SNAP-47 mediates somatic oxytocin dynamics in hypothalamic neurons

Abstract

The neuropeptide oxytocin (OT) plays a crucial role in regulating homeostatic responses and complex behaviors, including social interaction. OT can be released from somatodendritic regions, enabling communication through retrograde, autocrine, and volume transmission. However, the mechanisms governing somatodendritic OT dynamics and their impact on neuronal function and behavior are not yet fully understood. Our study identifies SNAP-47, a member of the SNAP-25 protein family highly expressed in the soma of peptidergic neurons in the mouse hypothalamus, where it exhibits a close interaction with OT-containing compartments localized at the plasma membrane. Knocking down SNAP-47 diminishes the recruitment of OT to the plasma membrane in the cell body under both basal conditions and following neuronal stimulation. Reducing endogenous SNAP-47 expression in vivo results in altered spontaneous synaptic transmission in oxytocinergic neurons of the paraventricular nucleus (PVN) and decreases sociability, likely due to disrupted somatic trafficking. These findings provide new insights into the molecular mechanisms governing somatic OT dynamics, its influence on hypothalamic neuromodulation, and its role in OT-dependent behaviors such as social interaction.

SNAP-47 drives somatic oxytocin trafficking in hypothalamic neurons. Its loss disrupts OT release, alters synaptic activity, and impairs sociability, uncovering a molecular pathway linking OT dynamics to social behavior.

Introduction

Hypothalamic cells residing within the paraventricular and supraoptic nuclei (PVN and SON, respectively) serve as the principal source of oxytocin (OT) in the mammalian brain¹. Beyond their neuroendocrine connection with the pituitary gland², oxytocinergic neurons extend projections throughout the brain, influencing essential functions such as food intake, fear responses, and social behaviors, including maternal care^3–9. Notably, many of these projections are dendritic rather than axonal, reflecting diverse mechanisms of OT release and signaling⁸.

Endogenous neuropeptides like OT are typically stored in large dense core vesicles (LDCVs)¹⁰, with their synthesis, transport, and release mechanisms differing from those of small synaptic vesicles (SSVs)^11–14. Pioneering work by Pow and Morris¹⁵ provided compelling electron microscopy evidence of neurosecretory granule exocytosis, likely containing OT or arginine vasopressin (AVP), from the dendrites of hypothalamic neurons. Subsequent research confirmed the postsynaptic region as an active site for neuropeptide release and highlighted the role of somatodendritic exocytosis in modulating neuronal physiology and behavior^13–17.

While somatodendritic OT was initially linked to peripheral reflexes such as milk ejection and neuroendocrine responses^13,18, recent evidence connects it to complex behaviors such as social bonding and maternal care^19–21. Despite these crucial roles, understanding the precise actions of somatic OT in the brain has been challenging due to the properties of this type of release mechanism.

Neuronal secretion of LDCVs requires prolonged, intense stimulation and occurs on a slower time scale compared to SSVs^22–25. Furthermore, OT somatodendritic exocytosis can be triggered by the mobilization of intracellular calcium without affecting electrical activity or axonal release²⁶. Conversely, firing in the cell bodies can lead to OT secretion from nerve terminals with little or no discharge from dendrites²⁶. This indicates a distinct regulatory mechanism underlying somatodendritic OT exocytosis, differing from traditional axonal release. Identifying this mechanism could pave the way for targeted manipulation of somatodendritic OT, allowing to elucidate its specific contributions to neuronal function and behavior.

A recent study using a genetically encoded OT sensor²⁷ has shown that the expression of tetanus toxin light chain (TeNT), which specifically cleaves VAMP isoforms 1–3²⁸, had no significant effect on OT dendritic release in the PVN, suggesting the involvement of a VAMP isoform distinct from those implicated in presynaptic exocytosis. In contrast, botulinum toxin serotype A light chain (BoNT/A), which severs SNAP-25²⁹, a canonical member of the presynaptic SNARE complex, reduced OT secretion at both axons and dendrites²⁷. However, these findings contrast with an earlier study that reported no detectable expression of SNAP-25 in the somatodendritic region of oxytocinergic neurons³⁰, underscoring the need for further research. This controversy is compounded by the limited studies investigating these mechanisms in neurons, and while some have explored these processes during neuronal stimulation, none have addressed OT sorting and priming under basal conditions in hypothalamic neurons.

In this study, we combined visualization of endogenous OT-containing compartments with electrophysiological and behavioral assays to investigate the molecular mechanisms governing the recruitment of OT to the somatic plasma membrane of cultured hypothalamic neurons under resting conditions and in response to stimulation. Our findings revealed SNAP-47, a member of the SNAP-25 family³¹, as a prominent SNAP isoform in the soma of hypothalamic peptidergic (OT and AVP) cells. In vitro and in vivo SNAP-47 knockdown experiments confirmed the role of this protein in OT somatic dynamics, neuronal function, and social behavior. These findings reveal a pivotal role of SNAP-47 in regulating intracellular trafficking within oxytocinergic neurons, suggesting a potential link between somatic OT release and social interaction drive³².

Results

SNAP-47 exhibits high expression levels within peptidergic neurons in the mouse hypothalamus

Given the limited understanding of the molecular mechanisms regulating somatodendritic OT dynamics, we began by examining the expression of SNAP-47, a SNAP protein isoform previously linked to postsynaptic exocytosis in hippocampal neurons^33,34, to evaluate its potential role in regulating similar processes in oxytocinergic cells.

Fluorescence immunohistochemistry in fixed mouse hypothalamic slices revealed high levels of SNAP-47 expression in several hypothalamic nuclei (Supplementary Fig. S1), including the PVN and SON regions (Fig. 1a, b), where substantial colocalization with OT-positive cells was observed (Fig. 1a, b: Percentage of OT cells expressing SNAP-47: PVN: 70.3 ± 5.0%; SON: 65.3 ± 3.2%). A similar degree of colocalization between SNAP-47 and OT was observed in cultured oxytocinergic neurons (Fig. 1c: Percentage of OT cells expressing SNAP-47 in cultured neurons: 71.0 ± 6.0%), suggesting that the culture environment mimics physiological conditions in terms of SNAP-47 and OT co-expression. SNAP-47 labeling was predominantly found in the cell body (Fig. 1d, e; Supplementary Fig. 2), where it colocalized with the OT signal (Fig. 1d).

Fig. 1. SNAP-47 is expressed in oxytocinergic neurons.

a A schematic of mouse hypothalamic nuclei highlights the PVN, with oxytocinergic and vasopressinergic cells indicated in red and green. The pie chart above shows the percentage of oxytocinergic cells expressing SNAP-47 (n = 10 mice). A representative image from immunohistochemistry experiments on wild-type mouse PVN is shown. Oxytocinergic cells are indicated in green, SNAP-47-positive cells appear in red, and nuclei stained with DAPI are shown in blue. Arrows in (a–c) indicate representative cells exhibiting clear colocalization of SNAP-47 and OT staining, with only a few cells marked for clarity. Scale bar indicates 30 μm. b A schematic of mouse hypothalamus highlights the SON. The percentage of oxytocinergic cells expressing SNAP-47 is depicted in the pie chart above (n = 10 mice). A representative image of immunohistochemistry experiments on wild-type mouse SON is shown. Scale bar indicates 30 μm. c The cartoon depicts cultured hypothalamic neurons from wild-type mice, containing both oxytocinergic and vasopressinergic cells. Mouse embryo schematic to create the figure was obtained from DataBase Center for Life Science BCLS under the Creative Commons Attribution 4.0 International license. The pie chart above shows the percentage of oxytocinergic cells expressing SNAP-47 under the same culture conditions used for OT chasing experiments (Figs. 2–5). A representative image from immunohistochemistry experiments conducted on 10 DIV hypothalamic cultured neurons is shown. Scale bar indicates 50 μm. d Representative high-magnification (63x) image of an OT neuron in the mouse PVN shows colocalization of SNAP-47 with OT at the soma. Arrows indicate potential regions of overlap between the SNAP-47 and OT signal. Additionally, SNAP-47 staining is observed in an OT-negative cell just above (indicated by an asterisk). Scale bar indicates 50 μm. e A representative 20x magnification image from double immunohistochemistry experiments targeting α-tubulin (green) and SNAP-47 (red) in mouse PVN acute slices. SNAP-47 staining consistently appears concentrated in oxytocinergic somas and is excluded from regions labeled with α-tubulin. Scale bar indicates 200 μm. Colocalization percentages between SNAP-47 and OT cells in PVN and SON slices, as well as in cultured oxytocinergic neurons was calculated from n = 70 cells (PVN and SON) and n = 150 (cultured cells), either from 5 mice or 3 cultures).

Initially, the high levels of labeling observed in the hypothalamus (Supplementary Fig. S3a) with the commercial antibody for SNAP-47 raised concerns about its specificity. However, the low expression levels in other regions such as the olfactory bulb (Supplementary Fig. S3b) analyzed in parallel in slices from the same animals, along with the lack of staining in cells infected with a specific SNAP-47 shRNA (Jurado et al., 2013; Arendt et al., 2015; Supplementary Fig. S3c–e: % OT^SNAP-47KD - 47⁺ cells: 0.8%; mean SNAP-47 fluorescence/area (au) (non-normalized data): Control: 8.10 ± 0.80; 47^KD: 0.80 ± 0.03; Mann-Whitney p < 0.0001), confirmed the antibody’s specificity, further supporting SNAP-47 as a prominent SNAP isoform in the hypothalamus. We also observed abundant SNAP-47 expression in AVP-positive cells within the PVN and SON (Supplementary Fig. S4), two hypothalamic nuclei enriched in this protein. SNAP-47 was detectable at embryonic stage E18.5 and in newborns (Supplementary Fig. S5), indicating its early presence in these hypothalamic regions. In contrast, immunostaining experiments revealed no expression of SNAP-25 in the soma of oxytocinergic neurons, neither in fixed tissue (PVN and SON, Supplementary Fig. S6a, b), nor in cultured hypothalamic neurons (Supplementary Fig. S6c), consistent with a previous study by Tobin et al.³⁰ in the rat hypothalamus.

SNAP-47 colocalizes with OT-containing compartments in close proximity to the somatic plasma membrane

We then sought to test whether SNAP-47 expression in the soma of oxytocinergic neurons could mediate OT dynamics. Given the challenge of reliably labeling OT due to its small size (9 amino acids in its mature form), we established a chasing procedure using calcium-free, non-permeabilizing solutions (Fig. 2a, see Materials and Methods for details), to visualize endogenous OT- and SNAP-47-enriched microdomains near the plasma membrane. By focusing on molecules at or near the cell surface, this strategy minimizes interference from intracellular pools, reducing potential issues with light dispersion, ensuring that the observed signal accurately reflects protein localization at the plasma membrane rather than within internal compartments (Supplementary Fig. S7).

Fig. 2. SNAP-47 is localized in close proximity to OT-containing compartments within the somatic plasma membrane.

a A schematic representation of the chasing procedure is shown. A bright field image from a typical chasing experiment illustrates OT (green) and SNAP-47 (red) patches at the somatic plasma membrane. The yellow arrow indicates the overlapping region, which is used to quantify the correlation coefficients. The cell and nucleus contours are approximately outlined with dotted white lines and pink lines, respectively. Scale bar represents 3 μm. b A violin plot of the mean area of OT- and SNAP-47-containing patches at the somatic plasma membrane (n = 133 OT^m patches; n = 330 SNAP-47^m patches; Mann-Whitney test). c A violin plot comparing the distance between the centroids of OT and SNAP-47 patches under basal conditions, with experimental data versus a randomized control (n^experimental = 130 distance measurements, n^randomized = 150 distance measurements; Mann-Whitney test). d Distance between OT and SNAP-47 patches obtained from the randomized control (purple dots) was larger than the experimental data (blue dots). Only 9.31% of random data presented distances between OT^m and SNAP-47^m similar to the ones obtained in the experimental data set. e A violin plot of the Pearson´s correlation coefficient for interactions between the entire patch volumes (Pearson A) and the overlapping volume (Pearson B) (n = 127 measurements; Two-sample t-test Welch correction). f Density plot showing a significant difference between Pearson A and Pearson B, reflecting the difference in the area between OT- and SNAP-47-containing patches. g Violin plot of the Mander´s correlation coefficient for the overlap between SNAP-47 and OT (Manders A) and the OT signal overlapping with SNAP-47 (Manders B). Manders B is considered more precise due to the smaller area of OT patches (n = 127 measurements, Two-sample t-test Welch correction). h Density plot of Manders A and Manders B shows no significant difference. In violin plots, thick black bar represents the 25% - 75% interquartile (IQR) range; thin bars indicate the range within 1.5 x IQR; white dot indicates the median. ****p < 0.0001, ***p < 0.001, ^nsp > 0.05.

Using this approach, we consistently identified SNAP-47-enriched microdomains adjacent to OT-containing compartments in close proximity to the plasma membrane of cultured oxytocinergic cells (SNAP-47^m and OT^m, respectively; Fig. 2a). Importantly, OT expression was predominantly localized to neurons (Supplementary Fig. S8), thus minimizing the risk of mistakenly attributing OT to glial cells³⁵.

Estimation of the average area of OT^m and SNAP-47^m patches revealed that SNAP-47-labeled spots were significantly larger than OT-containing compartments (Fig. 2b: area of labeled patches in µm²: SNAP-47: 0.58 ± 0.04; OT: 0.36 ± 0.03; Mann-Whitney test p = 0.0004). Additionally, the distance between the estimated centroids of OT^m and SNAP-47^m spots was approximately 0.1 µm, significantly shorter than that observed in a randomized control conducted to confirm that the observed colocalization was not occurring by chance (Supplementary Fig. S9; Fig. 2c, d: distance between OT and SNAP-47-labeled patched in µm: Basal data: 0.09 ± 0.005; Randomized control: 5.15 ± 0.30; Mann Whitney test p < 0.0001), suggesting a close proximity between OT- and SNAP-47-containing compartments in the somatic plasma membrane.

The intensity correlation of pixel-wise colocalizing objects in each dual-color image was calculated by Pearson´s correlation coefficient (Fig. 2e, f) for interactions between either the entire patch volume (Pearson A^{total volume}: 0.60 ± 0.01) or the volume of the colocalized region (Pearson B^{colocalized region}: 0.20 ± 0.02). While these results indicated a correlation above chance, the area disparity observed between SNAP-47 and OT microdomains (Fig. 2b) could influence the Pearson´s correlation, as indicated by the significant differences between the Pearson A and Pearson B values (Fig. 2f). To obtain a more accurate estimation of the colocalization between SNAP-47^m and OT^m, the Manders´ coefficient was calculated (Fig. 2g, h). These measurements showed a high degree of the total fluorescence from SNAP-47^m overlapping with OT^m (Manders A^{SNAP-47over OT}: 0.76 ± 0.02). Additionally, a Manders B^{OT over SNAP-47} correlation coefficient was used to measure the total fluorescence from OT^m colocalizing with SNAP-47^m (Manders B^{OT over SNAP-47}: 0.75 ± 0.02). Although the two Manders coefficients did not significantly differ (Fig. 2h), the value corresponding to Manders B^{OTover SNAP-47} could be considered more precise, given the smaller area of the OT^m compartments (Fig. 2b). These findings indicated a robust interaction between SNAP-47- and OT-enriched microdomains in the somatic plasma membrane of oxytocinergic neurons.

Interaction between SNAP-47 and OT-enriched microdomains at the plasma membrane is not affected by neuronal stimulation

Our results indicated a strong association between SNAP-47 and OT at the somatic plasma membrane of cultured oxytocinergic neurons. To explore the functional implications of this interaction, we investigated potential rearrangements in response to neuronal stimulation.

To achieve the robust and sustained stimulation required to promote neuropeptide release^22–25, we initially attempted high-frequency electrical stimulation using electrodes embedded in the culture medium. However, this approach caused deleterious effects within the first few seconds of stimulation (experimental observations). Thus, cultured oxytocinergic cells were exposed to a high-potassium solution for 1 minute—a protocol previously shown to reliably induce OT release in vitro^26,36,37. This method did not produce observable toxicity (Supplementary Fig. S10a, b), even with longer incubation times, leading to OT release depletion (Supplementary Fig. S10c). Application of high-potassium solution (Fig. 3a) induced a slow and sustained depolarization in cultured oxytocinergic neurons, with minimal to no neuronal firing observed (Fig. 3b), in contrast to direct current injection through the recording pipette (Supplementary Fig. S11). This experimental setup provides an effective system for examining somatic OT release, whose priming has been reported to be mostly independent of neuronal firing and extracellular calcium^26,38(Supplementary Fig. S12), unlike axonal OT exocytosis^26,27. Due to the unique calcium requirements for somatodendritic release, optogenetic tools were deemed unsuitable for stimulation, as they can alter intracellular calcium levels^39,40.

Fig. 3. The recruitment of OT-containing compartments to the somatic plasma membrane is enhanced by neuronal stimulation.

a A schematic representation of the chasing protocol under stimulation conditions is shown. Representative images of OT (green) and SNAP-47 membrane patches (red) in cells under basal conditions and following stimulation. b A representative recording in current patch-clamp configuration shows the change in membrane potential of an oxytocinergic cell in response to stimulation with a high potassium solution for 60 s. The bath application and washout of the stimulation solution are indicated by grey arrows (Stim^IN; Stim^OUT). c A violin plot shows the number of OT and SNAP-47 membrane patches (abbreviated as OT^m and 47 ^m, respectively) under basal and stimulated conditions (n^Basal = 98 cells; n^Stim = 103 cells, from 3 different cultures; Mann-Whitney test). The number of OT^m patches significantly increases in response to stimulation, while the number of 47 ^m patches remains unchanged. Despite the increase in OT-containing patches, the number of SNAP-47 patches remains significantly higher than the number of OT-enriched microdomains after stimulation. d A violin plot of the area of labeled patches shows no significant differences between OT^m and 47 ^m patches before and after stimulation. The area difference between OT^m and 47 ^m patches is maintained across conditions. In violin plots, thick black bar represents the 25% - 75% interquartile (IQR) range; thin bars indicate the range within 1.5 x IQR; white dot indicates the median. ****p < 0.0001, *p < 0.05, ^nsp > 0.05.

OT chasing experiments revealed an increase in the number of OT-labeled patches in close proximity to the somatic plasma membrane upon neuronal stimulation compared with baseline conditions (Fig. 3c: number of OT^m-labeled patches/cell: basal: 1.80 ± 0.14; Stim: 3.00 ± 0.26; Mann-Whitney test p < 0.0001). This increase contrasted with the stability in the number of SNAP-47^m-enriched microdomains (Fig. 3c: number of SNAP-47^m-labeled patches/cell: basal: 4.00 ± 0.40; Stim: 4.00 ± 0.36; p > 0.5). The number of microdomains enriched with SNAP-47 exceeded the number of OT patches under both basal and stimulated conditions, indicating that SNAP-47 may play broader roles beyond its interaction with OT. Notably, the area of either OT or SNAP-47 patches did not significantly vary in response to stimulation (Fig. 3d: area of OT^m patches: basal: 0.36 ± 0.03; Stim: 0.34 ± 0.02, area of SNAP-47^m patches: basal: 0.58 ± 0.04; Stim: 0.66 ± 0.05), suggesting that the observed increase in OT staining was not likely due to clustering but rather the recruitment of new OT-containing organelles.

Furthermore, the distance between OT and SNAP-47 labeling (Fig. 4b), the percentage of colocalization (Fig. 4c), and the Manders B^{OT over SNAP-47} correlation coefficient (Fig. 4d, e) were unaffected in response to stimulation, suggesting that the newly recruited OT-containing compartments maintained a close interaction with SNAP-47.

Fig. 4. OT and SNAP-47 interaction at the plasma membrane is not affected by neuronal stimulation.

a Representative images of OT (green) and SNAP-47 membrane patches (red) in cells under basal conditions and following stimulation. The contours of the cell body and nucleus are approximately outlined with dotted white and red lines, respectively. Scale bar represents 3 μm. b Distribution of the distance between OT and SNAP-47 membrane patches under basal and stimulated conditions shows no significant differences were identified (n^Basal = 98 cells; n^Stim = 103 cells, from at least 3 different cultures; Mann-Whitney test). c The percentage of colocalization between OT and SNAP-47 membrane patches is not affected by neuronal stimulation. d Violin plot of the Manders B correlation coefficient between OT^m and 47 ^m patches. (n^{Basal Manders B} = 127 measurements; n ^{Stim Manders B} = 119; Mann-Whitney test). e Density plot of Manders B correlation coefficient during basal and stimulated conditions. In violin plots, a thick black bar represents the 25% - 75% interquartile (IQR) range; thin bars indicate the range within 1.5 x IQR; a white dot indicates the median. ****p < 0.0001, *p < 0.05, ^nsp > 0.05.

SNAP-47 knockdown reduces the number of OT-containing compartments at the somatic plasma membrane under both basal and stimulated conditions

The stable number of SNAP-47^m patches observed upon neuronal stimulation (Fig. 3c) indicates a direct role in OT mobilization, rather than a broad reorganization of the somatic plasma membrane. Furthermore, the consistent interaction between SNAP-47-enriched microdomains and OT-containing compartments recruited during stimulation conditions implied a functional cooperation between these two structures.

To test this hypothesis, we utilized a viral-mediated knockdown strategy to decrease endogenous SNAP-47 levels in hypothalamic cultured neurons (Supplementary Fig. S3c–e). This approach effectively reduced SNAP-47 expression in the infected OT cells (OT^SNAP-47KD cells) (Supplementary Fig. S3d: % infected OT cells/SNAP-47-negative cells (47^-): 99.20 ± 0.45; % infected OT cell/SNAP-47-positive cells (47⁺): 0.80 ± 0.02; p < 0.0001). Furthermore, the mean intensity of SNAP-47 fluorescence was significantly reduced in the PVN from infected animals (Supplementary Fig. S3e: Mean SNAP-47 fluorescence /area (a.u.): Control: 8.10 ± 0.80; SNAP-47^KD: 0.80 ± 0.03; p < 0.0001), indicating a robust reduction in protein expression upon knockdown.

OT^SNAP-47KD neurons showed a decrease in the number of OT-containing compartments near the plasma membrane under both basal conditions and neuronal stimulation (Fig. 5a, b, c: number of OT^m-labeled patches/cell: Control basal: 1.75 ± 0.11; 47^KD basal: 0.90 ± 0.24; Control Stim: 2.80 ± 0.20; 47^KD Stim: 0.50 ± 0.12), exhibiting a more significant decrease in the stimulated state (Fig. 5c: number of OT^m-labeled patches/cell: 47^KD basal: 0.90 ± 0.24; 47^KD Stim: 0.50 ± 0.12; p = 0.07).

Fig. 5. SNAP-47 knockdown reduces OT-containing compartments in the somatic plasma membrane under both basal and stimulated conditions.

a Representative images from vesicle chasing experiments in control cells, showing OT^m patches under basal and stimulated conditions. Scale bar represents 3 μm. b Representative images of cells infected with an AAV-SNAP47^KD-GFP, where OT^m patches are labeled in red. Scale bar represents 3 μm. c Violin plot shows the number of OT^m patches across conditions, indicating a significant reduction in cells infected with the SNAP-47 knockdown virus (47^KD) under both basal and stimulated conditions. d Violin plot of the mean area of OT^m patches across conditions is unaffected by 47^KD. Sample sizes are as follows: n^{Cont Basal} = 147 cells; n^{Cont Stim} = 145 cells; n^{47KD Basal} = 148 cells; n^{47KD Stim} = 152 cells; Mann-Whitney test ^nsp > 0.05, ***p < 0.001, ****p < 0.0001. In violin plots, a thick black bar represents the 25% - 75% interquartile (IQR) range; thin bars indicate the range within 1.5 x IQR; a white dot indicates the median.

SNAP-47 knockdown did not affect the area of OT^m-labeled patches (Fig. 5d: area of OT^m-labeled patches (um²): Control basal: 0.40 ± 0.07; 47^KD basal: 0.32 ± 0.06; p = 0.25; Control Stim: 0.34 ± 0.04; 47^KD Stim: 0.40 ± 0.05; p = 0.95), indicating that the reduction in OT^m patches was not due to changes in the overall size of the labeled regions. These findings suggest that SNAP-47 plays a role in regulating OT-containing compartments at the somatic plasma membrane under both resting conditions and in response to neuronal stimulation.

In vivo injection of a SNAP-47 knockdown in the PVN reduces spontaneous activity in oxytocinergic neurons

The impact of the SNAP-47 knockdown on the number of OT^m patches under basal conditions introduced a significant complication to studying its role in response to neuronal stimulation. Nonetheless, this scenario allowed us to investigate the functional consequences of reducing somatic OT. Considering that current OT sensors²⁷ present limitations in reliably detecting low peptide concentrations, such as those expected from somatic release under basal conditions⁴¹, we focused on exploring the impact of reducing OT^m-compartments on the spontaneous activity of oxytocinergic neurons, which is known to be influenced by ambient levels of OT⁴² (Supplementary Figs. S13; S14).

To this aim, we performed in vivo stereotaxic injections of either a control virus (OT^GFP) or a virus expressing the same SNAP-47 knockdown (OT^SNAP-47KD) used in cultures, into the PVN of OT-Cre mice⁴³, followed by ex vivo patch-clamp recordings in OT neurons (Fig. 6a, b). We found that both sEPSC and sIPSC exhibited a significant decrease in frequency (Fig. 6c–f: frequency sEPSC (Hz): Control OT^GFP cells: 3.84 ± 0.30; OT^SNAP-47KD cells: 3.10 ± 0.20; p = 0.03; frequency sIPSC (Hz): Control OT^GFP cells: 2.10 ± 0.20; OT^SNAP-47KD cells: 1.70 ± 0.10; p = 0.04). Interestingly, the reduction in sIPSC and sEPSC frequency caused by SNAP-47 knockdown was increased by OT receptor blockade (Supplementary Fig. S14), suggesting that ambient OT may arise from multiple sources.

Fig. 6. In vivo knockdown of SNAP-47 reduces excitatory and inhibitory spontaneous activity in PVN OT neurons.

a Schematics illustrating the in vivo stereotaxic injection of a virus expressing a specific knockdown against SNAP-47 in the mouse PVN. OT neurons in the PVN were recorded ex vivo to analyze the effect of SNAP-47 knockdown on spontaneous activity. Schematics were obtained from BioRender (www.biorender.com). b Representative image of PVN OT neurons (red) infected with AAV-SNAP-47^KD-GFP (green). Infected cells show no detectable SNAP-47 expression (white) (Supplementary Fig. 2d, e). c Cumulative probability plot of sEPSC frequency in OT^GFP and OT^SNAP-47KD (OT^47KD) cells. d Distribution plot showing sEPSC frequency across conditions. e Cumulative probability plot of sIPSC frequency in OT^GFP and OT^47KD cells. f Distribution plot of sIPSC across conditions. g Cumulative probability plot of sEPSC amplitude in OT^GFP and OT^47KD cells. h Frequency histogram for sEPSCs recorded in OT^GFP and OT^47KD cells sorted into 10 pA bins to assess the relative proportion of small and large events across conditions. No significant differences were found. i Sorting of sEPSC events in OT^GFP and OT^47KD. No significant differences were detected. j Cumulative probability plot of sIPSC amplitude in OT^GFP and OT^47KD cells. k Frequency histogram of sIPSC amplitudes recorded in OT^GFP and OT^47KD cells, sorted into 10 pA bins to evaluate the relative proportion of small and large events. Significant differences were found in the relative frequency of 20, 70 and 80 pA events. l Distribution plot of sIPSC events at 20, 70, and 80 pA recorded in OT^GFP and OT^47KD cells. While the contribution of 70 and 80 pA events was reduced, the contribution of 20 pA events was increased. Sample sizes: n^OT-GFP = 9 mice, n^OT47KD = 13 mice. Statistical analyses were conducted using the Kolmogorov-Smirnov test for panels (c, e, g, j) and the Mann-Whitney test for the remaining plots. *p < 0.05, ^nsp > 0.05. a includes a schematic of the in vivo stereotaxic injections in the mouse brain adapted from previous work (Zoe et al., “An optimized intracerebroventricular injection of CD4⁺ T cells into mice” STAR Protocols (2021); 10.1016/j.xpro.2021.100725) reused under a Creative Commons Attribution–NonCommercial (CC BY-NC 4.0) license. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Additionally, cumulative probability analyses revealed an effect on the amplitude of sIPSC, but not on sEPSCs, in OT^SNAP-47KD cells (Fig. 6g, j: amplitude sEPSC (pA): Control OT^GFP cells: 20.30 ± 0.09; OT^SNAP-47KD cells: 18.45 ± 0.08; amplitude sIPSC (pA): Control OT^GFP cells: 42.10 ± 0.25; OT^SNAP-47KD cells: 27.60 ± 0.11), indicating that SNAP-47 may have broader roles in the trafficking of key molecules for synaptic transmission, such as GABA_A receptors. To further understand the alterations to basal inhibitory transmission, we undertook a detailed analysis of the properties of spontaneous activity onto OT^SNAP-47KD cells. Different inhibitory neurons contact these cells along their somatodendritic axis⁴⁴, thus dendritic filtering provides an opportunity to evaluate the origin of IPSCs according to their amplitude and kinetic properties. Larger events typically correspond to synapses on the cell body, where the recording pipette is positioned. We sorted sEPSCs and sIPSCs into 10 pA bins, using the amplitude of these events as an estimate of their origin along the somatodendritic axis. While sEPSC amplitudes remained unaffected across the different classifications (Fig. 6h, i), OT^SNAP-47KD neurons exhibited a decrease in the relative frequency of large sIPSC (Fig. 6l: relative frequency of sIPSC events at 70 pA: Control OT^GFP cells: 3.97 ± 0.65; OT^SNAP-47KD cells: 2.50 ± 0.44; p = 0.03; relative frequency of sIPSC events at 80 pA: Control OT^GFP cells: 2.34 ± 0.44; OT^SNAP-47KD cells: 1.34 ± 0.30; p = 0.03; relative frequency of sIPSC events at 90 pA: Control OT^GFP cells: 1.37 ± 0.30; OT^SNAP-47KD cells: 0.77 ± 0.20; p = 0.04).

In parallel, the relative frequency of small sIPSC was increased, reaching statistical significance at 20 pA (Fig. 6l: relative frequency of sIPSC events at 20 pA: Control OT^GFP cells: 25.55 ± 2.30; OT^SNAP-47KD cells: 32.50 ± 2.30; p = 0.035). These results suggest that disrupting SNAP-47 may impair the insertion of GABA_A receptors into the cell body of OT cells, potentially increasing their presence at dendrites, further supporting SNAP-47´s role in regulating the recruitment of molecules to the somatic plasma membrane.

In vivo SNAP-47 knockdown in the PVN impairs sociability

Given the impact of SNAP-47 knockdown on spontaneous activity, we investigated its potential effects on behaviors dependent on the activity of oxytocinergic neurons in the PVN, with social interaction one of the most extensively associated with OT-dependent signaling in this region⁸.

Therefore, we examined the impact of decreasing SNAP-47 levels on sociability and social novelty using a three-chamber test^45,46. Animals infected with a SNAP-47 KD displayed a significant impairment in the sociability index compared to animals infected with a GFP control virus (Fig. 7a, b: sociability index: Control: 2.65 ± 0.4; 47^KD: 1.60 ± 0.2; p = 0.03). However, sociability was not completely abolished in the SNAP-47 KD-infected animals, as they still exhibited a preference for exploring the side of the cage containing a conspecific, although to a lesser extent than control mice (Fig. 7c, d: exploration time (s) control: empty: 31.30 ± 7.0; M1: 72.0 ± 9.5; p = 0.006; 47^KD: empty: 40.41 ± 4.2; M1: 59.7 ± 5.60; p = 0.02). Despite the observed impairment in sociability, the social novelty phase was unaffected by SNAP-47 KD (Fig. 7e–h: social novelty index: control: 1.97 ± 0.20; 47^KD: 2.43 ± 0.6; p = 0.2; exploration time (s) control: M1: 40.30 ± 4.4; M2: 76.2 ± 2.6; p = 0.0001; 47^KD: M1: 40.01 ± 3.3; M2: 88.2 ± 16.70; p = 0.02), suggesting that reducing SNAP-47 levels, and likely ambient somatic OT, may have a subtle yet specific impact on some basic aspects of social behavior.

Fig. 7. In vivo knockdown of SNAP-47 in the PVN impairs sociability.

a Schematic of the three- chamber test used to assess sociability. The initial sociability phase involves the test animal exploring either an empty chamber or a chamber containing a conspecific. b Dispersion plot of the mean sociability index for control animals (injected with a control GFP virus) compared to animals injected with a virus expressing SNAP-47 shRNA (47^KD, knockdown) in the PVN. c Exploration time of the empty chamber (E) versus the chamber containing an unfamiliar mouse (M1) for control animals. d Exploration time of the empty chamber (E) versus the chamber containing an unfamiliar mouse (M1) for animals injected with SNAP-47 knockdown in the PVN. e Schematic of the three-chamber test used to assess social novelty. The social novelty phase involves the test animal exploring either a familiar subject (M1) or a novel mouse (M2). f Dispersion plot of the mean social novelty index for control animals (injected with a control GFP virus) compared to animals injected with SNAP-47 knockdown in the PVN. g Exploration time of the chamber containing a familiar mouse (M1) versus the chamber containing a novel subject (M2) for control animals. h Exploration time of the chamber containing a familiar mouse (M1) versus the chamber containing a novel subject (M2) for animals injected with SNAP-47 knockdown in the PVN. Sample sizes: n^Control = 6 mice; n^47KD = 8 mice; Two-way ANOVA. ***p < 0.001, **p < 0.01, *p < 0.05, ^nsp > 0.05. a and b include schematics of the social behavior tests adapted from our previously published work (Portales et al., “Natural and pathological aging distinctively impacts the pheromone detection system and social behavior,” Mol Neurobiol, (2023); 10.1007/s12035-023-03362-3). Reused under a Creative Commons Attribution–NonCommercial (CC BY-NC 4.0) license. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Discussion

OT released from the somatodendritic compartment coordinates adjacent neural networks and exerts autocrine effects that modulate excitability and subsequent OT secretion, impacting vital physiological and behavioral processes^13,41,42. However, the molecular mechanisms underlying somatic OT release in the brain remain underexplored compared to its presynaptic action onto the posterior pituitary², limiting our knowledge on the exact roles of OT in fine-tuning neuronal activity and behavior.

This gap in our knowledge largely stems from the absence of reliable tools to directly visualize OT in cells and tissues. Although recent advancements in OT sensors^27,47,48 and in vivo fiber photometry⁴⁹ have provided valuable insights into the role of OT signaling, these tools fail to provide detailed insights into the specific subcellular compartments involved in secretion and the dynamics of OT-containing organelles. Tagging OT has been particularly challenging for several reasons. Achieving labeling specificity has been hindered by OT´s small size (9 amino acids in its mature form), making it complex to develop antibodies or sensors that exclusively target OT without cross-reacting with similar molecules like AVP. Furthermore, OT´s small size and susceptibility to degradation complicate the development of effective live-cell labeling techniques². Moreover, labeling methods may interfere with the normal function of OT-containing organelles or the release process itself, making it challenging to obtain accurate, non-disruptive measurements. These factors underscore the need for advanced labeling techniques to directly tag neuropeptides and neurotransmitters, alongside their receptors, to enable a better understanding of their cellular dynamics and role in various cellular processes.

In this study, we have addressed the recruitment of endogenous OT-containing compartments to the somatic plasma membrane using an OT chasing strategy. This protocol, which involves incubating cells in ice-cold calcium-free solutions followed by non-permeabilized fixation, preserves the natural distribution of OT on the cell surface, minimizing artifacts that could arise from intracellular organelles (Supplementary Fig. S7). Although this approach lacks single-vesicle resolution, it reduces potential confounding factors that might distort the interpretation of fluorescence data. As a result, the observed signals—while not directly measuring exocytosis—reliably reflect plasma membrane localization.

First, our analyses identified SNAP-47 expression in the cell bodies of oxytocinergic cells within the PVN and SON (Fig. 1), where it exhibited a distinctive punctate pattern. SNAP-47 was detected in approximately 70% of both oxytocinergic and vasopressinergic neurons (Fig. 1; Supplementary Fig. S4) from early developmental stages (Supplementary Fig. S5), with its expression consistently detected outside α-tubulin-positive regions (Fig. 1e). Thus, we concluded that SNAP-47 is a prominent somatic SNAP isoform in diverse types of peptidergic neurons within the mouse PVN and SON.

In cultured oxytocinergic neurons, SNAP-47-enriched microdomains largely colocalized with OT-containing compartments near the somatic plasma membrane (Fig. 2). This interaction persisted under both resting and stimulated conditions (Fig. 3), suggesting a functional correlation. Targeted SNAP-47 knockdown reduced the number of OT-containing compartments at the plasma membrane in both basal and stimulated states (Fig. 5), with the reduction being more pronounced during stimulation. These findings, along with the stable number and size of SNAP-47 patches, suggest that SNAP-47-enriched microdomains may delineate sites for OT organization near the somatic plasma membrane. These findings suggest an activity-dependent recruitment of OT vesicles to pre-existing SNAP-47 sites. The observed high colocalization and static number of SNAP-47 patches suggest that vesicle fusion is spatially restricted. Even under increased stimulation, the number of available docking sites (i.e., SNAP-47 patches) remains unchanged, while their occupancy increases due to the enhanced trafficking of OT vesicles, suggesting that SNAP-47 is not dynamically redistributed in response to activity. Furthermore, the data imply that OT vesicle recruitment does not require new SNAP-47 synthesis or redistribution.

Our results point to SNAP-47 as a suitable candidate for modulating the dynamics, trafficking, and exocytosis of somatic molecules in neurons. Identified in 2006 as a member of the SNAP protein family³¹, SNAP-47 is highly expressed in the brain at both pre- and postsynaptic sites⁵⁰. Unlike SNAP-25 and SNAP-23, SNAP-47 lacks cysteines in its linker region³¹, whose palmitoylation is essential for forming tight interactions with plasma membrane lipids⁵¹. Therefore, SNAP-47 might be well-suited for mediating release dynamics in regions lacking a stably defined active zone, such as the somatodendritic compartment of hypothalamic neurons^15,52. In fact, brain SNAP-47 has been associated with the secretion of postsynaptic endosomes that store neurotransmitter receptors in the hippocampus^33,34, while appearing to be dispensable for synaptic vesicle exocytosis in axons⁵³.

Although SNAP-47 is generally regarded as predominantly cytosolic due to its biophysical properties, the consistent number and size of SNAP-47-enriched microdomains in oxytocinergic neurons under both basal and stimulated conditions suggest that it may form or associate with stable complexes near the plasma membrane, which could, among other functions, facilitate the recruitment of OT-containing compartments. Furthermore, the observation that SNAP-47–labeled spots are larger than OT-containing compartments may suggest that SNAP-47 associates with broader vesicle trafficking or membrane compartments beyond those strictly containing OT. This could imply that SNAP-47 participates in a more extensive vesicle pool or trafficking machinery that supports somatodendritic release, possibly involving different vesicle types or stages of vesicle maturation. Notably, our data implicating SNAP-47 in GABA receptor trafficking (Fig. 6j–l) further support this notion of SNAP-47 involvement in diverse membrane trafficking processes. Alternatively, the larger SNAP-47 labeling might reflect its presence in membrane-associated complexes or scaffolding structures that organize the exocytic machinery. Consistent with this, SNAP-47 has been shown to bind key components of the SNARE complex³¹ and participate in activity-dependent exocytosis^33,34, albeit with less efficiency, than SNAP-25^31,54.

While SNAP-47 has been implicated in dendritic release triggered by high-frequency stimulation protocols that heavily depend on extracellular calcium influx—such as LTP in the hippocampus^33,34—in oxytocinergic neurons, SNAP-47 appears to play a crucial role in mobilizing OT compartments under resting conditions (Fig. 5c). This recruitment likely supports basal OT release, a process that is largely independent of extracellular calcium influx in these cells²⁶. Deficits in the constitutive replenishment of somatic OT could account for the larger reduction in OT^m patches observed in OT^SNAP-47KD cells under stimulated conditions (Fig. 5c), where ongoing exocytosis can deplete OT compartments more rapidly.

Although the presence of SNAP-47-enriched microdomains near the plasma membrane suggests a role in the final stages of sorting and release, our measurements are insufficient to precisely define the exact role of SNAP-47 in the OT secretory pathway, which may involve multiple sites and potentially overlap with other SNAP isoforms. Consequently, another SNAP isoform might also play essential roles in the final steps of OT-vesicle fusion. A recent study by Qian et al.²⁷ using a genetically encoded OT sensor proposed a role for SNAP-25 in modulating activity-dependent OT release in both axons and dendrites of PVN cells. However, the lack of detectable SNAP-25 protein expression in our fluorescence immunohistochemistry results (Supplementary Fig. S6), as well as in a previous study of rat SON OT and AVP cells³⁰, complicates the interpretation of the functional data. It is important to note, however, that interpreting immunohistochemistry findings requires caution, particularly given the challenges associated with detecting proteins at low levels. Consequently, this limitation does not exclude the possibility of protein translocation in response to stimulation, which could serve to provide additional support in response to increased demands.

Nonetheless, SNAP-47 might still be sufficient to support the slow rates of membrane fusion and release observed with our stimulation protocol, which was selected for its ability to predominantly promote somatodendritic exocytosis^26,55. Protocols involving high KCl concentrations have been shown to induce OT release and prime OT-containing vesicles in dendrites—but not in axons—through a mechanism largely dependent on intracellular calcium stores^26,56. These properties, along with evidence that OT somatodendritic fusion is not tightly linked to cell firing^38,55 (Fig. 3b), suggest that basal OT mobilization may rely on a less efficient SNARE machinery. Supporting this, OT somatodendritic release in the PVN remains unaffected by TeNT expression²⁷, which specifically cleaves VAMP1-3, indicating that the SNARE complex involved in somatic OT priming and release may include unconventional exocytic proteins such as SNAP-47^31,56 or synaptotagmin-7, which has been shown to promote the priming of LDCVs, especially at low resting calcium concentrations⁵⁷.

The comparable expression of SNAP-47 in AVP neurons (Supplementary Fig. S4) suggests that SNAP-47–mediated vesicle shuttling may also occur in these cells, despite known OT vs. AVP cell-type differences in somatodendritic release. We can speculate that while SNAP-47 may serve as a shared component of the somatodendritic release machinery in both OT and AVP neurons, the reported differences in release dynamics and other functional properties⁵⁸ may arise from distinct exocytic machinery or regulatory mechanisms. For instance, OT and AVP neurons differ in their calcium channel expression profiles⁵⁹, which could influence calcium entry dynamics and, in turn, affect vesicle priming and release^58,59. These differences are particularly relevant for understanding OT vs. AVP cell-type–specific somatodendritic release, especially within the supraoptic nucleus (SON), which contains both OT and AVP magnocellular neurons and where variations in calcium handling and excitability have been well documented^60,61. Thus, although SNAP-47 may contribute to a common vesicle trafficking framework, the functional outcomes of somatodendritic release likely diverge between OT and AVP systems due to differences in upstream signaling and calcium dynamics.

Even though the effects under basal conditions prevented us from drawing definitive conclusions about the potential role of SNAP-47 in response to neuronal stimulation, it identifies SNAP-47 as a target for manipulating basal OT dynamics to investigate its impact on synaptic transmission and behavior.

Our data suggest that reducing SNAP-47 expression in vivo decreases both inhibitory and excitatory spontaneous activity of PVN oxytocinergic cells, likely due to the disruption of local OT signaling. These findings align with the well-documented facilitator role of OT in neuronal excitability and bursting activity in OT cells within both the PVN and SON^62–69. However, the reduction in OT patches due to SNAP-47 knockdown under resting conditions made it challenging to explore the signaling pathways involved in these basal effects. For example, occlusion experiments with OT receptor antagonists to test the effect of potential disruptions in ambient OT signaling were difficult to perform because the altered baseline introduced a confounding factor that complicates interpretation. Additionally, while genetically encoded OT sensors²⁷ have been valuable for studying activity-dependent exocytosis, they may not detect the low concentrations of somatic OT release occurring under basal conditions⁴¹. Moreover, acute manipulation of SNAP-47 using specific neurotoxins is not currently feasible, as there are no botulinum toxins (such as BoNT/A, BoNT/B, etc.) that specifically target SNAP-47⁷⁰. These challenges highlight the need for developing novel tools and approaches to gain a deeper understanding of SNAP-47 function in various cellular processes.

Different inhibitory and excitatory neurons contact OT PVN cells at specific regions along their somatodendritic axis⁴⁴. Dendritic filtering allows evaluation of the origin of these synaptic contacts based on their amplitude and kinetic properties. Analysis of the amplitude of both sEPSC and sIPSC suggested that reduced activity of OT^SNAP-47KD cells could stem from a multimodal effect, including the reduction of surface GABA_A receptors (Fig. 6j-l). We found that while sEPSC amplitudes remained unaffected, OT^SNAP-47KD neurons exhibited a decrease in the relative frequency of large sIPSCs (70-90 pA; Fig. 6l), suggesting a reduced number of GABA_A receptors at the somatic plasma membrane of these cells. These findings underscore a broader role of SNAP-47 in regulating somatic trafficking in oxytocinergic neurons, while revealing a degree of specificity in its function. For example, SNAP-47 appears to be involved in sorting specific cargos, such as OT and GABA_A receptors, the latter of which are primarily localized to the soma of these cells⁴⁴, as opposed to ionotropic glutamate receptors, which remained unaffected by SNAP-47 knockdown. SNAP-47’s functions at various stages of the secretory pathway^71,72 may be regulated by the formation of distinct complexes, potentially specific to different cargos. Future research should focus on clarifying SNAP-47´s roles throughout the secretory pathway and in membrane fusion, particularly in regulating the trafficking of different proteins in neurons.

Although the functional implications of basal OT are not yet completely understood, OT somatic release is believed to contribute to activity patterns that enhance neuropeptide secretion^42,62,64,65, sustain basal hypothalamic activity⁶⁹, and support critical functions like social homeostasis³². In this context, our analysis of social interaction in animals injected with a SNAP-47 knockdown virus showed a significant decrease in sociability compared to controls (Fig. 7), suggesting a potential link between somatic OT and social behavior. However, sociability was not entirely abolished in the SNAP-47 knockdown animals (Fig. 7d), indicating that other factors may contribute to sociability and partially compensate for the disruption of basal OT. Additionally, the lack of effect on the social novelty phase in the three-chamber test (Fig. 7f) suggests that reducing SNAP-47, and likely disrupting somatic OT dynamics, may impact specific aspects of social behavior. Specifically, OT somatic release might affect more sustained and context-dependent behaviors, such as general sociability^13,19,32, while OT axonal release could be more crucial for behaviors involving rapid communication and signaling, such as aggression^73–76.

Understanding the distinct roles of somatic OT release is essential for deciphering the complexities of OT’s influence on behavior and physiology. To achieve this, it is important to explore the cellular and molecular mechanisms that govern OT secretion. This includes investigating OT vesicle trafficking, its link to specific neuronal activity patterns, and the fusion machinery that regulates OT release from different cellular compartments. Gaining insights into these processes is vital for understanding how OT signaling functions under normal physiological conditions and how its dysregulation may contribute to behavioral disorders. Our findings contribute to this effort by uncovering a novel role for SNAP-47 in regulating OT dynamics at the cell body, highlighting it as a promising target for further research into the functions of somatic OT in the hypothalamus. Data from male and female mice were combined for the analysis. No significant sex differences were observed.

Material and methods

Animals

Immunohistochemistry and cultured neurons were obtained from either in-house-bred wild-type BL6/C57 mice or OT-^tdTomato mice, generated by crossing OT-Cre animals⁴³ (Jackson Laboratories; strain ID 024234) with the Ai9 (RCL-tdT) reporter line from Jackson Laboratories (strain ID 007909) to identify OT-positive neurons⁴³. We have complied with all relevant ethical regulations for animal use. All experiments were performed according to Spanish and European Union regulations regarding animal research (2010/63/EU), and the experimental procedures were approved by the Bioethical Committee at the Instituto de Neurociencias and the Consejo Superior de Investigaciones Científicas (CSIC). Animals were housed in ventilated cages in a standard pathogen-free facility, with free access to food and water on a 12 h light/dark cycle.

Hypothalamic cultured neurons

Dissociated hypothalamic cultures were prepared from either newborn wild-type C57BL/6 or OT^tdTomato mice. Briefly, hypothalami were isolated and dissociated in a digestion solution containing papain for 18 minutes at 37 °C. Papain inactivation solution containing trypsin inhibitor type III Ovomucoid was then applied. Tissue was mechanically disaggregated through a glass pipette, and cells were plated on poly-D-lysine-coated glass coverslips placed in 12 mm wells at a density of 75,000 cells per cover slip. Cells were grown in Neurobasal medium (Invitrogen) supplemented with B-27 (Thermo Fisher) and Glutamax (Invitrogen). Half of the culture medium was replaced every 2–3 days. Neurons were infected with an adeno-associated virus (AAV) expressing a specific shRNA to block SNAP-47 expression (Jurado et al., 2013) and GFP as a reporter. Cultures were infected 7-10 days prior experiments.

Cytotoxicity assay

Primary hypothalamic neurons at 10-14 DIV were incubated in Tyrode’s basal solution (mM: 125 NaCl; 2 KCl; 30 glucose; 25 HEPES; 2 CaCl2; 2 MgCl2; pH 7.4), 70% EtOH, 50 mM KCl Tyrode’s solution (mM: 77 NaCl; 50 KCl; 30 glucose; 25 HEPES; 2 CaCl2; 2 MgCl2; pH 7.4), or 100 mM KCl Tyrode’s solution (mM: 27 NaCl; 100 KCl; 30 glucose; 25 HEPES; 2 CaCl2; 2 MgCl2; pH 7.4) for 1 or 10 minutes. A LIVE/DEAD® Cell Assay (Thermo Fisher) was then performed by incubating the cells for 15 minutes at 20-25 °C. Cells were subsequently stained with DAPI (Sigma Aldrich) for cell quantification, fixed in PFA, and mounted on coverslips. At least 5 images per condition from two different cultures were acquired using a Leica SPEII confocal microscope. Image analysis was conducted with the open-source software Fiji (National Institutes of Health, USA).

Immunohistochemistry

Brains were dissected from young adult (2-3-month-old) C57BL/6 mice, fixed in PFA 4% and embedded in agarose 4% for processing in a vibratome (Leica VT 1000S) to obtain 50 µm thick slices. Immunohistochemistry for OT and AVP was performed using mouse anti-OT and anti-AVP primary antibodies, originally developed in Dr. H. Gainer´s laboratory⁷⁷ and kindly provided by Dr. A. H. Veenema (Michigan State University). Additional antibodies used included: rabbit anti-SNAP-47 (Synaptic Systems, Ref: 111 403, IHC and ICC 1:100), rabbit anti-SNAP-25 (Synaptic Systems, Ref: 111 008, IHC and ICC: 1:1000), mouse anti-GFAP (Millipore, Ref: MAB360, ICC: 1:1000), and mouse anti-α-tubulin (Abcam, Ref: Ab7291, ICC: 1:5000).

Cultured cells were incubated for 1 hour in a blocking solution containing 0.5% PBS azide, 99.5% sodium azide, 0.1% Triton X-100, and 2% Normal Goat Serum. Tissue samples were incubated for 1 hour in a similar blocking solution, with 0.5% PBS azide, 0.3% Triton X-100, and 2% Normal Goat Serum. Primary antibodies were incubated overnight at 4 °C. Secondary Alexa antibodies (anti-rabbit Alexa 488 and anti-rabbit Alexa 594; Invitrogen) were added for 2 hours at room temperature. Samples were then incubated with DAPI and mounted on coverslips with Mowiol (Merk). Imaging was performed using a Leica SPEII confocal microscope with oil immersion objectives at 20x, 40x, and 63x magnifications.

Chasing of OT-containing compartments in cultured neurons

Hypothalamic primary neuronal cultures at 10-14 DIV were incubated in tempered Tyrode’s solution (mM: 125 NaCl; 2 KCl; 30 glucose; 25 HEPES; 2 CaCl2; 2 MgCl2; pH 7.4) for 3 minutes on a shaker. Cells were then incubated with either tempered Tyrode’s basal or 100 mM KCl Tyrode (mM: 27 NaCl; 100 KCl; 30 glucose; 25 HEPES; 2 CaCl2; 2 MgCl2; pH 7.4) for 1 or 10 minutes, or with chelated calcium 100 mM KCl Tyrode (mM: 125 NaCl; 2 KCl; 30 glucose; 25 HEPES; 0.5 EGTA; 2 MgCl2; pH 7.4) for 1 minute at 37 °C. To arrest calcium-dependent endocytosis, cells were placed on ice and rinsed with calcium-free Tyrode’s solution. Primary antibodies (anti-OT, anti-SNAP-47) were then added for 2 hours on ice. After antibody incubation, plates were rinsed and fixed in 4% PFA at 4 °C for 10 minutes. Cells were incubated with secondary antibodies (anti-Rabbit Alexa 488; anti-Rabbit Alexa 594; Invitrogen) prepared in 1X PBS for 2 hours at room temperature on a shaker.

Images were acquired using a confocal laser Olympus Fluoview FV300 (Olympus) with a 100x oil immersion objective (A.N = 1.45) and FluoView 5.0 software. Image analysis was performed with the open-source software Fiji (National Institutes of Health, USA), using a custom macro and plugins “UCSD Control” and JACoP⁷⁸. Results were analyzed with GraphPad Prism 8.

Colocalization analysis

Images were opened using the “UCSD Control” plugin in Fiji. Each image was separated into different Z planes, and a 3D projection was constructed from the stacks. OT-containing compartments from the 3D projection were outlined and saved in the ROI manager for colocalization analysis using the JACoP plugin. Colocalization parameters for individual OT compartments in each Z stack were obtained using an automatic threshold. The colocalization analysis produced two parameters: Pearson´s and Manders´ coefficients⁷⁹. Pearson’s coefficient measures the linear relationship between the intensity levels from two channels, with values ranging from -1 (perfect inverse correlation) to +1 (perfect correlation), with 0 indicating no correlation⁷⁸. Two Pearson’s coefficients can be derived: Pearson_A, which measures the correlation within the entire volume of the analyzed signal, and Pearson_B, which refers to the interaction within the region of colocalization (Fig. 2e, f).

Manders’ overlap coefficient measures the degree of co-occurrence between two channels, independent of the linearity of the relationship. Manders’ overlap coefficient values range from 0 (no overlap) to +1 (total overlap). Two Manders’ coefficients can be calculated: Manders_A, which refers to the correlation of channel 1 (red) with channel 2 (green), and Manders_B, which measures the co-occurrence of channel 2 (green) with channel 1 (red) (Fig. 2g, h). Pearson’s and Manders’ coefficients are not expressed as percentage values.

Although both parameters provide information about the colocalization of pixels between two channels, Manders’ and Pearson’s coefficients exhibit notable differences. Manders’ overlap coefficient is independent of object size and channel intensity, while Pearson’s correlation coefficient compares channels pixel by pixel and requires that both objects be of similar size to provide accurate comparisons. Since the OT-containing compartments were smaller than the SNAP-47 staining, Manders’ overlap coefficient was considered more reliable than Pearson’s coefficient.

Additionally, a random data set was generated as an internal control to demonstrate that the observed colocalization was not occurring by chance. The random data set was generated from the real stack that exhibited the highest Manders’ overlap value for each individual OT-containing compartment, using the “UCSD Control” and JACoP plugins in Fiji. Random OT-containing compartments were created by selecting a real OT-containing compartment with a size closest to the mean OT-containing compartment size and placing it at random x and y positions within the cell body, excluding the nucleus and extracellular locations. The control picture was generated by overlapping the image containing the randomly generated OT-containing compartments with experimental SNAP-47 data, followed by colocalization analysis. Basal and stimulation conditions used in these simulations mirror the treatments applied in the chasing experiments.

Viral vectors

A specific shRNA targeting the untranslated (UTR) region of the mouse SNAP-47 (SNAP-47 shRNA: ATAGCAATAGAATCAGCAGAGC) was cloned downstream of the human polyubiquitin promoter-C. shRNA effectiveness was tested in cultured neurons as described in Jurado et al.³³ (see Supplementary Fig. S3). The effectiveness of the shRNA was also evaluated in hypothalamic slices from injected animals using immunohistochemistry to detect endogenous SNAP-47. SNAP-47 shRNA was subcloned into a floxed AAV vector containing GFP as a reporter.

In vivo injections

OT-Cre mice (1-2-months-old) were prepared for stereotactic injection using standard procedures approved by the Bioethical Committee at the Instituto de Neurociencias and the Consejo Superior de Investigaciones Científicas (CSIC). Briefly, animals were anesthetized with isoflurane and administered analgesic (Buprenex; 0.1 mg kg⁻¹, s.c.). For knockdown of SNAP-47 in the PVN, an AAV-SNAP-47^KD-GFP was injected bilaterally into the PVN using the following coordinates from bregma: AP: ± 0 mm, ML: ± 0.25 mm, DV: – 4.75 mm. A virus containing just GFP was used as a control. Pipette was left in the ROI for 5 min to allow the diffusion of the AAVs (200 nl) into the brain. The scalp was then sealed and the animals were left to recover in a warm chamber. Electrophysiological recordings and behavioral assays were conducted 3–5 weeks after the injections.

Electrophysiology

Acute hypothalamic slices from 2-3-month-old mice (male and females) were obtained in a Leica 1200S vibratome. The recording chamber was perfused with cold ACSF gassed with 5% CO2 / 95% O2. Whole-cell voltage-clamp recordings were obtained with patch recording pipettes (5–7 MΩ) filled with a solution containing (mM): 115 CsMeSO3, 20 CsCl, 10 HEPES, 2.5 MgCl², 4 Na₂-ATP, 0.4 Na-GTP, 10 sodium phosphocreatine, 0.6 EGTA, pH 7.25, osmolarity 290 mOsm. Recordings were performed using transmitted light illumination under a microscope equipped with a 40X water immersion objective. Neurons were held either at -70 mV to record spontaneous excitatory postsynaptic currents (sEPSC) or at 0 mV to record spontaneous inhibitory postsynaptic currents (sIPSCs). Access resistance was monitored throughout the experiments, cells with changes above 20% were discarded. Recordings were analyzed using Clampfit 10 (Molecular Devices). Data acquisition was performed with a Multiclamp 700B amplifier, a 1550B digitizer and pClamp 10 software (Molecular Devices). Data were acquired at a 20 kHz sampling rate and were filtered at 10 kHz.

Social behavior

Social behavior was assayed by a three-chamber test following standard procedures^45,46. In brief, the test was conducted in a cage measuring 60 × 40 × 22 cm, featuring dividing walls with openings that allowed access into each chamber. The test mouse was placed in the middle chamber and allowed to explore for 10 minutes. Following this habituation period, an unfamiliar subject of the same sex (mouse 1, M1) was placed in one of the side chambers within a small, wire cage that permitted contact. In the sociability session, the test mouse had a choice of spending time in either the empty chamber (E) or the chamber occupied by M1. At the end of the sociability session, each mouse was tested in a second 10-min session to evaluate social preference for a new subject (M2) during the social novelty session. Control mice commonly spent more time exploring the novel animal (M2)^45,46. Exploration time was quantified offline from continuous video recordings using BORIS and SMART video-tracking software (PanLab S.L.).

Statistics and reproducibility

All of the statistical details of experiments can be found in the figure legends, which include the statistical tests used, the exact value of n, exclusion of any data, and what n represents (cells, slices, mice). Statistical analyses were conducted using GraphPad Prism 8 data analysis software. Results in dispersion plots are presented as the mean ± standard error of the mean (SEM). In violin plots, a thick black bar represents the 25–75% interquartile (IQR) range; thin bars indicate the range within 1.5 x IQR; a white dot indicates the median. P values < 0.05 were considered statistically significant. Statistical tests used for each specific data set are indicated in the corresponding figure legends. The sample size was determined based on values used in previous experiments and informed by earlier studies in the field using the same methods and measuring comparable outcomes. Male and female animals were indistinctively used, and data were pooled for the analysis. No sex differences were observed.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Author contributions

B.A. conducted OT chasing experiments, in vivo stereotaxic injections, and immunohistochemistry assays. M.R. performed in vivo stereotaxic injections and electrophysiological recordings. A.P. carried out behavioral assays. P.M. conducted early characterization of SNAP-47 expression. J.V. and L.M.G. assisted with the conceptualization and analysis of OT chasing experiments. S.J. designed the experiments, wrote the manuscript, supervised the work, and provided the funding.

Peer review

Peer review information

Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editor: Benjamin Bessieres. [A peer review file is available].

Data availability

All original data required to reproduce the main results is publicly available as of the date of the publication, as the following link: 10.20350/digitalCSIC/17761. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s42003-025-09442-5.