Disseminated tuberculosis secondary to polymicrobial co-infection following long-term immunotherapy for sarcomatoid mesothelioma: A case report

Abstract

Malignant pleural mesothelioma (MPM), particularly its sarcomatoid subtype, is a highly aggressive sarcoma of the pleural lining with a dismal prognosis. Prolonged use of immune checkpoint inhibitors (ICIs), while improving survival in selected patients, can induce profound immunosuppression, increasing susceptibility to life-threatening opportunistic infections. This report describes a 77-year-old male with sarcomatoid MPM who developed fatal disseminated tuberculosis (TB), accompanied by concurrent Aspergillus and herpesvirus infections during extended immunotherapy. The case underscores the critical role of metagenomic next-generation sequencing (mNGS) in enabling rapid diagnosis of atypical TB reactivation in an immunocompromised host, even when conventional cultures are negative. mNGS identified co-infections with Aspergillus flavus and herpesviruses (HHV-5, HHV-4, HHV-1), demonstrating its superiority in polymicrobial infection detection.

1. Introduction

Malignant Pleural Mesothelioma (MPM) is an aggressive malignant tumor originating from mesothelial cells in the pleura. Its occurrence is significantly associated with asbestos exposure, and approximately 80 % of cases can be traced back to occupational or environmental asbestos exposure history [1].This tumor has highly invasive growth characteristics and often involves the diaphragm, chest wall, and surrounding organ tissues. Due to the extensive tumor infiltration range and close adhesion to important organs, surgical resection is often not feasible, and systemic treatment is required [2]. Currently, platinum-based combination chemotherapy regimens (such as pemetrexed + cisplatin) and immunotherapy have been included in clinical guidelines for recommendation [3]. Based on the evidence from key clinical trials such as CheckMate-743, the dual immunotherapy combining PD-1/PD-L1 inhibitors (such as nivolumab) with CTLA-4 inhibitors (such as ipilimumab) has been listed as the first-line treatment option for unresectable MPM in the National Comprehensive Cancer Network/European Society for Medical Oncology(NCCN/ESMO)guidelines, as it significantly prolongs the overall survival of patients (with the median OS increased to 18.1 months vs 14.1 months in the chemotherapy group) [4].However, immune checkpoint inhibitors (ICIs)—particularly PD-1/PD-L1 inhibitors—reinvigorate exhausted T cells but may paradoxically disrupt regulatory T-cell subsets and CD4⁺/CD8⁺ balance, especially when co-administered with corticosteroids (a standard intervention for immune-related adverse events [irAEs]) [5]. This immunosuppressive triad (ICIs, steroids, chemotherapy) not only impairs anti-tumor immunity but also drives immune dysregulation—a key trigger of opportunistic infections [6]. Notably, this dysregulation markedly elevates risks of Mycobacterium Tuberculosis(MTB) reactivation, invasive fungal disease, and herpesvirus reactivation—conditions often delayed in diagnosis and treatment due to overlapping clinical manifestations and challenges in pathogen detection.

Metagenomic next-generation sequencing (mNGS) provides a transformative diagnostic approach by enabling rapid, unbiased detection of pathogens directly from clinical samples within 48 hours, regardless of prior antimicrobial exposure or host immune status [7]. In patients with MPM and febrile neutropenia or unexplained organ dysfunction, mNGS can detect co-infections missed by standard diagnostic panels, allowing for earlier targeted treatment.

This case report describes a patient with MPM who received ICI treatment and died of sepsis due to multiple infections (MTB, aflatoxin, herpes virus and novel coronavirus). This article mainly discusses the infection prevention strategies for immunosuppressed hosts and the clinical application value of mNGS.

2. Case report

A 77-year-old male with a 2-year history of sarcomatoid MPM was admitted to the intensive care unit (ICU) due to persistent epigastric pain, hyperpyrexia (up to 40.3 °C), dizziness, and fatigue—developing 3 days after receiving combined chemotherapy and targeted therapy. He had a history of type 2 diabetes mellitus managed with long-term insulin (glargine 18 U daily + aspart 10 U daily), with poor glycemic control on ICU admission (random blood glucose: 31.4 mmol/L). Additionally, he received methylprednisolone for over 6 months to manage immune-related complications, resulting in iatrogenic immunosuppression(see Table 1 for summarized key clinical events).

Table 1.

Patient disease progression Timeline.

Timeline	Key Clinical Events
2022.5–2024.6	Initial treatment: Nivolumab (360mg Q3W) + ipilimumab (50mg Q6W), followed by nivolumab monotherapy.
2024.6–2024.9	Regimen switch to sintilimab-based therapy (200mg + ipilimumab 50mg initially, then sintilimab 200mg monthly); Sep: Left lower lung local radiotherapy (6MV-IMRT, 70Gy/10F).
2024.12–2025.2	2024.12.22:Epigastric pain + low-grade fever; diagnosed with immune-related adrenal insufficiency; treated with methylprednisolone + anti-infectives; discharged on 2025.1.17. 2025.2.26:Admitted for anti-tumor therapy; fever + fatigue; thoracic CT showed tumor progression; sputum detected bacteria + yeast (AFB smear negative).
2025.3	3.5: High fever (39.4 °C); imipenem administered; fungal culture positive for Aspergillus flavus; added voriconazole.
	3.21–22: Anemia aggravated (Hb 55g/L); blood transfusion performed; developed hyperpyrexia (40.3 °C) + gastrointestinal bleeding + grade IV myelosuppression.
	3.24: Transferred to ICU (hypotension/hypoxemia).
	3.25–27: Sputum AFB positive; mNGS detected TB/Aspergillus flavus/HHV; ddPCR confirmed high TB load.
	3.30: Expired due to septic shock.

2.1. Timeline of clinical course

May 2022–June 2024: The patient received sequential immunotherapy for MPM: initial nivolumab [360 mg Q3W(quaque 3 Weeks)] combined with ipilimumab (50 mg Q6W), followed by single-agent nivolumab. Due to economic considerations, he switched to domestic sintilimab-based therapy in June 2024 (initial sintilimab 200 mg + ipilimumab 50 mg, then maintenance sintilimab 200 mg monthly).

September 2024: Imaging revealed tumor progression; he underwent local intensity-modulated radiotherapy.[6 MegaVolt-Intensity-Modulated Radiation Therapy,70 Gy in 10 Fractions(6MV-IMRT, 70 Gy/10F) ] to the left lower lung lobe, with continued sintilimab monotherapy until December 2024.

December 22, 2024: Post-immunotherapy, he developed epigastric pain, nausea, diarrhea, and low-grade fever (max 38 °C). Admitted to the oncology department, he was diagnosed with immune-related adrenal insufficiency and treated with methylprednisolone, hormone replacement therapy, and anti-infective agents (cefoperazone-sulbactam + trimethoprim-sulfamethoxazole). He was discharged on January 17, 2025.

February 26, 2025: Upon re-admission to the oncology department for anti-tumor therapy, the patient reported low-to-moderate fever and persistent fatigue over the past 3 days. Subsequently, relevant tests were performed. Thoracic computed tomography (CT) showed disease progression: left lower lobe pleural nodule, right upper lobe mass (3.5 × 4.0 cm), and bilateral pulmonary nodules (Fig. 1). He received methylprednisolone (20 mg/qd), sulfonamides (fungal prophylaxis), omeprazole, calcitriol, and calcium carbonate D3. Sputum smears (February 27) detected Streptococcus viridans (3+), Neisseria spp. (3+), oral viscid bacteria (3+), and a small amount of yeast-like fungi, sputum,acid-fast bacilli (AFB) smears were negative.

Fig. 1.

Chest CT imaging: Three days after anti-tumor treatment, the patient experienced persistent upper abdominal pain and other symptoms. Chest computed tomography image shows a pleural nodule in the lower left lung lobe and a mass (3.5 × 4.0 cm) in the upper right lung lobe.

March 5, 2025: Developed high fever (up to 39.4 °C) with elevated C-reactive protein (CRP: 102.03 mg/L). lab neutrophil percentage 85oratory tests on admission showed WBC 9.4 × 10⁹/L, RBC 3.28 × 10¹²/L, Hb 89 g/L, PLT 242 × 10⁹/L,0.3 %, lymphocyte percentage 7.2 %, and ACTH 0.97 pg/ml. imipenem (1 g/q8h) and sodium bicarbonate were initially administered for anti-infection and symptomatic support. On March 9, etiological tests revealed Aspergillus flavus on fungal culture, Streptococcus viridans (2+) and yeast-like fungi (2+) on throat swab culture; blood culture, serum β-D-glucan, and sputum AFB smears were negative, bacterial infection was suspected with possible fungal colonization, so voriconazole was added while continuing imipenem.

March 13, 2025: Fever resolved, and voriconazole was continued for antifungal treatment.

March 17, 2025: Fungal-related laboratory parameters trended downward following antifungal therapy. Per family request, antitumor therapy (pemetrexed 500 mg d1 + bevacizumab 400 mg d1) was administered (sintilimab was suspended). No acute toxicities were observed.

March 21, 2025: Developed dizziness and fatigue with decreased hemoglobin,Hb 69 g/L; treated with Shengxuebao mixture, and a peripherally inserted central catheter (PICC) was placed.

March 22, 2025: Hb 55 g/L,transfused with 2 units of allogeneic O-type Rh-positive leukocyte-depleted suspended red blood cells, resulting in significant relief of dizziness and fatigue. However, he developed recurrent hyperpyrexia (up to 40.3 °C) and gastrointestinal bleeding(passed approximately 150 mL of melena). Laboratory tests confirmed grade IV myelosuppression (WBC: 0.36 × 10⁹/L, Hb: 60 g/L, Plt: 44 × 10⁹/L), severe CD4⁺ T-cell lymphopenia (128/μL), hypoalbuminemia (29.43 g/L), and CRP >200 mg/L.

March 23, 2025: ICU consultation was performed, which indicated myelosuppression, hyperpyrexia complicated with gastrointestinal bleeding after chemotherapy. Prior to further identification of pathogenic organisms at the infection site, anti-infection therapy was strengthened; it was recommended to add vancomycin and antifungal agents (imipenem-cilastatin, vancomycin, and caspofungin) on the basis of imipenem. On the same day, pharmacy department consultation was conducted for the patient with febrile neutropenia, and it was suggested to continue submitting sputum culture(negative), fungal culture medium(results on Mar 30 was negative), and blood culture(results on Mar 27,28,29, 30 were negative) on the basis of the above medications.

March 24, 2025: Due to grade IV myelosuppression and hemodynamic deterioration (BP: 85/42 mmHg, oxygen saturation: 85 % on room air, heart rate: 120 bpm), he was transferred to the ICU.

2.2. ICU evaluation and diagnosis

On ICU admission, the patient presented with tachypnea (24 breaths/min), bilateral coarse breath sounds, right lower lung rales, and epigastric tenderness (+) without rebound tenderness or muscle guarding. Performance Status(PS) and Numerical Rating Scale (NRS) pain scores were 1 (mild pain).

Key diagnostic findings:

March 25, 2025: AFB smear showed 3+ bacilli (Fig. 2); chest X-ray revealed bilateral pulmonary infiltrates (Fig. 3).

Fig. 2.

Acid-fast stained sputum smear microscopy.Microscopic examination of a sputum smear stained with acid-fast bacilli (AFB) staining (Ziehl-Neelsen method) reveals numerous acid-fast bacilli (+++ ∼++++) under oil immersion (1000 × magnification).The bacilli have a slender rod-like structure and appear red against a blue background.

Fig. 3.

Chest X-ray imaging: the chest X-ray shows extensive bilateral lung infiltration.

March 25, 2025: mNGS was performed on blood and sputum samples, identifying Mycobacterium tuberculosis (MTB) complex (50,595 reads), Enterococcus faecium (21 reads), Aspergillus flavus complex (7 reads), and human herpesviruses 1, 4, 5 (HHV-1/4/5: 743/927/60,318 reads)(Fig. 4). No rifampicin or isoniazid resistance was detected.

Fig. 4.

Pathogen genomic coverage depth distribution in blood sample analyzed by NGS. A. Mycobacterium tuberculosis: Genomic coverage of 41.32 % with a depth distribution range of 0.00–1.25.B. Human betaherpesvirus 5: Coverage rate of 100.00 % with a depth distribution range of 0.00–2.00.C. Human gammaherpesvirus 4: Genomic coverage of 20.24 % with a depth distribution range of 0.00–2.00.D. Human alphaherpesvirus 1: Coverage of 19.00 % with a depth distribution range of 0.00–2.00.

March 26, 2025: Repeat sputum AFB smear confirmed 4+ bacilli.

March 27, 2025:Droplet digital PCR (ddPCR) using primers F: ACAGGGCTGCTCTCACAAC and R: AGCGGCACGTAATGAAAGAC confirmed human-type MTB with a high bacterial load (11,433.4 copies/mL; Fig. 5).

Fig. 5.

Analysis of droplet digital PCR (ddPCR) detection results for liquid sample.

The red line represents the predefined detection threshold line. Left panel 1: Negative control (NTC, no template control), with no target nucleic acid signal detected. Left panel 2: Positive control (known concentration standard), showing signals unequivocally above the threshold line, validating the efficacy of the detection system. Panel 3: Results from the patient's blood sample, demonstrating a target nucleic acid concentration significantly exceeding the threshold line (11433.4copies/mL).

2.3. Treatment and outcome

Antitumor therapy was discontinued. Supportive care included oxygenation via non-rebreathing mask, fluid resuscitation, blood product transfusion, and granulocyte colony-stimulating factor for myelosuppression. Antimicrobial therapy was adjusted to linezolid + isoniazid + moxifloxacin + amikacin (400 mg/qd) + caspofungin to cover polymicrobial infection.

Due to financial constraints, the family declined adjunctive therapies (thymalfasin, magnesium isoglycyrrhizinate, isavuconazole, human albumin, thrombopoietin). Despite improved oxygenation, the patient developed refractory septic shock and multiorgan failure. He expired on March 30, 2025.

3. Discussion

This case highlights the fatal synergistic risk of long-term iatrogenic immunosuppression and opportunistic TB reactivation in patients with advanced cancer [6]. Our findings align with Anand et al. (2020), who reported a 2.3-fold increased TB risk in ICI-treated patients [8]. In addition, Fujita et al. have also indicated that TB reactivation is not merely caused by immunosuppression, but rather by the synergistic effects of immune dysregulation and excessive immune responses. During ICI therapy, immune imbalance drives TB reactivation: such dysregulation allows MTB to evade host clearance while concurrently inducing excessive inflammatory damage [9]. this case uniquely demonstrates MTB bacteremia with an extreme bacillary load (11,433 copies/mL), a phenomenon predominantly observed in non-HIV immunosuppressed hosts, as corroborated by Tan et al. (2010) showing higher MTB bacteremia rates in this population [10]. This aligns with studies linking high MTB DNA loads in peripheral blood to rapid clinical deterioration and mortality.

Performed on March 25, 2025, subsequent to the failure of empirical therapies to control the patient's progressive deterioration, mNGS was demonstrated to have pivotal diagnostic utility in this case: the previously undetected dominant pathogen MTB and co-infecting pathogens were identified, diagnostic ambiguity associated with conventional detection methods was resolved, and thus the etiological confirmation rate of infections in immunocompromised patients with MPM was significantly improved. mNGS not only identified MTB as the dominant pathogen, with 50,595 sequence reads, but also unmasked co-infections with Aspergillus flavus and HHV-1,4,5,—pathogens frequently overlooked in conventional workflows. These findings are supported by studies demonstrating that mNGS maintains high sensitivity (70.8–95.0 %) even in samples with low pathogen burden, including blood and CSF [11]. The discordance between the high MTB DNA load detected by mNGS and the persistently negative blood cultures may be attributed to MTB's unique biological characteristics, including its lipid-rich cell wall that impedes growth in conventional media, and its ability to persist in a non-replicating state under immunosuppression, thereby evading culture detection [7]. Furthermore, mNGS's capacity to capture cell-free DNA from both viable and lysed pathogens enables detection even when viable bacilli are scarce, a critical advantage in immunocompromised hosts [11]. These findings underscore the necessity of integrating molecular diagnostics such as mNGS with clinical and radiological assessments to guide early targeted therapy, particularly in high-risk populations where delayed diagnosis can lead to catastrophic outcomes. The World Health Organization (WHO) now advocates for combined molecular and conventional approaches to enhance diagnostic accuracy in disseminated tuberculosis, emphasizing the paradigm shift toward precision medicine in managing complex infections [12].

Therapeutic challenges were multifold. First, rifampicin—a cornerstone of TB regimens—was contraindicated due to its CYP450-inducing effects, which risked subtherapeutic exposure to concurrently administered chemotherapeutics [13].Second, hematologic toxicity from moxifloxacin exacerbated preexisting pancytopenia, necessitating dose adjustments and transfusion dependence [14]. Third, the overlapping nephrotoxicity of caspofungin and corticosteroids precipitated acute kidney injury [15]. Highlighting the precarious balance between antimicrobial efficacy and organ preservation in myelosuppressed patients. These complexities underscore the need for pharmacokinetic monitoring and individualized regimens in such scenarios.

Notably, this case diverges from reported successes in ICI-associated TB management. Juan E. et al. (2017) documented favorable outcomes in a patient with dual Concomitant disseminated histoplasmosis and disseminated tuberculosis through prompt targeted therapy [16].this finding also suggests that pre-emptive screening for pathogenic bacteria such as MTB using tests including T-SPOT should be implemented in patients receiving ICI therapy, thereby shortening the therapeutic window for intervention [17]. Notably, This study has inherent limitations: its single-center retrospective design which may restrict the generalizability of findings and the absence of autopsy confirmation for disseminated tuberculosis, potentially impacting the definitive verification of mycobacterial dissemination patterns. Despite these constraints, our findings underscore the critical need for proactive pathogen surveillance in high-risk immunosuppressed populations--specifically, screening for tuberculosis (TB) via tests such as T-SPOT or metagenomic next-generation sequencing (mNGS). Proactive mNGS screening in high-risk cohorts (e.g., those receiving ICIs combined with corticosteroids) could narrow the diagnostic window, particularly when classic TB symptoms are absent or masked by cancer-related morbidity.

Multidisciplinary collaboration is imperative. Oncologists, infectious disease specialists, and intensivists must jointly optimize immunosuppression withdrawal, antimicrobial selection, and supportive care. Guidelines should recommend routine tuberculosis screening in endemic areas prior to the initiation of immunosuppressive therapy. In conclusion, this case serves as a stark reminder of TB's resurgence in the era of cancer immunotherapy. Integrating advanced diagnostics like mNGS into standard care, coupled with vigilant monitoring for coinfections, may avert catastrophic outcomes in similarly vulnerable patients.

4. Conclusion

• 1This case suggests that sarcomatoid MPM patients receiving long-term ICIs combined with corticosteroids may have an increased risk of fatal polymicrobial infections.
• 2TB screening prior to ICI administration, vigilant infection monitoring, early application of mNGS, and multidisciplinary collaboration are critical for reducing catastrophic outcomes.
• 3Regular MTB screening combined with the early application of mNGS can markedly enhance the detection rate of pathogenic infections in patients receiving ICI therapy, and is crucial for lowering the risk of catastrophic clinical outcomes.

CRediT authorship contribution statement

Lingyin Xia: Writing – original draft. Jianning Xu: Formal analysis. Zhiqing Chen: Investigation. Yang Shen: Investigation. Yeqing Zou: Writing – review & editing.

Funding

This research was supported by the National Natural Science Foundation of China (No. 82360513) and the Natural Science Foundation of Jiangxi Province (No. 20224ACB206037).

Declaration of competing interest

The authors declare that they have no competing interest Consent for publication Written informed consent was obtained from the patient for publication of this Case report and any accompanying images.

Abbreviations:

MPM:Malignant Pleural Mesothelioma; NCCN/ESMO:National Comprehensive Cancer Network/European Society for Medical Oncology; ICU:intensive care unit; ICIs:immune checkpoint inhibitors; irAEs:immune-related adverse events; Q3W:Quaque 3 weeks; 6MV-IMRT:6 Megavoltage-Intensity Modulated Radiation; 70 Gy/10F:70 Gy in 10 Fractions; qd:quaque daily; AFB:acid-fast bacilli: BP:blood pressure; WBC:White Blood Cell; RBC:Red Blood Cell; Hb:Hemoglobin; PLT:Platelet; PICC:peripherally inserted central catheter; PS:Performance Statusand; NRS:Numerical Rating Scale; MTB:Mycobacterium tuberculosis; HHV:herpesviruses; ddPCR:droplet digital polymerase chain reaction; CYP450:Cytochrome P450; T-SPOT:T‑cell Spot Test for Tuberculosis Infectionm; mNGS:metagenomic next-generation sequencing.