google Scholar]
- 36.Anonymous. GPS coordinates of Enugu, Nigeria (2024). https://latitude.to/map/ng/nigeria/cities/enugu.
- 37.Pace, J. E. & Wakeman, D. L. Determining the Age of Cattle by their Teeth (University of Florida IFAS Extension, 2003). http://www.edis.ifas.ufl.edu.
- 38.Igwaran, A. & Okoh, A. I. Molecular determination of genetic diversity among Campylobacter jejuni and Campylobacter coli isolated from milk, water, and meat samples using enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). Infect. Ecol. Epidemiol.10 (1), 1830701. 10.1080/20008686.2020.1830701 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Hoque, N., Islam, S., Haque, A. K. M. Z., Hossain, M. M. & Kabir, S. M. L. Economic loss associated with bovine campylobacteriosis in selected districts of Bangladesh. Int. J. Livest. Prod.12 (4), 183–194. 10.5897/IJLP2021.0786 (2021). [Google Scholar]
- 40.Salawu, M. B., Ibrahim, A. G., Lamidi, L. O. & Sodeeq, A. E. Consumption and consumer preference for poultry meat types in Ibadan metropolis. J. Econ. Sustainable Dev.5 (28), 22–27 (2014). [Google Scholar]
- 41.Arowolo, O. V., Oladejo, J. A., Oguntoye, T. O., Kabir, G. B. & Salako, B. A. Analysis of meat consumption pattern in Ogbomoso North local government Area, Oyo State, Nigeria. J. Appl. Sci. Environ. Manage.25 (4), 615–619 (2021). [Google Scholar]
- 42.Audu, B. J. et al. Genomic diversity and antimicrobial resistance of Campylobacter spp. From humans and livestock in Nigeria. J. Biomedical Sci.29, 7–22 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Salihu, M. D. et al. Isolation and prevalence of Campylobacter species in cattle from Sokoto State, Nigeria. Vet. Ital.45 (4), 501–505 (2009). [PubMed] [Google Scholar]
- 44.Okunlade, A. O., Ogunleye, A. O., Jeminlehin, F. O. & Ajuwape, A. T. P. Occurrence of Campylobacter species in beef cattle and local chickens and their antibiotic profiling in Ibadan, Oyo State, Nigeria. Afr. J. Microbiol. Res.9 (22), 1473–1479 (2015). [Google Scholar]
- 45.Hoque, N. et al. Prevalence, risk factors, and molecular detection of Campylobacter in farmed cattle of selected districts in Bangladesh. Pathogens10 (3), 313. 10.3390/pathogens10030313 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Premarathne, J. M. K. et al. Prevalence and antibiotic resistance against Tetracycline in Campylobacter jejuni and C. coli in cattle and beef meat from Selangor, Malaysia. Front. Microbiol.8, 2254. 10.3389/fmicb.2017.02254 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Chala, G., Eguale, T., Abunna, F., Asrat, D. & Stringer, A. Identification and characterization of Campylobacter species in livestock, humans, and water in livestock-owning households of peri-urban addis Ababa, ethiopia: A one health approach. Front. Public. Health. 9, 750551 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Ghoneim, N. H. et al. Isolation and molecular characterization of Campylobacter jejuni from chicken and human stool samples in Egypt. Food Sci. Technol.41 (1), 195–202. 10.1590/fst.01620 (2021). [Google Scholar]
- 49.Kehinde, O. O. et al. Isolation methods for molecular detection and antibiotic resistance pattern of Campylobacter spp. In layer chickens. J. Nat. Sci. Eng. Technol.19, 149–159 (2020). [Google Scholar]
- 50.Ogbor, O., Ajayi, A., Zautner, A. E. & Smith, S. I. Antibiotic susceptibility profiles of Campylobacter coli isolated from poultry farms in Lagos, Nigeria – a pilot study. Eur. J. Microbiol. Immunol.9 (2), 32–34 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Nwankwo, I. O. et al. Prevalence and molecular identification of Campylobacter species isolates from poultry and humans in Sokoto, Nigeria. Sokoto J. Veterinary Sci.15, 1–8 (2017). [Google Scholar]
- 52.Benites, C. et al. Prevalence, Tetracycline resistance and TetO gene identification in pathogenic Campylobacter strains isolated from chickens in retail markets of Lima, Peru. Antibiotics11 (11), 1580. 10.3390/antibiotics11111580 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Karikari, A., Saba, C. & Kpordze, S. Biotyping of multidrug-resistant Campylobacter jejuni from poultry and humans in Northern region of Ghana. Open. J. Med. Microbiol.11, 18–31. 10.4236/ojmm.2021.111002 (2021). [Google Scholar]
- 54.Lawes, J. R. et al. Investigation of prevalence and risk factors for Campylobacter in broiler flocks at slaughter: results from a UK survey. Epidemiol. Infect.140 (10), 1725–1737. 10.1017/S0950268812000982 (2012). [DOI] [PubMed] [Google Scholar]
- 55.Wayou, B. A. et al. Molecular survey and identification of Campylobacter spp. In layer farms In central Ethiopia. Trop. Med. Infect. Dis.7 (2), 31. 10.3390/tropicalmed7020031 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Mousavinafchi, S. B., Rahimi, E. & Shakerian, A. Campylobacter spp. Isolated from poultry in iran: antibiotic resistance profiles, virulence genes, and molecular mechanisms. Food Sci. Nutr.11 (2), 1142–1153. 10.1002/fsn3.3152 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Hakeem, M. J. & Lu, X. Survival and control of Campylobacter in poultry production environment. Front. Cell. Infect. Microbiol.10, 615049. 10.3389/fcimb.2020.615049 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Esan, O. B. et al. Factors associated with sequelae of Campylobacter and non-typhoidal Salmonella infections: a systematic review. EBioMedicine15, 100–111. 10.1016/j.ebiom.2016.12.006 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Falodun, O. I., Adesola, E. A., Ademola, E. A. & Bakarey, S. A. Faecal carriage and antibiotics resistance patterns of Campylobacter species from HIV/AIDS patients in Ibadan, Southwest Nigeria. South. Asian J. Res. Microbiol.7, 39–46 (2020). [Google Scholar]
- 60.Adekunle, O. C., Onilude, A. A. & Sanusi, T. O. Molecular identification of Campylobacter species from positive cultural stool samples of diarrhoeic children in Osun state. Open. J. Med. Microbiol.9, 8–15. 10.4236/ojmm.2019.91002 (2019). [Google Scholar]
- 61.Gwimi, P. B. et al. Prevalence of Campylobacter species in faecal samples of pigs and humans from Zuru kebbi State, Nigeria. Int. J. One Health. 1, 1–5 (2015). [Google Scholar]
- 62.Forson, A. O., Adjei, D. N., Olu-Taiwo, M. N., Quarchie, M. & Asmah, H. R. Characterization of Campylobacter-associated gastric enteritis among patients with human immunodeficiency virus (HIV) in a hospital in Accra, Ghana. PLOS ONE. 15 (10), e0240242. 10.1371/journal.pone.0240242 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Li, Y. et al. Gastroenteritis outbreak caused by Campylobacter jejuni - Beijing, China, August 2019. China CDC Wkly.2, 422–425. 10.46234/ccdcw2020.108 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Noreen, Z., Siddiqui, F., Javed, S., Wren, B. W. & Bokhari, H. Transmission of multidrug-resistant Campylobacter jejuni to children from different sources in Pakistan. J. Global Antimicrob. Resist.20, 219–224. 10.1016/j.jgar.2019.07.018 (2020). [DOI] [PubMed] [Google Scholar]
- 65.Zeinhom, M. M. A., Abdel-Latef, G. K. & Corke, H. Prevalence, characterization, and control of Campylobacter jejuni isolated from Raw milk, cheese, and human stool samples in Beni-Suef Governorate, Egypt. Foodborne Pathog. Dis.18, 322–330. 10.1089/fpd.2020.2895 (2021). [DOI] [PubMed] [Google Scholar]
- 66.Behailu, Y., Hussen, S., Alemayehu, T., Mengistu, M. & Fenta, D. A. Prevalence, determinants, and antimicrobial susceptibility patterns of Campylobacter infection among under-five children with diarrhoea at governmental hospitals in Hawassa city, Sidama, ethiopia: a cross-sectional study. PLOS ONE. 17 (5), e0266976 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Djennad, A., Lo Iacono, G. & Sarran, C. Seasonality and the effects of weather on Campylobacter infections. BMC Infect. Dis.19, 255. 10.1186/s12879-019-3840-7 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Kuhn, K. G., Nygård, K. M. & Guzman-Herrador, B. Campylobacter infections expected to increase due to climate change in Northern Europe. Sci. Rep.10, 13874. 10.1038/s41598-020-70593-y (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Ohanu, M. E. & Offune, J. The prevalence of Campylobacter in childhood diarrhoea in Enugu state of Nigeria. J. Commun. Dis.41 (2), 117–120 (2009). [PubMed] [Google Scholar]
- 70.Njoga, E. O. et al. Pre-slaughter, slaughter, and post-slaughter practices of slaughterhouse workers in South-East, nigeria: animal welfare, meat quality, food safety and public health implications. PLOS ONE. 18, e0282418. 10.1371/journal.pone.0282418 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Ugwu, P. C. et al. Indiscriminate slaughter of pregnant goats for meat in Enugu, nigeria: causes, prevalence, implications and ways-out. PLOS ONE. 18 (1), e0280524. 10.1371/journal.pone.0280524 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Abegunrin, O. O. et al. Perception of white meat consumption among urban households in Ibadan North local government of Oyo state. Global J. Agric. Sci.20, 11–17 (2021). [Google Scholar]
- 73.Njoga, E. O. et al. Systematic review and meta-analysis of Campylobacter species infections in humans and food-producing animals in Nigeria, 2002–2023: the imperative of a one health control approach. One Health. 20, 101029. 10.1016/j.onehlt.2025.101029 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Mariette, F., Amrane, S., Couteau, C., Lagier, J. C. & Eldin, C. Campylobacter jejuni infection associated with miscarriage, a case report and literature review. J. Reprod. Immunol.141, 103153. 10.1016/j.jri.2020.103153 (2020). [DOI] [PubMed] [Google Scholar]
- 75.Sibanda, N. et al. A review of the effect of management practices on Campylobacter prevalence in poultry farms. Front. Microbiol.9, 2002. 10.3389/fmicb.2018.02002 (2018). [DOI] [PMC free article] [PubMed]
- 76.Taha-Abdelaziz, K. et al. Intervention strategies to control Campylobacter at different stages of the food chain. Microorganisms11 (1), 113. 10.3390/microorganisms11010113 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data generated in this study are available within this paper and the supplementary information.





