Assessment of key transcription factors and drought-responsive genes in wheat cultivars under drought stress

Mohamed A Sakr; Eman A El-Khateeb; Hanan I Sayed-Ahmed; Reda M Gaafar

doi:10.1016/j.jgeb.2026.100657

. 2026 Jan 27;24(1):100657. doi: 10.1016/j.jgeb.2026.100657

Assessment of key transcription factors and drought-responsive genes in wheat cultivars under drought stress

Mohamed A Sakr ¹, Eman A El-Khateeb ¹, Hanan I Sayed-Ahmed ¹, Reda M Gaafar ^1,^⁎

PMCID: PMC12865643 PMID: 41839679

Abstract

Wheat is a vital crop. Its long-term sustainability and reliability are crucial for global food security. Drought is a major abiotic stress impacting growth of wheat. It is the main cause of low and inconsistent wheat yields. This study explores the role of transcription factors (TFs) and drought-responsive genes in the mechanisms controlling drought stress responses in six Egyptian wheat varieties (Misr1, Misr2, Misr3, Gemmiza9, Sids14, and Sakha95) under severe drought induced by polyethylene glycol. Drought stress was induced with PEG 6000 at 25%, applied for 3 and 6 days on 14-day-old wheat seedlings grown in a hydroponic system. Results showed that antioxidant enzyme activities (CAT, POD, and SOD) were significantly elevated, and H₂O₂ concentrations decreased. After 3 days, proline accumulation notably increased in Gemmiza9 and Misr2, while MDA levels increased across all cultivars, indicating enhanced lipid peroxidation. After 6 days, proline content was significantly elevated in all cultivars, with continued increases in MDA and reductions in H₂O₂ levels. This confirmed ongoing oxidative stress and adaptive responses. The qRT-PCR results revealed a time-dependent gene expression pattern under drought stress. After 3 days, Misr2 cultivar showed the highest induction of TaMYB73 (1.56-fold), TaWRKY13 (5.62-fold), and TaDHN2.1 (4.92-fold), while Sakha95 exhibited the strongest WDERB-2B expression (3.94-fold). After 6 days, TaMYB73 was highest in Misr3 (6.32-fold), while TaNAC2 peaked in Misr2 (5.98-fold), WDERB-2B in Sakha95 (13.45-fold), and TaDHN2.1 in Gemmiza9 (7.78-fold). TaOBF-1B was upregulated in all cultivars and reached its highest level in Misr1 (6.92-fold). This study categorizes Misr2 and Misr3 as tolerant cultivars, Misr1, Sakha95, and Gemmiza9 as semi-tolerant cultivars, and Sids14 as a sensitive cultivar. Our analysis identified key TF genes that regulate wheat’s drought stress response network.

Keywords: RWC, Gene expression, Osmotic stress, TFs, MDA, Proline, PEG, Triticum aestivum

1. Introduction

Wheat is the most widely grown cereal grain globally.¹ It is a main source of nutrients for 36% of the world’s population and is cultivated on 70% of the planet’s farmland.² In Egypt, wheat remains the leading crop. Many Egyptians get a significant part of their daily calories and protein from wheat, primarily through subsidized bread called Baladi.³ As a result, these grains provide a large portion of daily calorie intake in many countries. For instance, wheat accounts for 40–50% of calorie intake in Egypt and Turkey, while in the UK it accounts for around 20%.⁴ However, the Egyptian agriculture sector faces significant challenges due to limited arable land, rising water scarcity, and a rapid population growth. This situation is further complicated by land degradation, climate change effects, and rural poverty.⁵ Additionally, Egypt relies heavily on irrigation sources, primarily the Nile River; however, rising water shortages, intensified by climate change, make drought a significant obstacle to farming, especially in newly reclaimed areas with limited water retention capacity.6, 7

Drought stress is a major threat to cereal production, causing grain yield losses across parts of Europe, Africa, Asia, Oceania, South America, Central America, and North America⁸ Drought can have an even greater impact on wheat plants during critical developmental stages, such as germination and seedling growth.⁹ Drought stress disrupts plant metabolism and physiological systems, leading to reductions in growth and yield of 30–90%, depending on the species and maturity stage.¹⁰

The development of drought-resistant crops depends significantly on genes that control cellular structure protection and maintenance, which are meticulously regulated in response to water scarcity. Transcription factors, enzymes, functional proteins, molecular chaperones, and metabolites are among the proteins involved in plant water-stress signaling pathways.¹¹ Wheat has many genes that contribute to its drought tolerance, and its strategies are complex. TFs act as molecular regulators, instantly controlling the expression of linked genes during signal transduction. These TFs bind with cis-elements in the promoter regions of their target genes. Up to 10% of plant genes may encode TFs.¹² These genes are grouped into gene families depending on the configuration of their DNA-binding domains, including AREB, DREB, MYB, WRKY, NAC, and bZIP.13, 14 While genome-wide analyses can identify all members of a TF family, they often serve only as a starting point. The main weakness is the lack of detailed functional characterization for most identified TFs. Understanding the complex interactions between TFs, target genes, and other regulatory elements is critical for successful crop development. Selecting drought-tolerant cultivars is an effective strategy to mitigate the impact of drought on wheat quality and production.¹⁵

The NAC transcription factor (TF) family controls plant physiological processes, growth, and responses to biotic and abiotic stresses.16, 17 In wheat, genes TaNAC2A, TaNAC2B, and TaNAC2D participate in responses to abscisic acid (ABA), cold, salinity, and drought conditions. Similarly, wheat WRKY2, WRKY10, and WRKY19, when overexpressed in tobacco and Arabidopsis, confer enhanced tolerance to salt and drought stress.18, 19 Furthermore, TaMYB73 plays a role in salt stress adaptation and is regulated through phytohormones and stress-responsive promoter elements.²⁰ The genes TaDREB1 and TaDREB3 are key regulators of drought tolerance in wheat²¹, while TaOBF1 responds positively to drought stress.²² Although investigations are limited on catalase (CAT) genes in wheat,²³ 10 CAT genes have been determined.²⁴ Overexpression of the genes W69 and W106 in Arabidopsis has conferred tolerance to salt, hydrogen peroxide (H₂O₂), and ABA.²⁵ Additionally, dehydrin proteins accumulate in vegetative tissues under dehydration-related stresses, such as drought, salinity, and increased temperatures²⁶, with at least 54 putative dehydrins (DHNs) identified in wheat.²⁷

Our investigation explored the role of transcription factors (TFs) and stress-responsive genes in mitigating osmotic stress in six Egyptian wheat cultivars: Misr1, Misr2, Misr3, Gemmiza9, Sids14, and Sakha95. Additionally, it aimed to identify which of these wheat cultivars are the most tolerant and sensitive to severe osmotic stress induced by 25% PEG-6000.

2. Materials and methods

2.1. Plant materials

In our study, the seeds of six Egyptian wheat cultivars (Misr1, Misr2, Misr3, Gemmeiza9, Sids14, and Sakha95) were acquired from the Crop Research Institute at the Agriculture Research Center (ARC), Giza, Egypt.

2.2. Germination of wheat seeds

The experiment was conducted at the Biotechnology Laboratory, Botany and Microbiology Department, Faculty of Science, Tanta University, in 2024. We repeated the experiment three times. For each treatment, three independent biological replicates were established by randomly selecting and pooling three seedlings per cultivar per treatment to form a single biological sample. The tools used were disinfected with 70% ethanol and rinsed multiple times with distilled water before use. Wheat grains were initially surface-sterilized with 70% ethanol for 5 min. Afterwards, they were treated with a 1.5% sodium hypochlorite (NaClO) solution for 15 min. Subsequently, the seeds were washed several times with distilled water to remove any residual chlorine. Twelve grains from each wheat cultivar were soaked in distilled water and retained for 24 h at 22 °C. Grains were germinated on floating gauze placed on plastic trays filled with distilled water, as shown in Fig. S1 A. Three trays were used for germination, with approximately 80 grains per tray. The trays were maintained in a growth room at 22 °C in the dark. The germination process lasted 5 to 7 days. After this period (7 days), the grains developed into healthy, dark-green seedlings with proper roots and shoots.

2.3. Transplanting of wheat seedlings on a hydroponic aqueous culture system and growth conditions

Seven-day-old wheat seedlings (shown in Fig. S1 B) were hydroponically transplanted into four plastic boxes containing equal volumes of nutrient solution. This work was performed in a growth room maintained at 22 °C. The chamber’s photoperiod was a 16-hour light/8-hour dark cycle, as indicated in Fig. S1 C. White fluorescent lamps provided light intensity of 250 μmole/m2/s to sustain this cycle. Each culture box held 36 wheat seedlings, arranged in a completely randomized design. There were six seedlings of each wheat cultivar per box. The nutrient solution was adapted from Cooper.²⁸ It includes N, P, K, Ca, and Fe as macronutrients, and Mn, Zn, Cu, B, and Mo as micronutrients. The concentrations for each are shown in Table 1. To ensure proper aeration, aquarium air pumps connected via silicone tubes circulated air through the culture medium. Continuous aeration maintained a normoxic environment for the wheat seedlings and prevented hypoxia. The seedlings were grown in the culture solution for seven days (see Fig. S1 D).

Table 1.

Chemical composition of the nutrient solution used in this study.

Element	Macronutrients (ppm)						Micronutrients (ppm)
	N	P	K	Ca	Mg	Fe	Mn	Zn	Cu	B	Mo
	220	45	300	180	60	3	1	0.25	0.15	0.25	0.012

Open in a new tab

2.4. Induction of osmotic stress using PEG 6000 (25%)

Fourteen-day-old wheat seedlings were treated with 25% polyethylene glycol (PEG) 6000 (Central Drug House (P) Ltd, INDIA). PEG 6000 was mixed with the nutrient solution to simulate osmotic stress, as shown in Fig. 1D. The sublethal concentration of PEG 6000 (25%) was determined based on preliminary studies (Fig. S2 and Table S1, S2, and S3). The corresponding osmotic potential (ψ_o_s) of this concentration is approximately −7.703 MPa. This value was calculated using Michel and Kaufmann’s equation²⁹ as follows:

Fig. 1 — Shoot height (A), root depth (B), shoot fresh mass (C), and root fresh mass (D) of seedlings from six wheat cultivars subjected to drought stress with 25% PEG-6000. 14-day-old wheat seedlings were exposed to drought stress for 3 and 6 days. The results show the mean values ± SD of three biological replicates. Statistical significance was determined using a one-way ANOVA. Bars marked with different letters indicate significant differences (p ≤ 0.05).

$Ψ_{os} = - (1.18 \times 10^{- 2}) C - (1.18 \times 10^{- 4}) C^{2} + (2.67 \times 10^{- 4}) C T + (8.39 \times 10^{- 7}) C^{2} T$ , where $Ψ_{os}$ is osmotic potential (in Megapascals, MPa), C is concentration of PEG-6000 (g/L), and T is temperature (°C).

The wheat seedlings treated with the nutrient solution without PEG 6000 were designated as the control group, as shown in Figs. S1 E, S1 F, and S1 G. The wheat seedlings were collected for further analysis after 3 and 6 days of osmotic stress. Wheat samples were directly frozen in liquid nitrogen after harvest and kept at −80 °C for RNA extraction.

2.5. Growth parameters measurements

The shoot height and root depth were estimated utilizing a scale ruler. An electronic balance determined the fresh mass of the shoot and root. The fresh shoots and roots were then placed in an oven at 70 °C for 72 h until a steady dry weight was attained, which was documented as the shoot and root dry weights.

2.6. Relative water content and Root-Shoot ratio

The relative water content (RWC) of both shoot and root was estimated using the following equation: $R W C % = (f r e s h w e i g h t - d r y w e i g h t) / (t u r g i d w e i g h t - d r y w e i g h t) \times 100$ .³⁰ The root-shoot ratio was defined as the ratio of root dry weight to aboveground dry weight.³¹

2.7. Determination of photosynthetic activity, chlorophyll a, chlorophyll b, and carotenoid content

The photosynthetic performance was assessed by analyzing fluorescence kinetics $[v a r i a b l e f l u o r e s c e n c e (F v) / m a x i m u m f l u o r e s c e n c e (F m)]$ of dark-adapted leaves using an OS-30p Chlorophyll Fluorometer (Hudson, NH 03051, USA). The leaves were dark-adapted and secured in a leaf clip to maintain a consistent angle of incidence between the fluorometer's fiber-optic arm and the leaf surface. Maximum fluorescence (Fm), which represents the fluorescence when photosystem II reaction centers are closed after saturating flash, was recoreded. In contrast, the initial fluorescence (Fo) was detected when the reaction centers are open after dark-adaptation. The change in fluorescence (Fv, variable fluorescence $(F v = F m - F o)$ ), reflects the photosynthetic activity. Photosynthetic activity is measured as the efficiency of PSII (Fv/Fm). Three separate replicates were examined.

Photosynthetic pigments (chlorophyll a and b) were estimated using the spectrophotometric technique explained by Metzner et al.³² Carotenoids were quantified using the method of Horvath et al.³², as adopted by Kissimon.³³ For extraction, 0.1 g fresh wheat leaf was homogenized in 5 ml of 85% cold aqueous acetone for 5 min in the dark. The homogenate was centrifuged for 5 min at 1000 rpm, and the extract volume was adjusted with cold acetone. Pigment color intensity was measured at 663, 644, and 480 nm using a spectrophotometer, with pure 85% aqueous acetone. The subsequent equations were used to calculate the pigment portions as μg/ml:

$C h l o r o p h y l l a = 10.3 E 663 - 0.918 E 644 = μ g / m l .$
$C h l o r o p h y l l b = 19.7 E 644 - 3.87 E 663 = μ g / m l .$
$C a r o t e n o i d s = 5.02 E 480 = μ g / m l .$

Then, the portions were represented as mg/g dry weight of various treatments.

2.8. Estimation of CAT, POD, and SOD antioxidant enzyme activities

250 mg of fresh wheat shoots were frozen in liquid nitrogen and then ground into a fine powder using a pestle in a cooled mortar. The powder was then added to 10 mL of 100 mM phosphate buffer (KH₂PO₄/K₂HPO₄) at pH 6.8. The homogenates were centrifuged at 20000 rpm for 20 min. The supernatant was used to measure enzyme activities. Catalase activity was determined by measuring the initial rate of H₂O₂ depletion.³⁴ The reaction mixture (3 mL) contained 0.1 M sodium phosphate buffer (pH 7), 2 mM H₂O₂, and 0.1 mL of enzyme extract. Catalase activity was assessed by recording the change in absorbance at 240 nm and using the extinction coefficient of 40 mM cm⁻¹ at this wavelength for H₂O₂. Peroxidase (POD) activity was determined using the procedure of Kato and Shimizu.³⁵ The experimental medium consisted of 0.1 M sodium phosphate buffer (pH 5.8), 7.2 mM guaiacol, 11.8 mM H₂O₂, and 0.1 mL enzyme extract, with a final assay volume of 3 mL. The reaction was started by adding H₂O₂, and the absorbance was measured at 470 nm. POD activity was quantified using the guaiacol extinction coefficient (26.6 mM⁻¹ cm⁻¹ at 470 nm). Enzyme activity is expressed as μM of substrate converted per minute per gram of fresh weight (μM min⁻¹ g⁻¹ f. wt.). Superoxide dismutase (SOD) activity was measured based on its ability to inhibit the photochemical reduction of nitroblue tetrazolium chloride, following the Giannopolitis & Ries method.³⁶ The assay medium contained 50 μL of enzyme extract, 50 mM phosphate buffer (pH 7.8), 0.1 μM EDTA, 13 mM methionine, 75 μM nitroblue tetrazolium (NBT), and 2 μM riboflavin in a total volume of 1.5 mL. Riboflavin was added last. Tubes were shaken before being placed under a light bank (15 fluorescent lights) at 78 μmol m⁻² s⁻¹ for 15 min. After incubation, the lights were turned off and tubes were covered with a black cloth. Absorbance of the reaction mixture was measured at 560 nm. One unit of SOD activity was defined as the amount of enzyme required to inhibit 50% of the NBT photoreduction.

2.9. Determination of MDA, H₂O_2, and proline contents

The malondialdehyde (MDA) content was determined using the procedure depicted by Sun & Hu.³⁷ First, 0.15 g of wheat seedling leaf tissue was homogenized in an ice bath with 3 mL of 5% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 4000 rpm for 5 min at 5 °C. The resulting supernatant was carefully collected and mixed with 5 mL of 0.5% (w/v) thiobarbituric acid (TBA). This mixture was incubated in a boiling water bath at 100 °C for 10 min, then cooled on ice. The cooled mixture was centrifuged again at 1000 rpm for 5 min. The final supernatant was collected for spectrophotometric analysis at 450, 532, and 600 nm. The MDA concentration (n. mole/g. f. wt.) was estimated using the extinction coefficient (155 µM⁻¹ cm⁻¹). Hydrogen peroxide (H₂O₂) content was measured according to the method outlined by Velikova et al.³⁸ 100 mg of fresh wheat shoot was extracted with 5 ml of 0.1% trichloroacetic acid (TCA). After centrifugation at 12,000 rpm for 15 min, the supernatant was combined with 0.5 ml of 10 mM potassium phosphate buffer (pH 7.0) and 1 ml of 1 M potassium iodide. Absorbance was measured at 390 nm. The H₂O₂ concentration was estimated using the extinction coefficient (0.28 µM⁻¹ cm⁻¹) and reported as µmol/g. f. wt. Proline was quantified using the method of Bates et al.³⁹ For this, 100 mg of dry wheat shoot was homogenized in 10 ml of 3% aqueous sulfosalicylic acid. The mixture was centrifuged at 4000 rpm, and the supernatant was collected. This was combined with 2 ml of acidic ninhydrin reagent (1.250 g ninhydrin in 30 ml glacial acetic acid, 8 ml orthophosphoric acid, and 12 ml distilled water) and 2 ml of glacial acetic acid. The solution was heated at 100 °C for 1 h. After incubation, the reaction mixture was extracted with 5 mL of toluene. Absorbance of the toluene layer was measured at 520 nm, with toluene as the blank. Proline content was represented as mg/g dry weight, estimated from a proline calibration curve.

3. Gene expression analysis

3.1. RNA Extraction, cDNA Synthesis, and qRT-PCR

The RNeasy Plant Mini Kit was employed to isolate total RNA following the manufacturer's instructions (QIAGEN, Germany). cDNAs were synthesized using a reverse transcription kit (QIAGEN, Germany), following provider's instructions. qRT-PCR was conducted using a CFX96 real-time PCR system (Bio-Rad), with three replicates per sample. TaActin (GenBank accession MF405765.1) was chosen as the reference gene due to its reported stability in wheat transcriptomic studies.⁴⁰ Its consistent Ct values across all cultivars and stress durations (3 and 6 days) confirmed its suitability. The average Ct was 22.68 with a standard deviation of 1.48 and a coefficient of variation of 6.50%. One-way ANOVA found no significant differences among sample groups (p = 0.405), further supporting its use as a stable reference gene. The reaction mix was prepared as described in Table S5. This evaluated gene expression of the selected genes. The expression levels of the target genes were analyzed using the primers outlined in Table 2. The PCR protocol included an initial denaturation at 95 °C for 3 min, followed by 45 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 30 s. In qRT-PCR, relative quantification is used to determine gene expression levels by comparing the target gene to a reference gene. According to Livak & Schmittgen⁴¹, the difference (Δ) in the quantification cycle value (C_T) between the measured samples for the target gene (C_T target) and the reference gene (CT reference) is represented as ΔC_T. This difference is used to calculate relative quantities (RQ) using the exponential function efficiency (EFE) of the PCR reaction:

ΔC_T target = C_T target − C_T reference
ΔC_T control = C_T control − C_T reference

Table 2.

Primers and their respective sequences used in qRT-PCR for gene expression analysis.

Primer Name	Sequence (5′→3′)	Length	Tm
TaMYB73	F: TGGTGGCTCACATCGAGAAG	20	59.7 °C
TaMYB73	R: GGCCATCGAGTAGTCAGCAG	20	60.3 °C
TaNAC2	F: GACCTCTACCGCTTCGACC	19	59.6 °C
TaNAC2	R: GGCTCCATCATCGTCTCCTC	20	59.7 °C
TaWRKY13	F: ACCAGGACCCAGCAAAGAAT	20	59.2 °C
TaWRKY13	R: CGTTAGGAATGTCGGCTGCT	20	60.5 °C
TaOBF1b	F: GAAGAGGCGGCTGTCGAA	18	59.7 °C
TaOBF1b	R: TTGACCCAATCATCACCGGA	20	59.0 °C
WDREB2B	F: TCTCTGAAACGATCAGGCGA	20	59.9 °C
WDREB2B	R: GCTGAAGCACCACGTACAAC	20	59.7 °C
TaAPX	F: CCTATCCTGGTCCGTTTGGG	20	59.8 °C
TaAPX	R: TTCCAAGTGTGTGTGCTCCG	20	60.8 °C
TaCAT	F: CAACACCTACACGCTGGTGA	20	60.3 °C
TaCAT	R: GCGTGTCGGAGTAGGAGAAG	20	59.9 °C
W106	F: GCTCAGCAGATACAAGGGGA	20	59.2 °C
W106	R: ATTCTCAATGCCGAGTGGGG	20	60.1 °C
TaDHN2.1	F:GAAGGAGGAGCACGAGGATG	20	59.9 °C
TaDHN2.1	R: TCTGTCTTCACGTCACCGTC	20	59.7 °C
TaActin	F: GTGCCCATTTACGAAGGATA	20	58 °C
TaActin	R: GAAGACTCCATGCCGATCAT	20	60 °C

Open in a new tab

NCBI Primer-BLAST program (http://www.ncbi.nlm.nih.gov/tools/primer-blast) was employed to design primers.

The 2^−ΔΔCt technique is then applied to normalize the relative expression levels of target genes against the reference gene, based on the cycle threshold values: ΔΔCT = C_T target − C_T control. An expression value of 2^−ΔΔCT greater than 1 indicates upregulation of the target gene, while a value less than 1 suggests downregulation.

3.2. Statistical analysis

Statistical analyses were conducted using CoStat Software version 6.311 (CoHort Software, CA, USA). According to Bishop, the analyses employed a completely randomized block design with analysis of variance. Significance was assessed using L.S.D. values at P = 0.05 and 0.01.⁴² The results were investigated utilizing a one-way ANOVA to determine significance. The heatmap showing gene expression was constructed with GraphPad Prism Ver. 9.5.1 (San Diego, California USA). All measurements were performed using three biological replicates. For each biological sample, three technical replicates were used (n = 3 * 3).

4. Results

4.1. Impacts of PEG-induced osmotic stress on growth parameters of wheat seedlings

Six wheat cultivars (Misr1, Misr2, Misr3, Gemmiza9, Sids14, and Sakha95) were assessed at the seedling phase for their growth responses to severe osmotic stress. Stress was applied using 25% PEG-6000 prepared in Hoagland solution, after 3 and 6 day stress periods. Well-watered hydroponics sereved as a control group. The shoot height (SH), root depth (RD), fresh mass (FM), and dry mass (DM) are shown in Fig. 1, Fig. 2. Significant declines were observed in SH, shoot FM, DM, and root FM values. Conversely, RD and root DM significantly increased in all six wheat cultivars. SH varied significantly among cultivars under both control and osmotic stress conditions, with reductions ranging from 11% to 25% depending on cultivar and duration. Osmotic stress consistently reduced SH compared to controls, and the effect increased after 6 days. For example, Misr1 decreased by 14.2% after 3 days and 20.4% after 6 days. Gemmiza9 showed reductions of 19.7% and 34.5%, respectively. However it maintained the highest overall shoot height at 36.91 cm under control conditions after 6 days. Misr2 and Misr3 showed intermediate sensitivity, with reductions of 21.9% to 25.1%. Sids14 was moderately tolerant, with reductions between 13.9% and 15.7%. Sakha95 had the lowest absolute growth and reductions of 9.1% to 15.5%. This indicates a naturally low elongation capacity. Root depth also differed significantly among the cultivars. Under osmotic-stress conditions, each cultivar developed deeper roots than its control, although the amount varied by cultivar. After 3 days of osmotic stress, all cultivars showed increased root depth. Sids14 increased by 2.6% (6.27–6.54 cm) and Misr1 rose by 8.8% (10.03–11.26 cm). Misr1 and Sakha95 had the most pronounced early responses, gaining 1.23 cm and 1.57 cm, respectively. By day six, the effects of drought intensified. Misr1 and Sakha95 again showed the largest increases, from 10.39 to 12.49 cm and from 9.86 to 11.83 cm. Misr2 and Misr3 followed, with increases of 11.2% and 10.5%. Gemmiza9 and Sids14 had more modest increases. Sids14 consistently showed the lowest root depth, indicating genotype-specific limitations.

Fig. 2 — Growth parameters (A) shoot dry mass and (B) root dry mass of seedlings of six wheat cultivars subjected to drought stress by means of 25% PEG-6000. 14-day-old wheat seedlings were exposed to drought stress for 3 and 6 days. The results show the mean values ± SD of three biological replicates. Statistical significance was determined by the one-way ANOVA. Bars marked with different letters indicate significant differences (p ≤ 0.05).

All cultivars experienced a slight reduction in shoot fresh mass (FM) under osmotic stress at both 3 and 6 days. At 3 days, FM reductions ranged from 0.07 g in Misr1 (0.236 vs. 0.127 g) to 0.15 g in Misr3 (0.261 vs. 0.14 g). Notably, Gemmiza9 had the highest control FM (0.306 g) and maintained relatively high FM under stress (0.156 g), indicating superior short-term tolerance. By day 6, FM remained reduced across all cultivars (0.14–0.21 g), with Misr1 (0.279 vs. 0.138 g) and Sids14 (0.293 vs. 0.095 g) as notable examples. In addition to FM, shoot dry mass (DM) also declined under osmotic stress, with more pronounced reductions at 6 days and variation by genotype. Specifically, at 3 days, shoot DM decreased by 4.3% (Misr2), 8.1% (Misr1), 8.7% (Sakha95), 10.3% (Gemmiza9), and 10.4% (Misr3), while Sids14 increased by 11.5%, suggesting initial drought stimulation. By 6 days, DM reductions ranged from 6.0% (Misr1) to 37.6% (Gemmiza9), identifying Gemmiza9 as the most sensitive late-stage cultivar. Under control conditions, all cultivars increased DM from 3 to 6 days, reflecting normal growth. However, under stress, Misr1, Misr3, and Sakha95 partially recovered or maintained growth, while Gemmiza9, Misr2, and Sids14 declined at later stages. Overall, Gemmiza9 was most sensitive at 6 days, while Misr1, Misr3, and Sakha95 demonstrated greater resilience.

Root FM was markedly affected by drought: at 3 days, osmotic stress reduced root FM by 10–65.7%. Misr3 showed the smallest decline (0.022 vs. 0.017 g; 10%), while Sakha95 had the largest (0.062 vs. 0.014 g; 65.7%). Misr1 and Misr2 declined by 44.3% and 31.4%, while Gemmiza9 and Sids14 declined by 53.3% and 51.7%. At 6 days, Sakha95 showed a less severe reduction than at 3 days (0.039 vs. 0.026 g; 20%). In contrast, root DM increased under osmotic stress across all cultivars, especially at 3 days, with gains from + 29.7% in Sakha95 (0.0096 vs. 0.0074 g) to +64.8% in Misr2 (0.0117 vs. 0.0071 g). Misr1 (+53.6%), Misr3 (+48.5%), Gemmiza9 (+43.6%), and Sids14 (+37%) had intermediate increases. By 6 days, the positive effect persisted, though it was less pronounced in some genotypes. Misr1 (+58.3%), Misr2 (+53.2%), and Misr3 (+45.7%) still showed high increases, while Gemmiza9 (+9.5%), Sids14 (+5.9%), and Sakha95 (+5.0%) showed only modest gains. Over time, under control conditions, root DM increased from 3 to 6 days by +2.9–11.3% (e.g., Misr2: 0.0071 → 0.0079 g). Under osmotic stress, from 3 to 6 days, root DM continued to increase in Misr1–Misr3 (+0.99–10.5%), but declined in Gemmiza9, Sids14, and Sakha95 (–12.5 to –18.9%), indicating an early surge followed by stabilization or decline in these genotypes.

4.2. Impacts of PEG-induced osmotic stress on relative water content and root-shoot ratio of wheat seedlings

Relative water content (RWC) closely correlates with osmotic stress resistance and responds quickly to changes in osmotic conditions. The results showed that osmotic stress significantly decreased RWC in both shoots and roots across all six wheat cultivars compared to the control (Table 3). After 3 and 6 days of drought stress, Sids14 recorded the lowest average shoot RWC (78.1% and 75.9%), while Misr1 had the highest average shoot RWC (84.6% and 82.9%). For roots, Gemmiza9 recorded the lowest average RWC (37.3% and 64.6%) and Misr1 had the highest (69.9% and 79.6%) after 3 and 6 days of osmotic stress, respectively.

Table 3.

RWC and root-shoot ratio of seedlings of six wheat cultivars (Misr1, Misr2, Misr3, Gemmiza9, Sids14, and Sakha95) cultivated under control conditions for 14 days, followed by exposure to drought stress for 3- and 6-days using 25% PEG-6000.

Treatment period	Cultivar	Shoot RWC (%)	Root RWC (%)	Root/shoot ratio
Control (3-days)	Misr1	91.1 ± 0.3 ^a	90.4 ± 1.6 ^a	0.265 ± 0.014 ^fg
	Misr2	89.5 ± 0.7 ^a	87.6 ± 1.7 ^ab	0.304 ± 0.012 ^efg
	Misr3	89.9 ± 1.7 ^a	72.4 ± 2.4 ^d	0.262 ± 0.017 ^fg
	Gemmiza9	89.2 ± 0.1 ^a	84.7 ± 1.7 ^bc	0.236 ± 0.022 ^g
	Sids14	89.9 ± 0.3 ^a	83.4 ± 1.3^c	0.348 ± 0.022 ^de
	Sakha95	89.9 ± 1.2 ^a	87.9 ± 1.9 ^ab	0.319 ± 0.009 ^def
Drought (25% PEG) (3-days)	Misr1	84.6 ± 2.3^b	69.9 ± 1.3 ^e	0.446 ± 0.033 ^bc
	Misr2	79.7 ± 0.8 ^d	69.1 ± 0.7 ^de	0.52 ± 0.079 ^a
	Misr3	83.3 ± 3.9 ^bc	44.2 ± 3.5^f	0.443 ± 0.056 ^bc
	Gemmiza9	81.1 ± 2^cd	37.3 ± 3.7 ^g	0.38 ± 0.018 ^cd
	Sids14	78.1 ± 1.5 ^d	40.7 ± 2.2 ^fg	0.46 ± 0.077 ^ab
	Sakha95	84.8 ± 0.8^b	39.5 ± 1.9 ^h	0.455 ± 0.043 ^ab
Control (6-days)	Misr1	90.9 ± 2.2 ^a	88.5 ± 1.8 ^a	0.245 ± 0.066 ^e
	Misr2	89.2 ± 1.1 ^a	82.9 ± 2.6^b	0.302 ± 0.022 ^de
	Misr3	90.7 ± 0.4 ^a	75 ± 3.1 ^e	0.254 ± 0.013 ^e
	Gemmiza9	89.9 ± 1.3 ^a	82.8 ± 1.2^b	0.239 ± 0.017 ^e
	Sids14	91.6 ± 1.4 ^a	78.7 ± 0.7 ^cd	0.305 ± 0.033 ^cde
	Sakha95	91.8 ± 1.3 ^a	78 ± 2.9 ^cde	0.358 ± 0.037 ^bcd
Drought (25% PEG) (6-days)	Misr1	82.9 ± 0.4^b	79.6 ± 1.3 ^bc	0.401 ± 0.006 ^bc
	Misr2	79.9 ± 3.7^c	75.4 ± 2.8 ^de	0.567 ± 0.068 ^a
	Misr3	76.5 ± 0.8 ^d	67.6 ± 0.3 ^fg	0.406 ± 0.009^b
	Gemmiza9	77.9 ± 1.2 ^cd	64.6 ± 0.9 ^g	0.419 ± 0.029^b
	Sids14	75.9 ± 0.6 ^d	67.1 ± 1.1 ^fg	0.405 ± 0.011^b
	Sakha95	77.2 ± 2.6 ^cd	68.8 ± 3.1^f	0.371 ± 0.043 ^bcd
Significance		High ***	High ***	High ***

Open in a new tab

Values are the mean ± SD of 3 replicates. Values with different letters indicate significant differences (p ≤ 0.05). Statistical significance was determined using one-way ANOVA (* p ≤ 0.05, ** p ≤ 0.01, *** highly significant).

Osmotic stress increased the root-to-shoot ratio in all cultivars, shifting biomass toward roots. After 3 days, the largest increases occurred in Misr2 (+71.1%), Misr3 (+69.1%), and Misr1 (+68.3%), with smaller increases in Gemmiza9 (+61.0%), Sakha95 (+42.6%), and Sids14 (+32.2%). This indicates strong early plasticity, particularly in Misr1, Misr2, and Misr3. By day 6, the shift persisted but varied by genotype: Misr2 showed the highest increase (+87.6%), followed by Gemmiza9 (+75.7%), Misr1 (+63.8%), and Misr3 (+59.7%). In contrast, Sids14′s increase was modest (+32.6%), and Sakha95′s was minimal (+3.8%), suggesting reduced root allocation over time. Under control conditions, ratios were stable or slightly decreased from 3 to 6 days, except for minor increases in Gemmiza9 (+1.1%) and Sakha95 (+12.2%). In comparison, under drought, ratios declined in Misr1 (−10.1%), Misr3 (−8.4%), Sids14 (−12.0%), and Sakha95 (−18.4%), but increased in Misr2 (+9.1%) and Gemmiza9 (+10.4%), indicating sustained reallocation in these two genotypes. Overall, these results show that osmotic stress leads to a pronounced, genotype-specific increase in root investment, most persistent in Misr2 and Gemmiza9.

4.3. Impacts of PEG-induced osmotic stress on photosynthetic activity, chlorophyll a, chlorophyll b, and carotenoids in wheat seedlings

The data show that photosynthetic activity significantly decreased in all six wheat seedlings (Fig. 3A). Specifically, Sids14 recorded the lowest average Fv/Fm (0.48) after a 3-day osmotic stress period, while Misr1 recorded the highest (0.691). By the end of a 6-day stress period, however, Misr1 had the lowest average Fv/Fm (0.307), whereas Sakha95 had the highest (0.726). In contrast, Misr2, Misr3, and Sakha95 showed an increase in photosynthetic activity from 0.659, 0.602, and 0.534 Fv/Fm to 0.612, 0.618, and 0.726 Fv/Fm at the end of 3- and 6-day stress periods, respectively. Furthermoe, chlorophyll a pigment concentrations reduced in all wheat seedlings under harsh osmotic stress. After 3 days, Sids14 had the lowest mean (1.91 mg g⁻¹ dry wt⁻¹), while Sakha95 had the highest (3.76 mg g⁻¹ dry wt⁻¹). The trend shifted after 6 days, with Misr3 showing the lowest mean (0.55 mg g⁻¹ dry wt⁻¹) and Misr1 the highest (2.77 mg g⁻¹ dry wt⁻¹) (Fig. 3B). Regarding chlorophyll b content, stressed seedlings showed lower level than control seedlings, except for Misr1 and Gemmiza9 (1.4, 1.64, 1.49, and 1.7 mg g⁻¹ dry wt⁻¹) after 3 days (Fig. 3C). Additionally, a notable increase in chlorophyll b was observed in Misr1 compared to the control (3.39 and 1.73 mg g⁻¹ dry wt⁻¹ after 6 days). Finally, stressed seedlings showed a decrease in carotenoid (car) content relative to control seedlings, except for Misr1 (1.09 and 1.07 mg g⁻¹ dry wt⁻¹ after 6 days).

5. Impacts of PEG-induced osmotic stress on differential response of antioxidant enzymes in wheat seedlings

The results indicate a significant rise in the antioxidant activities of catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD) in all stressed wheat seedlings compared to controls at the end of 3- and 6-day periods (Table 4). Misr3 exhibited the highest average CAT activity (0.0032 µM/g F. wt. m⁻¹) during the 3-day stress phase. After 6 days, Misr2 and Misr1 recorded the highest average CAT activity (0.00787 and 0.0076 µM/g F. wt. m⁻¹, respectively). For POD, Sakha95 showed an initial increase of 50.74% after 3 days (0.205 vs. 0.136 µM/g F. wt. m⁻¹). This value then declined by 37.20% after 6 days (0.265 µM/g F. wt. m⁻¹ vs. 0.422 µM/g F. wt. m⁻¹). These results indicate early activation followed by possible enzyme inhibition under prolonged stress. Misr1 showed the highest average POD activity (1.312 µM/g F. wt. m⁻¹) after 3 days, while Misr3 reached the highest at 6 days (0.456 µM/g F. wt. m⁻¹). POD activity in Sakha95 increased compared to the control after 3 days (0.205 vs. 0.136 µM/g F. wt. m⁻¹) but decreased after 6 days (0.265 vs. 0.422 µM/g F. wt. m⁻¹). Sakha95 also had the highest SOD activity (0.566 µM/g F. wt. m⁻¹) after 3 days, while Gemmiza9 showed the highest SOD activity (1.318 µM/g F. wt. m⁻¹) after 6 days. After 3-day stress period, Sids14 exhibited reduced SOD activity compared to the control (0.172 vs. 0.396 µM/g F. wt. m⁻¹). However, after 6 days of osmotic stress, SOD activity in Sids14 increased (0.513 vs. 0.286 µM/g F. wt. m⁻¹). SOD activity in Sids14 decreased by 56.57% at 3 days (0.172 vs. 0.396 µM/g F. wt. m⁻¹), then increased by 79.37% at 6 days (0.513 vs. 0.286 µM/g F. wt. m⁻¹). This indicates delayed activation of superoxide detoxification pathways. Together, these findings underscore the complexity of antioxidant regulation: CAT and SOD show rapid activation for ROS detoxification, while POD shows cultivar-specific adaptation to prolonged stress.

Table 4.

Differential response of CAT, POD, and SOD antioxidant activities in seedlings of six wheat cultivars (Misr1, Misr2, Misr3, Gemmiza9, Sids14, and Sakha95) cultivated under control conditions for 14 days, followed by exposure to drought stress for 3- and 6-days using 25% PEG-6000.

Treatment period	Cultivar	CAT activity (µM/g F.wt. m⁻¹)	POD activity (µM/g F.wt. m⁻¹)	SOD activity (µM/g F.wt. m⁻¹)
Control 3-days	Misr1	0.0011 ± 0.00006 ^cde	0.457 ± 0.013 ^d	0.168 ± 0.024 ^gh
	Misr2	0.0014 ± 0.00031 ^bc	0.098 ± 0.011 ^h	0.145 ± 0.011 ^h
	Misr3	0.0028 ± 0.00056 ^a	0.258 ± 0.009 ^ef	0.256 ± 0.017 ^f
	Gemmiza9	0.0006 ± 0.00005 ^ef	0.154 ± 0.012 ^gh	0.285 ± 0.004 ^e
	Sids14	0.0005 ± 0.00005 ^ef	0.138 ± 0.01 ^gh	0.396 ± 0.009 ^c
	Sakha95	0.0005 ± 0.00007 ^f	0.136 ± 0.007 ^gh	0.427 ± 0.012 ^b
Drought (25% PEG) 3-days	Misr1	0.0012 ± 0.00003 ^bcd	1.312 ± 0.118 ^a	0.432 ± 0.026 ^b
	Misr2	0.0016 ± 0.00003 ^b	0.665 ± 0.071 ^c	0.317 ± 0.013 ^d
	Misr3	0.0032 ± 0.00081 ^a	0.989 ± 0.019 ^b	0.395 ± 0.015 ^c
	Gemmiza9	0.0013 ± 0.00014 ^bc	0.45 ± 0.031 ^d	0.452 ± 0.011 ^b
	Sids14	0.0007 ± 0.00002 ^def	0.302 ± 0.004 ^e	0.172 ± 0.011 ^g
	Sakha95	0.0012 ± 0.00028 ^bcd	0.205 ± 0.004 ^fg	0.566 ± 0.007 ^a
Control 6 days	Misr1	0.00057 ± 0.00026 ^d	0.145 ± 0.014 ^ef	0.341 ± 0.002 ^ef
	Misr2	0.0004 ± 0.0002 ^def	0.183 ± 0.014 ^e	0.524 ± 0.015 ^bc
	Misr3	0.00063 ± 0.00017 ^de	0.131 ± 0.011 ^ef	0.344 ± 0.006 ^ef
	Gemmiza9	0.00016 ± 0.00004 ^ef	0.116 ± 0.006^f	0.601 ± 0.005^b
	Sids14	0.00012 ± 0.00006^f	0.096 ± 0.006^f	0.286 ± 0.008^f
	Sakha95	0.00063 ± 0.00022 ^de	0.422 ± 0.008 ^a	0.372 ± 0.011 ^e
Drought (25% PEG) 6 days	Misr1	0.0076 ± 0.00273^b	0.25 ± 0.02 ^d	0.467 ± 0.106 ^cd
	Misr2	0.00787 ± 0.00493 ^a	0.282 ± 0.007 ^cd	0.6 ± 0.004^b
	Misr3	0.00721 ± 0.00057 ^c	0.456 ± 0.104 ^a	0.393 ± 0.012 ^de
	Gemmiza9	0.0065 ± 0.00123 ^c	0.318 ± 0.013 ^bc	1.318 ± 0.133 ^a
	Sids14	0.00635 ± 0.00172 ^c	0.341 ± 0.005 ^b	0.513 ± 0.003 ^c
	Sakha95	0.00633 ± 0.00227 ^c	0.265 ± 0.015 ^cd	0.401 ± 0.011 ^de
Significance		High ***	High ***	High ***

Open in a new tab

5.1. Impacts of PEG-induced osmotic stress on MDA, H₂O_2, and proline levels in wheat seedlings

Malondialdehyde (MDA) is a reactive oxygen species (ROS) byproduct that oxidizes membrane lipids. Therefore, MDA production is considered an indirect indicator for assessing the damaging effects of osmotic stress on membranes. As depicted in Fig. 4A, all six wheat cultivars displayed a significant increase in MDA concentrations under 25% PEG-induced osmotic stress compared to control conditions. Misr3 and Sids14 recorded the highest average values (1076.5 and 1055.6 nmol/g f. wt., respectively) at the end of a 3-day stress period. Meanwhile, Misr2 and Misr3 recorded the highest average values (1032.3 and 1030 nmol/g f. wt., respectively, at the end of a 6-day stress period). Misr1 showed the lowest MDA levels (597.5 nmol/g f. wt.) after 3 days of stress. However, after 6 days, Misr1 had a higher MDA concentration (804.5 nmol/g f. wt.) than the control (583.6 nmol/g f. wt.). As depicted in Fig. 4B, all six wheat seedlings showed significant reductions in H₂O₂ content after 3 and 6 days of 25% PEG 6000 treatment compared to control seedlings. Gemmiza9 recorded the lowest mean H₂O₂ content (7.2 nmol/g. f. wt.), while Sids14 recorded the lowest (3.9 nmol/g. f. wt.) at the end of 3 and 6 days, respectively. Sakha95, Misr2, and Misr1 registered the highest mean H₂O₂ levels (8.41, 8.82, and 8.15 nmol/g f. wt., respectively) after 3 days of stress. Similarly, at 6 days, these genotypes showed the highest mean H₂O₂ contents (5.94, 6.47, and 7.15 nmol/g. f. wt., respectively). Wheat genotypes with higher proline concentrations under drought conditions were selected for their drought resistance compared to controls. As shown in Fig. 4C, applying 25% PEG 6000-induced drought significantly increased proline content in all wheat seedlings after 6 days. Misr2 had the highest mean proline value (46.3 mg/g d. wt.) after 6 days. Significant differences in proline accumulation were observed after 3 days of treatment with 25% PEG 6000. Gemmiza9 and Misr 1 had the highest mean proline levels (45.86 and 44.61 mg/g d. wt., respectively) at 3-day stress. Sakha 95′s proline content decreased (28.97 mg/g.d.wt.) after 3 days compared to the control (40.58 mg/g.d.wt.), but it increased again (30.8 mg/g.d.wt.) after 6 days of stress, surpassing the control (28 mg/g.d.wt.).

Fig. 4 — MDA content (A), H₂O₂ content (B), and proline content (C) in seedlings of six wheat cultivars exposed to drought stress using 25% PEG-6000. Fourteen-day-old wheat seedlings underwent drought stress for 3 and 6 days. The results show the mean values ± SD of three biological replicates. Statistical significance was determined by one-way ANOVA. Bars marked with different letters indicate significant differences (p ≤ 0.05).

5.2. Gene expression analysis of transcription factors and osmotic stress -responsive genes in wheat seedlings

qRT-PCR was performed to examine the expression levels of TFs and genes associated with drought stress. Five drought-responsive TF genes (TaMYB73, TaNAC2, TaOBF-1B, TaWRKY13, and WDERB-2B), three antioxidant genes (TaAPX, TaCAT, and W106), and the drought-responsive gene (TaDHN2.1) were chosen to assess their expression under severe drought conditions.

5.3. Tfs genes TaMYB73, TaNAC2, TaOBF-1B, TaWRKY13, and WDERB-2B

Fig. 5 (A) shows that after 3 days of severe osmotic stress, TaMYB73 levels increased in Misr1, Misr2, Misr3, and Gemmiza9 compared to the control. Misr2 showed the highest TaMYB73 expression, approximately 1.56-fold. However, TaMYB73 levels decreased in Sids14 (0.15-fold) and Sakha95 (0.11-fold). After 6 days of severe osmotic stress, all cultivars showed increased TaMYB73 expression compared to the control. Misr3 showed the highest TaMYB73 expression, approximately 6.32-fold. Meanwhile, Sids14 and sakha95 showed slight increases (1.06- and 1.32-fold, respectively). Fig. 5 (B) shows that after 3 days of severe osmotic stress, TaNAC2 levels declined in all wheat cultivars compared to the control group. Misr3 had the smallest decrease in fold change, around 0.41-fold. Sids14 showed a small decrease of about 0.83-fold. However, after 6 days of severe osmotic stress, all cultivars showed increased TaNAC2 levels compared to the control. Misr2 had the highest gene fold at about 5.98-fold. In contrast, Misr1 showed a slight increase (1.5-fold). TaOBF-1B qRT-PCR results demonstrate an increase in Misr1, Misr2, Misr3, and Gemmiza9 cultivars and a decrease in Sids14 and Sakha95 cultivars after 3 days of severe osmotic stress, as exhibited in Fig. 5 (C). Misr1 had the highest TaOBF-1B expression at about 2.13-fold, while Sids14 had the smallest decrease in TaOBF-1B expression at around 0.38-fold. All cultivars showed an increase in TaOBF-1B after 6 days of severe osmotic stress compared to the control. Misr1 had the highest gene fold at about 6.92-fold. Meanwhile, Misr3 showed a slight increase (1.22-fold). The qRT-PCR results for TaWRKY13 show a decrease in fold change across all cultivars, except Gemmiza9, which showed a small increase (1.05-fold) after 3 days of severe osmotic stress (Fig. 5D). However, after 6 days of severe osmotic stress, all cultivars showed a higher TaWRKY13 fold change than the control. Gemmiza9 and Misr2 had the highest TaWRKY13 expression, about 5.62- and 5.32-fold, respectively. Sakha95 showed the lowest increase in TaWRKY13 expression at 1.22-fold. The WDERB-2B qRT-PCR results reveal an increase in fold change in all wheat cultivars after 3 and 6 days of severe osmotic stress compared to the control, as displayed in Fig. 5(E). Sahka95 showed the highest WDERB-2B expression at 3.94- and 13.45-fold after 3 and 6 days of stress, respectively. Meanwhile, Misr1 and Misr3 showed the smallest increases in WDERB-2B expression, at 1.14- and 2.79-fold after 3 and 6 days of stress, respectively.

5.4. Osmotic stress -related antioxidant genes TaAPX, TaCAT, and W106

As demonstrated in Fig. 6(A), all wheat cultivars exhibited higher relative expression of TaAPX after 3 and 6 days of severe osmotic stress compared to the control. Sids14 and Sahka95 showed the highest fold changes after 3 days (1.99- and 1.61-fold, respectively) and 6 days (4.96- and 5.94-fold, respectively). Meanwhile, Misr1 showed the smallest increase in TaAPX expression (1.16- and 1.96-fold) after 3 and 6 days of stress, respectively. Similarly, qRT-PCR results revealed that TaCAT expression increased in all wheat cultivars after 3 and 6 days of severe osmotic stress compared to the control, as shown in Fig. 6(B). Misr2 showed the most significant increase in TaCAT expression (2.08- and 4.41-fold) after 3 and 6 days of drought stress, respectively. Conversely, Misr3 showed the smallest increase in TaCAT expression (1.55- and 3.23-fold) after 3 and 6 days of stress, respectively. Additionally, qRT-PCR results revealed that W106 expression increased in all wheat cultivars after 3 and 6 days of severe osmotic stress compared to the control, as shown in Fig. 6(C). Misr3 showed the highest increase in W106 expression (1.88-fold) after three days of drought stress. In contrast, Sids14 and sakha95 showed the smallest increases in W106 expression (1.26- and 1.3-fold, respectively) after 3 days. However, Sids14 and sakha95 exhibited the highest fold changes after 6 days of stress, with approximately 7.52- and 8.88-fold increases, respectively. Meanwhile, Misr1 demonstrated the lowest increase in W106 expression (2.07-fold) after 6 days of stress.

5.5. Osmotic stress responsive genes TaDHN2.1

qRT-PCR results indicated that TaDHN2.1 expression increased in all wheat cultivars after 3 and 6 days of severe osmotic stress compared to the control, as shown in Fig. 6D. After 3 days, Misr2 exhibited the highest increase in TaDHN2.1 expression (4.92-fold), while Gemmiza9 showed the smallest increase (1.53-fold) among the tested cultivars. By contrast, after 6 days of stress, Gemmiza9 showed the largest increase in expression (7.78-fold), whereas Sakha95 showed the smallest increase (3.43-fold) compared to other cultivars.

5.6. Heatmap analysis of expressed genes

The gene expression heatmap clearly showed that most genes were induced after 6 days of PEG treatment. Additionally, WDERB-2B was the most highly upregulated gene, especially in Sakha95 (13.45-fold), followed by Sids14 (10.63-fold), Misr2, and Gemmiza9 (8.28-fold). TaDHN2.1 was the highly induced gene (7.78-fold) after 6 days in Gemmiza9 (Fig. 7), followed by Misr3 (6.45-fold). Similarly, W106 was highly expressed in Sakha95 (8.88-fold), followed by Sids14 (7.52-fold).

Fig. 7 — Heatmap of the expression of TaMYB73, TaNAC2, TaOBF-1B, TaWRKY13, WDERB-2B, TaAPX, TaCAT, W106, and TaDHN2.1. genes in seedlings of six wheat cultivars exposed to drought stress by means of 25% PEG-6000. The results represent the mean values of three replicates. The expression levels are indicated by a graded color scale from blue to red. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

6. Discussion

Plants, because of their immobile nature, encounter wide variety of climatic conditions, including extreme temperatures, drought, salinity, pollution, and pathogens.⁴³ Drought disrupts many physiological and biochemical functions, including photosynthesis, nitrogen uptake, and metabolism.⁴⁴ To understand how plants tolerate drought, it helps to assess key physiological traits and biochemical markers.⁴⁵ Combining physiological responses with gene expression analysis in wheat may help mitigate the impacts of drought stress. In our study, growth and physiological parameters were measured and their relationships with biochemical markers, including photosynthetic pigment content, antioxidant enzyme activity, membrane lipid peroxidation, and proline production were examined. We also assessed root-shoot ratios and relative water content in roots and shoots. Comparative qRT-PCR analyses to identify the most drought-tolerant among six Egyptian wheat cultivars: Misr1, Misr2, Misr3, Gemmiza9, Sids14, and Sakha95 were conducted.

This study showed that drought stress significantly decreased SH, shoot FM, root FM, and shoot DM in nearly all wheat cultivars compared with the control. Under drought conditions, water availability decreases,⁴⁶ leading to a loss of turgor that inhibits cell elongation and division in the shoot apical meristem, the area responsible for new growth. Consequently, the shoots become shorter.⁴⁷ In response, reduced shoot development lowers the plant’s metabolic demands and concentrates metabolites needed for synthesizing defense compounds essential for osmotic adjustment. Notably, these findings align with those of Ahmad et al.⁴⁸, who observed that wheat plant morphological traits were significantly reduced under drought. Various factors, including decreased photosynthesis and disturbances in mineral uptake, protein synthesis, and glucose metabolism, can explain reduced shoot growth under drought.49, 50 Furthermore, osmotic stress markedly reduces dry matter accumulation by decreasing photosynthesis, cell growth and expansion, and nutrient uptake, as well as promoting senescence and the quick production of stress hormones such as abscisic acid (ABA).⁵¹ Finally, these results align with those of Orabi et al, who observed drought-induced reductions in both maize and canola biomass.⁵²

Also in our study, we found that osmotic stress significantly increased RD and root dry mass (DM) in all stressed wheat cultivars compared with the control. Notably, Misr1, Misr2, and Sakha95 had the highest RD, suggesting greater tolerance for water scarcity. This observation is consistent with Bardhan et al., who found that drought-resistant cultivars exhibit greater root flexibility under changing growth conditions.⁵³ Similarly, Li et al. reported that drought-tolerant cultivars tend to have more roots and produce more root/shoot ratios during the seedling stage.⁵⁴ These findings align with Mickky & Aldesuquy,⁵⁵ who examined certain morphological characters in wheat seedlings following exposure to PEG treatments. Misr1 was the most tolerant cultivar tested, followed by Misr2 and Gemmiza9. In contrast, Sids14 had the lowest RD values during 3- and 6-day stress periods, indicating reduced resilience to osmotic stress. Together, these findings show that osmotic stress promotes root growth in all cultivars while revealing genotypic differences. This underscores the importance of selecting suitable genotypes for stress management. Consequently, breeders should prioritize Misr1, Misr2, and Gemmiza9 when developing drought-tolerant wheat, whereas Sids14 requires targeted improvement strategies due to its sensitivity. Additionally, osmotic stress increases root dry matter accumulation, with Misr1 and Misr2 showing the strongest and most sustained responses, highlighting their superior capacity for rapid carbon allocation to roots under water deficit.

The RWC, which indicates tissue metabolic activity, accurately measures plant water status and is commonly used to assess drought resistance. Under osmotic stress conditions, RWC mainly reflects how well more tolerant species can absorb soil water and reduce stomatal water loss.56, 57 In this study, the decline in root and shoot RWC was greater in the Sids14 and Gemmiza9 cultivars after 3 and 6 days of drought stress, respectively, whereas the Misr1 cultivar exhibited a smaller loss in root and shoot RWC. These findings suggest that Misr1 may be more drought-tolerant than the other six wheat cultivars. Previous study ⁴⁷ also reported that drought stress considerably reduced wheat plant RWC, supporting supports these findings. Furthermore, studies found that species retaining a higher RWC under osmotic stress experience less impact from low water potential, enabling them to sustain growth and productivity.⁵⁸ Similarly, Eftekhari et al. observed that tolerant cultivars retained more water than non-tolerant cultivars, although RWC decreased sharply under drought stress.⁵⁹ In our study, drought stress caused a significantly greater rise in the root-shoot ratio in the Misr2 cultivar than in the other six wheat cultivars after 3 and 6 days of drought, indicating that Misr2 has a greater phenotypic plasticity in adapting to drought stress. This result algins with the finding of Licaj et al.⁶⁰, who noted that the root-shoot ratio in the Saragolla wheat cultivar increased significantly under osmotic stress, suggesting that this traditional variety exhibits greater phenotypic flexibility in response to environmental changes. This pattern supports an adaptive shift toward root growth to improve water acquisition.

Compared with the control, this study showed significant reductions in chlorophyll a, chlorophyll b, and carotenoid content in almost all stressed wheat cultivars. Several crops, including wheat, have shown reduced chlorophyll production under drought stress, consistent with our findings.⁶¹ Chlorophyll is a key component of chloroplasts, essential for photosynthesis and the photosynthetic rate.⁶² Reducing chlorophyll in response to water deficiency indicates oxidative stress damage produced by chlorophyllase enzymes.⁶³ However, these findings contradict previous reports, where Chl-a content in stressed wheat leaves increased compared to non-stressed leaves, which may occur specific conditions such as moderate water stress.⁶⁴ This suggests that chlorophyll response to drought may depend on the severity or duration of the stress. Some studies also suggest that carotenoid content may increase under mild or early drought stress as a defense mechanism against photo-oxidative damage, but the general trend observed in wheat under more harsh or prolonged drought stress is a decrease in carotenoid levels.⁶⁵ Additionally, Batool et al.⁶⁶ found that 15% PEG treatments on sensitive and tolerant plants reduced chlorophyll (a, b, total) and carotenoid levels, which aligns with our results. Based on these findings, Sids14 appears to be the most drought-sensitive among the six wheat cultivars, while Misr1 and Sakha95 may be more drought-resistant.

Plants have a complex system of antioxidant enzymes and non-enzymatic components that defend cells from ROS overproduction under stress.67, 68 As a result of drought stress, photochemical efficiency decreases, ROS production increases, and oxidative damage worsens.⁶⁹ Plants with higher levels of induced antioxidants show improved resistance and tolerance to oxidative stress.⁷⁰ Catalase (CAT) helps break down hydrogen peroxide (H₂O₂) into oxygen and water, reducing levels of this potentially toxic compound. POD oxidizes various compounds using H₂O₂, preventing excessive H₂O₂ accumulation under stressful conditions. SOD enables plants to eliminate superoxide radicals by converting them into oxygen and hydrogen peroxide during stress.⁷¹ The present investigation observed that severe drought stress significantly increased the activities of CAT, POD, and SOD compared to the control. Misr1, Misr2, and Misr3 showed the largest increases in CAT and POD activity after 3 and 6 days of stress. In contrast, Sids14 displayed a decrease in SOD activity after three days of stress. These findings highlight the critical role of antioxidant enzymes in conferring drought tolerance and underscore the genotypic variability in stress response mechanisms. Cultivars with strong antioxidant defenses, such as Misr1, Misr2, and Misr3, are promising candidates for breeding programs to improve drought resilience. Conversely, the vulnerability of Sids14 suggests that enhancing its antioxidant capacity through genetic or agronomic interventions could be a strategy to mitigate drought-induced oxidative stress. Qayyum et al.⁷² stated that antioxidant enzyme activity increases during abiotic stress, reflecting enhanced cellular defense. However, these results contradict Dvojković et al.⁷³, who found that CAT activity decreased under drought stress compared with the control in wheat varieties (Nada, Dubrava, and Njivka). Based on our findings, Sids14 appears to be the most drought-sensitive among the six wheat cultivars, while Misr1, Misr2, and Misr3 may be more drought-resistant.

The link between H₂O₂ concentration and its biological effect in plants is the most important factor. However, other factors, such as where it is produced, the plant's growth stage, and prior stress exposure, also matter.74, 75 As a result, whether H₂O₂ levels are low or high influences whether its impact on plants is harmful or helpful.⁷⁶ In this study, all cultivars showed a significant decrease in H₂O₂ levels. Sids14, Sakha95, and Misr2 showed the most significant reductions after 6 days of water shortage, while Misr1 and Misr3 showed smaller decreases, likely due to higher activity of CAT and POD enzymes in response to drought stress. CAT breaks down H₂O₂ into oxygen and water, lowering the levels of this potentially harmful substance.

Plants respond to abiotic stresses such as water shortage by accumulating intracellular proline.⁷⁷ Wheat genotypes with higher proline under drought typically chosen for drought resistance.⁷⁸ In our study, we found that drought stress caused a significant rise in proline content in Gemmiza9 and Misr2 after 3 days of drought stress and in all stressed cultivars after 6 days. This finding algins Chowdhury et al.⁷⁹, who found that proline accumulation depends on cultivar genetic capacity and the severity and duration of drought stress.

Accumulation of MDA and H₂O₂ is a key marker of drought-induced oxidative stress, which disrupts various physiological and cellular functions, including transpiration, photosynthesis, stomatal conductance, membrane activity, water-use efficiency, carboxylation efficiency, and respiration.⁸⁰ Consequently, MDA content is commonly used to evaluate oxidative damage and stress levels in plants. By measuring MDA levels, the effect of drought on wheat and identify more drought-tolerant varieties can be assessed. In this study, drought-induced oxidative stress consistently increased MDA production across all wheat cultivars. The most severe damage, as indicated by this stress marker, was observed in Misr3 and Sids14 (1076.5 and 1055.6 nmol/g fresh weight) after a 3-day stress period. In contrast, the least damage was observed in Misr1 (597.5 nmol/g fresh weight), indicating notably greater tolerant of drought stress. These findings align with those of Ishfaq et al.⁸¹, who also showed that drought stress increased MDA levels in wheat varieties (Punjab-2011 and Anaaj-201).

The results of this study indicated that nearly all transcription factor genes (TaMYB73, TaNAC2, TaOBF-1B, TaWRKY13, WDERB-2B, TaAPX, TaCAT, W106, and TaDHN2.1) showed significant increases in expression in all wheat cultivars after 3 and 6 days of osmotic stress in comparison with controls. Gemmiza9 and Misr2 showed the highest TaWRKY13 expression levels among all cultivars after 6 days of osmotic stress, suggesting that prolonged drought stress induces TaWRKY13 (used to simulate drought tolerance) and that it may be involved in drought responses. WRKY13 was found to play a role in numerous physiological functions; for example, an AtWRKY13 mutant exhibited a weaker stem phenotype, reduced sclerenchyma formation, and distorted lignin synthesis, indicating its role in stem development.⁸² Furthermore, a recent study revealed that TaWRKY13 may enhance wheat salt tolerance.⁸³ TaNAC2 levels decreased after three days of stress across all cultivars compared to controls. However, after 6 days of osmotic stress, TaNAC2 gene expression increased in all wheat cultivars, with Misr2 showing the highest fold change of approximately 5.98. Our results suggest that prolonged osmotic stress induces TaNAC2, which is used to simulate drought tolerance, suggesting its involvement in drought responses in wheat. Todaka et al.⁸⁴ observed that overexpression of TaNAC2 and TaNAC29 in Arabidopsis improved tolerance to cold, salt, and drought stress, accompanied by increased transcript levels of stress-responsive genes and enhanced physiological parameters. Mao et al.⁸⁵ also found that TaNAC2 overexpression in Arabidopsis improved tolerance to freezing, salt, and drought, as evidenced by higher physiological indices and stress-responsive gene expression. The expression levels of TaMYB73 were enormously downregulated in the wheat cultivars Sids14 and Sakha95 under initial osmotic stress, with reductions of 0.15-fold and 0.11-fold, respectively. However, upon extending the duration of osmotic stress to 6 days, TaMYB73 expression was markedly upregulated across all tested cultivars. Notably, Misr3 showed the greatest increase, with a 6.32-fold increase in TaMYB73 transcript levels, suggesting a cultivar-specific response and a potential drought tolerance mechanism. Our WDERB-2B results show an increase in fold change across all wheat cultivars after 3 and 6 days of severe osmotic stress compared to the control. Sahka95 exhibited the highest fold change (3.94-fold and 13.45-fold) after 3 and 6 days of stress, respectively. Our findings align with those of Sakuma et al.⁸⁶ who described that overexpression of the DREB2A gene enhances Arabidopsis tolerance to drought. Additionally, TaDREB1 and TaDREB3 regulate drought tolerance in wheat.²¹ Anbazhagan et al.⁸⁷ demonstrated that the transcription factor DREB1A improves root and shoot partitioning and increases transpiration efficiency in transgenic chickpeas under drought conditions. Chickpea (Cicer arietinum L.) yields decrease due to susceptibility to terminal drought stress. TaOBF-1B levels decreased in Sids14 and Sakha95 cultivars after 3 days of severe osmotic stress. However, all cultivars show a rise in TaOBF-1B after 6 days of severe osmotic stress, with Misr1 showing the highest gene fold increase of about 6.92-fold. Kobayashi et al.²² reported that TaOBF1 responds positively to osmotic stress. A former investigation reported that TaOBF1 transcript levels increased slightly at low temperature in seedling leaves.⁸⁸ This study found that prolonged osmotic stress induces TaOBF-1B, which is used to simulate drought tolerance, suggesting its involvement in drought responses. The differential expression patterns underscore the genetic variability in stress signaling pathways and suggest that TaOBF-1B could be a valuable molecular marker for screening drought-tolerant genotypes. Future studies should focus on the functional characterization of TaOBF-1B and its interaction with other transcription factors and stress-responsive genes to elucidate its regulatory network. Such insights could inform marker-assisted selection and genetic engineering strategies to improve drought resilience in wheat.

Furthermore, this study found that severe osmotic stress significantly increases TaAPX expression in all wheat cultivars. The cultivars Sids14 and Sahka95 show the strongest response, with notable fold changes after 3 and 6 days of stress. Conversely, the cultivar Misr1 demonstrates the smallest increase in TaAPX expression under the same conditions. These findings imply that wheat cultivars differ in their ability to upregulate TaAPX in response to osmotic stress, potentially influencing their overall stress tolerance. The ascorbate–glutathione cycle is a key H₂O₂ scavenging system in plant cells, where ascorbate peroxidase (APX) catalyzes the transformation of H₂O₂ into water. In this system, ascorbate is a specific electron donor.⁸⁹ Under osmotic stress conditions, RT-qPCR and transcriptomic analysis revealed different expression patterns of TaCAT genes across various wheat tissues.²³ TaCAT expression significantly increased in all wheat cultivars under severe osmotic stress. Misr2 exhibited the utmost increase in TaCAT expression, while Misr3 had the lowest, indicating that Misr2 may respond more strongly to osmotic stress. Suggesting a potential function in modulating oxidative stress during drought adaptation. The increased CAT activity likely triggered upregulation of the CAT gene in drought-tolerant cultivars during osmotic stress, consistent with our results.⁹⁰

Likewise, qRT-PCR analysis showed consistent upregulation of W106 gene expression across all tested wheat cultivars in response to severe osmotic stress at 3 and 6 days. After 3 days of stress, Misr3 showed the greatest increase in W106 expression, with an approximate 1.88-fold change. In contrast, Sids14 and Sakha95 showed the lowest induction levels, with about 1.26-fold and 1.3-fold increases, respectively. However, after 6 days of prolonged stress, Sids14 and Sakha95 showed the greatest fold changes in W106 expression, reaching approximately 7.52- and 8.88-fold, respectively. Meanwhile, Misr1 showed the smallest increase in W106 expression, with about 2.07-fold after 6 days of stress. These findings highlight the temporal and cultivar-specific regulation of W106 gene expression in wheat under severe osmotic stress. Previous studies showed that qRT-PCR analysis of W69 and W106 overexpression altered the transcription levels of key regulator genes, including those involved in ABA, H₂O₂, and salt signaling.²⁵ The mRNA levels of W106 indicate an early response in ROS decline or a sign of adaptation to ecological stress.⁹¹.

Dehydrins (DHNs), a subclass of late embryogenesis abundant (LEA) proteins, have primarily been examined for their role in plant responses to dehydration caused by abiotic stresses, including drought and salinity. These water-soluble proteins protect cells by stabilizing membranes and macromolecules under stress conditions.⁹² Wang et al.²⁷ identified at least 54 putative DHN genes in wheat, highlighting the complexity of this gene family. Previous studies have shown that DHNs are predominantly localized in young tissues and regions of active cell division and elongation, such as root tips, elongating stems, and petioles.⁹³ Moreover, DHN proteins increase in vegetative tissues when they are exposed to dehydration stimuli, including drought, osmotic stress, salinity, and extreme temperatures.²⁶ qRT-PCR analysis of this study showed differential expression of TaDHN2.1 among the wheat cultivars. After 3 days of osmotic stress, the Misr2 cultivar showed the greatest upregulation of TaDHN2.1, with a 4.92-fold increase. In contrast, Gemmiza9 showed the lowest induction, approximately 1.53-fold. Interestingly, after extending the stress duration to 6 days, Gemmiza9 showed the greatest increase in TaDHN2.1 expression, at 7.78-fold, while Sakha95 showed the lowest response, at 3.43-fold. These results highlight the cultivar-specific and time-dependent control of TaDHN2.1 in response to osmotic stress. The expression dynamics of TaDHN2.1 support the proposed protective role of dehydrin proteins (DHNs) in stress resilience. The delayed but strong induction observed in Gemmiza9 may suggest a late activation of protective pathways, whereas the early response in Misr2 could indicate a more immediate defense strategy. Overall, these findings enhance our knowledge of the molecular basis of osmotic stress tolerance in wheat and highlight TaDHN2.1 as a potential marker for breeding programs to improve stress resilience.

7. Conclusion

This study comprehensively analyzes of osmotic stress by examining growth, physiological, and biochemical characteristics, and by comparing expression of 9 drought- responsive genes using qRT-PCR across six Egyptian wheat cultivars. The findings classify Misr2 and Misr3 as drought-tolerant, Misr1, Sakha95, and Gemmiza9 as semi-tolerant, and Sids14 as sensitive.

Also, results highlight variation in the expression of the studied genes in response to osmotic stress, depending on cultivar and the timing of stress. Notably, WDERB-2B was the most highly upregulated gene in Sakha95, while TaDHN2.1 was significantly induced in Gemmiza9 after six days of osmotic stress. Additionally, W106 showed high expression levels in Sakha95.

Moreover, our results emphasize the key genes underlying osmotic stress tolerance in these cultivars, which are vital for breeding and genetic engineering efforts. The findings provide a foundation for future research aimed at developing drought-resistant wheat varieties through targeted breeding programs.

8. Statements and declarations

Ethics approval and consent to participate

Clinical trial: Not applicable.

Clinical Trial Number: Not applicable.

Consent for publication: Not applicable.

CRediT authorship contribution statement

Mohamed A. Sakr: Writing – original draft, Visualization, Software, Methodology, Investigation, Formal analysis, Data curation. Eman A. El-Khateeb: Writing – original draft, Validation, Supervision, Resources, Methodology, Investigation, Data curation. Hanan I. Sayed-Ahmed: Writing – original draft, Visualization, Validation, Supervision, Methodology, Investigation, Data curation. Reda M. Gaafar: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Methodology, Data curation, Conceptualization.

Funding

This work has received no funding.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

^{Appendix A}

Supplementary data to this article can be found online at https://doi.org/10.1016/j.jgeb.2026.100657.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Supplementary Data 1

mmc1.docx^{(10.5MB, docx)}

Data availability

Data used during the preparation of this manuscript is available within the article.

References

1.Khalid A., Hameed A., Shamim S., Ahmad J. Divergence in single kernel characteristics and grain nutritional profiles of wheat genetic resources and association among traits. Front Nutr. 2022;8 doi: 10.3389/fnut.2021.805446. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Riaz M.W., Yang L., Yousaf M.I., et al. Effects of heat stress on growth, physiology of plants, yield, and grain quality of different spring wheat (Triticum aestivum L.) genotypes. Sustainability. 2021;13(5):2972. doi: 10.3390/su13052972. [DOI] [Google Scholar]
3.High Level Panel of Experts on Food Security and Nutrition (HLPE). Sustainable agricultural development for food security and nutrition: What roles for livestock? Rome, Italy: Committee on World Food Security; 2016. Available from: http://www.fao.org/fileadmin/user_upload/hlpe/hlpe_documents/HLPE_Reports/HLPE-Report-10_EN.pdf.
4.Shewry P.R., Hey S.J. The contribution of wheat to the human diet and health. Food Energy Security. 2015;4(3):178–202. doi: 10.1002/fes3.64. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Abdalla A., Stellmacher T., Becker M. Trends and prospects of change in wheat self-sufficiency in Egypt. Agriculture. 2023;13(1):7. doi: 10.3390/agriculture13010007. [DOI] [Google Scholar]
6.Hamada A., Said M.T., Ibrahim K.M., Saber M., Sayed M.A. A predictive study of the redistribution of some bread wheat genotypes in response to climate change in Egypt. Agronomy. 2022;12(1):113. doi: 10.3390/agronomy12010113. [DOI] [Google Scholar]
7.Hamzawy A., Al-Mailam M., Arkeh J. Carnegie Endowment for International Peace; Washington, DC: 2023. Climate change in Egypt: opportunities and obstacles. Available from: https://carnegieendowment.org. [Google Scholar]
8.Zampieri M., Ceglar A., Dentener F., Toreti A. Wheat yield loss attributable to heat waves, drought, and water excess at the global, national, and subnational scales. Environ Res Lett. 2017;12(6) doi: 10.1088/1748-9326/aa723b. [DOI] [Google Scholar]
9.Duvnjak J., Lončarić A., Brkljačić L., et al. Morpho-physiological and hormonal response of winter wheat varieties to drought stress at the stem elongation and anthesis stages. Plants. 2023;12(3):418. doi: 10.3390/plants12030418. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Khan A.A., Wang Y.F., Akbar R., Alhoqail W.A. Mechanistic insights and future perspectives of drought stress management in staple crops. Front Plant Sci. 2025;16 doi: 10.3389/fpls.2025.1547452. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Song X., Li Y., Hou X. Genome-wide analysis of the AP2/ERF transcription factor superfamily in chinese cabbage (Brassica rapa ssp. pekinensis) BMC Genomics. 2013;14:1–15. doi: 10.1186/1471-2164-14-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Franco-Zorrilla J.M., López-Vidriero I., Carrasco J.L., Godoy M., Vera P., Solano R. DNA-binding specificities of plant transcription factors and their potential to define target genes. Proc Natl Acad Sci U S A. 2014;111(6):2367–2372. doi: 10.1073/pnas.1316278111. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Golldack D., Lüking I., Yang O. Plant tolerance to drought and salinity: stress regulating transcription factors and their functional significance in the cellular transcriptional network. Plant Cell Rep. 2011;30:1383–1391. doi: 10.1007/s00299-011-1068-0. [DOI] [PubMed] [Google Scholar]
14.Jin J., Zhang H., Kong L., Gao G., Luo J. PlantTFDB 3.0: a portal for the functional and evolutionary study of plant transcription factors. Nucleic Acids Res. 2014;42(D1):D1182–D1187. doi: 10.1093/nar/gkt1016. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Wang Q., Wu Y., Ozavize S.F., Qiu C.W., Holford P., Wu F. Genotypic differences in morphological, physiological, and agronomic traits in wheat (Triticum aestivum L.) in response to drought. Plants. 2024;13(2):307. doi: 10.3390/plants13020307. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Baloglu M.C., Inal B., Kavas M., Unver T. Diverse expression pattern of wheat transcription factors against abiotic stresses in wheat species. Gene. 2014;550(1):117–122. doi: 10.1016/j.gene.2014.08.037. [DOI] [PubMed] [Google Scholar]
17.Liu C., Mao B., Ou S., et al. OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol Biol. 2014;84:19–36. doi: 10.1007/s11103-013-0120-8. [DOI] [PubMed] [Google Scholar]
18.Niu C.F., Wei W., Zhou Q.Y., et al. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012;35(6):1156–1170. doi: 10.1111/j.1365-3040.2012.02480.x. [DOI] [PubMed] [Google Scholar]
19.Wang C., Deng P., Chen L., et al. A wheat WRKY transcription factor TaWRKY10 confers tolerance to multiple abiotic stresses in transgenic tobacco. PLoS One. 2013;8(6) doi: 10.1371/journal.pone.0065120. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.He Y., Li W., Lv J., Jia Y., Wang M., Xia G. Ectopic expression of a wheat MYB transcription factor gene, TaMYB73, improves salinity stress tolerance in Arabidopsis thaliana. J Exp Bot. 2012;63(4):1511–1522. doi: 10.1093/jxb/err388. [DOI] [PubMed] [Google Scholar]
21.Liu M., Wang Z., Xiao H.M., Yang Y. Characterization of TaDREB1 in wheat genotypes with different seed germination under osmotic stress. Hereditas. 2018;155:1–9. doi: 10.1186/s41065-018-0053-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Kobayashi F., Maeta E., Terashima A., Kawaura K., Ogihara Y., Takumi S. Development of abiotic stress tolerance via bZIP-type transcription factor LIP19 in common wheat. J Exp Bot. 2008;59(4):891–905. doi: 10.1093/jxb/ern011. [DOI] [PubMed] [Google Scholar]
23.Zhang Y., Zheng L., Yun L., et al. Catalase (CAT) gene family in wheat (Triticum aestivum L.): Evolution, expression pattern, and function analysis. Int J Mol Sci. 2022;23(1):542. doi: 10.3390/ijms23010542. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Raza A., Su W., Gao A., et al. Catalase (CAT) gene family in rapeseed (Brassica napus L.): Genome-wide analysis, identification, and expression pattern in response to multiple hormones and abiotic stress conditions. Int J Mol Sci. 2021;22(8):4281. doi: 10.3390/ijms22084281. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Zhai C.Z., Zhao L., Yin L.J., et al. Two wheat glutathione peroxidase genes whose products are located in chloroplasts improve salt and H2O2 tolerances in Arabidopsis. PLoS One. 2013;8(9) doi: 10.1371/journal.pone.0073989. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Bray E.A. Plant responses to water deficit. Trends Plant Sci. 1997;2(2):48–54. doi: 10.1016/S1360-1385(97)82562-9. [DOI] [Google Scholar]
27.Wang Y., Xu H., Zhu H., et al. Classification and expression diversification of wheat dehydrin genes. Plant Sci. 2014;214:113–120. doi: 10.1016/j.plantsci.2013.10.010. [DOI] [PubMed] [Google Scholar]
28.Cooper A.J. Grower Books; London: 1979. The ABC of NFT. [Google Scholar]
29.Michel B.E., Kaufmann M.R. The osmotic potential of polyethylene glycol 6000. Plant Physiol. 1973;51(5):914–916. doi: 10.1104/pp.51.5.914. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Pieczynski M., Marczewski W., Hennig J., et al. Down-regulation of CBP80 gene expression as a strategy to engineer a drought-tolerant potato. Plant Biotechnol J. 2013;11(4):459–469. doi: 10.1111/pbi.12033. [DOI] [PubMed] [Google Scholar]
31.Xu W., Cui K., Xu A., Nie L., Huang J., Peng S. Drought stress condition increases root to shoot ratio via alteration of carbohydrate partitioning and enzymatic activity in rice seedlings. Acta Physiol Plant. 2015;37:1–11. doi: 10.1007/s11738-015-1873-9. [DOI] [Google Scholar]
32.Metzner H., Rau H., Senger H. Untersuchungen zur synchronisierbarkeit einzelner pigmentmangelmutanten von Chlorella. Planta. 1965;65(2):186–194. doi: 10.1007/BF00384998. [DOI] [Google Scholar]
33.Horvath G., Kissimon J., Faludi-Dániel Á. Effect of light intensity on the formation of carotenoids in normal and mutant maize leaves. Phytochemistry. 1972;11:183–187. doi: 10.1016/S0031-9422(00)86816-8. [DOI] [Google Scholar]
34.Kissimon J. International Workshop and Training Course on Microalgal Biology and Biotechnology. 1999. Analysis of the photosynthetic pigment composition; pp. 13–26. [Google Scholar]
35.Kato M., Shimizu S. Chlorophyll metabolism in higher plants. Chlorophyll degradation in senescing tobacco leaves: phenolic-dependent peroxidative degradation. Can J Bot. 1987;65:729–735. doi: 10.1139/b87-101. [DOI] [Google Scholar]
36.Giannopolitis C.N., Ries S.K. Superoxide dismutases: I. Occurrence in higher plants. Plant Physiol. 1977;59(2):309–314. doi: 10.1104/pp.59.2.309. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Sun Q., Hu J.J. 1st ed. Northwest A&F University Press; Shaanxi, China: 2005. Method of and phytophysiology research. [Google Scholar]
38.Velikova V., Yordanov I., Edreva A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Sci. 2000;151(1):59–66. doi: 10.1016/S0168-9452(99)00197-1. [DOI] [Google Scholar]
39.Bates L.S., Waldren R.P., Teare I.D. Rapid determination of free proline for water-stress studies. Plant Soil. 1973;39(1):205–207. doi: 10.1007/BF00018060. [DOI] [Google Scholar]
40.Shi Q., Guo L., Ma M., et al. Global transcriptome analysis uncovers the gene co-expression regulation network and key genes involved in grain development of wheat (Triticum aestivum L.) Funct Integr Genomics. 2019;19(6):853–866. doi: 10.1007/s10142-019-00678-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
42.Bishop O.N. Longman Penguin; London: 1983. Statistics in biology; pp. 56–63. [Google Scholar]
43.Bellucci M., Mostofa M.G., Weraduwage S.M., et al. The effect of constitutive root isoprene emission on root phenotype and physiology under control and salt stress conditions. Plant Direct. 2024;8(7) doi: 10.1002/pld3.617. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Kim K.H., Lee B.M. Effects of climate change and drought tolerance on maize growth. Plants. 2023;12(20):3548. doi: 10.3390/plants12203548. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Yılmaz P., Babat C.F., Yılmaz C. Comparison of short-term physiological and biochemical effects of drought stress on two wheat cultivars. Braz Arch Biol Technol. 2023;66 doi: 10.1590/1678-4324-20232220705. [DOI] [Google Scholar]
46.Zahedi S.M., Karimi M., Venditti A., Zahra N., Siddique K.H., Farooq M. Plant adaptation to drought stress: the role of anatomical and morphological characteristics in maintaining the water status. J Soil Sci Plant Nutr. 2025;25(1):409–427. doi: 10.1007/s42729-024-01591-9. [DOI] [Google Scholar]
47.Litvin A.G., van Iersel M.W., Malladi A. Drought stress reduces stem elongation and alters gibberellin-related gene expression during vegetative growth of tomato. J Am Soc Hortic Sci. 2016;141(6):591–597. doi: 10.21273/JASHS03885-16. [DOI] [Google Scholar]
48.Ahmad A., Aslam Z., Javed T., et al. Screening of wheat (Triticum aestivum L.) genotypes for drought tolerance through agronomic and physiological response. Agronomy. 2022;12:287. doi: 10.3390/agronomy12020287. [DOI] [Google Scholar]
49.Tawfik M.M., Bahr A.A., Salem A.K.M. Response of kaller grass (Leptochloa fusca L.) to biofertilizer inoculation under different levels of seawater irrigation. J Appl Sci Res. 2006;2(12):1203–1211. [Google Scholar]
50.Loftus S., Sauer A.M., Schneider E.M., et al. Distinct water and phosphorus extraction patterns are key to maintaining the productivity of sorghum under drought and limited soil resources. Sci Rep. 2025;15(1):4949. doi: 10.1038/s41598-025-12345-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Nyaupane S., Poudel M.R., Panthi B., et al. Drought stress effect, tolerance, and management in wheat–a review. Cogent Food Agric. 2024;10(1) doi: 10.1080/23311932.2023.2296094. [DOI] [Google Scholar]
52.Orabi S.A., Hussein M.M., Zaki S.S., Sharara F.A. Influence of hydrogen peroxide on growth, yield, and biochemical constituents of canola plants grown under different irrigation intervals. Curr Sci Int. 2018;7:407–418. [Google Scholar]
53.Bardhan K., York L.M., Hasanuzzaman M., Parekh V., Jena S., Pandya M.N. Can smart nutrient applications optimize the plant's hidden half to improve drought resistance? Physiol Plant. 2021;172(2):1007–1015. doi: 10.1111/ppl.13338. [DOI] [PubMed] [Google Scholar]
54.Li L., Li H., Liu N., et al. Water use characteristics and drought tolerant ability of different winter wheat cultivars assessed under whole growth circle and at seedling stage. Agric Water Manag. 2024;300 doi: 10.1016/j.agwat.2024.108921. [DOI] [Google Scholar]
55.Mickky B.M., Aldesuquy H.S. Impact of osmotic stress on seedling growth observations, membrane characteristics, and antioxidant defense system of different wheat genotypes. Egypt J Basic Appl Sci. 2017;4(1):47–54. doi: 10.1016/j.ejbas.2016.11.002. [DOI] [Google Scholar]
56.Keyvan S. The effects of drought stress on yield, relative water content, proline, soluble carbohydrates, and chlorophyll of bread wheat cultivars. J Anim Plant Sci. 2010;8:1051–1060. [Google Scholar]
57.Takács G., Gergely I., Ördög V., Vörös L., Iváncsics J. Approaches to studying wheat and maize drought stress responses. Plant Soil. 2025:1–18. doi: 10.1007/s11104-025-06987-3. [DOI] [Google Scholar]
58.Joshi R., Karan R. In: Molecular Approaches in Plant Abiotic Stress. Gaur R.K., Sharma P., editors. CRC Press; Boca Raton, FL: 2013. Physiological, biochemical, and molecular mechanisms of drought tolerance in plants; pp. 209–231. [Google Scholar]
59.Eftekhari A., Baghizadeh A., Yaghoobi M.M., Abdolshahi R. Differences in the drought stress response of DREB2 and CAT1 genes and evaluation of related physiological parameters in some bread wheat cultivars. Biotechnol Biotechnol Equip. 2017;31(4):709–716. doi: 10.1080/13102818.2017.1320956. [DOI] [Google Scholar]
60.Licaj I., Di Meo M.C., Fiorillo A., Samperna S., Marra M., Rocco M. Comparative analysis of the response to polyethylene glycol-simulated drought stress in roots from seedlings of “modern” and “ancient” wheat varieties. Plants. 2023;12(3):428. doi: 10.3390/plants12030428. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Stiven G., Sanaratna T. Salicylic acid induced physiological and biochemical changes in wheat seedlings under water stress. Plant Growth Regul. 2006;39:137–141. doi: 10.1007/s10725-006-9114-3. [DOI] [Google Scholar]
62.Huang B., Huang D., Zhang J., et al. Barley young leaf chlorina, a putative pentatricopeptide repeat gene, is essential for chloroplast development in young leaves. Plant Mol Biol. 2025;115(2):36. doi: 10.1007/s11103-025-01336-7. [DOI] [PubMed] [Google Scholar]
63.Hosseinzadeh S.R., Amiri H., Ismaili A. Evaluation of photosynthesis, physiological, and biochemical responses of chickpea (Cicer arietinum L. cv. Pirouz) under water deficit stress and use of vermicompost fertilizer. J Integr Agric. 2018;17:2426–2437. doi: 10.1016/S2095-3119(18)62071-6. [DOI] [Google Scholar]
64.Sikuku P.A., Netondo G.W., Onyango J.C., Musyimi D.M. Chlorophyll fluorescence, protein, and chlorophyll content of three NERICA rainfed rice varieties under varying irrigation regimes. J Agric Biol Sci. 2010;5(1):19–25. [Google Scholar]
65.Ghanem H.E., Al-Farouk M.O. Wheat drought tolerance: Morpho-physiological criteria, stress indexes, and yield responses in newly sand soils. J Plant Growth Regul. 2024;43(7):2234–2250. doi: 10.1007/s00344-024-11111-1. [DOI] [Google Scholar]
66.Batool M., El-Badri A.M., Wang Z., et al. Rapeseed morpho-physio-biochemical responses to drought stress induced by PEG-6000. Agronomy. 2022;12(3):579. doi: 10.3390/agronomy12030579. [DOI] [Google Scholar]
67.Kiani R., Arzani A., Mirmohammady Maibody S.A.M. Polyphenols, flavonoids, and antioxidant activity involved in salt tolerance in wheat, Aegilops cylindrica and their amphidiploids. Front Plant Sci. 2021;12 doi: 10.3389/fpls.2021.646221. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.ul Islam SN, Asgher M, Khan NA. Hydrogen peroxide and its role in abiotic stress tolerance in plants. In: Gasotransmitters Signaling in Plant Abiotic Stress: Gasotransmitters in Adaptation of Plants to Abiotic Stress. Cham: Springer International Publishing; 2023:167-195. doi:10.1007/978-3-031-09348-8_8.
69.Sharma B., Yadav L., Shrestha A., et al. Drought stress and its management in wheat (Triticum aestivum L.): a review. Agric Sci Technol. 2022;14(1):3–14. [Google Scholar]
70.Lum M.S., Hanafi M.M., Rafii Y.M., Akmar A.S.N. Effect of drought stress on growth, proline, and antioxidant enzyme activities of upland rice. J Anim Plant Sci. 2014;24(5):1487–1493. [Google Scholar]
71.Seleiman M.F., Al-Suhaibani N., Ali N., et al. Drought stress impacts on plants and different approaches to alleviate its adverse effects. Plants. 2021;10(2):259. doi: 10.3390/plants10020259. [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Qayyum A., Al Ayoubi S., Sher A., et al. Improvement in drought tolerance in bread wheat is related to an improvement in osmolyte production, antioxidant enzyme activities, and gaseous exchange. Saudi J Biol Sci. 2021;28(9):5238–5249. doi: 10.1016/j.sjbs.2021.05.064. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Dvojković K., Plavšin I., Novoselović D., et al. Early antioxidative response to desiccant-stimulated drought stress in field-grown traditional wheat varieties. Plants. 2023;12(2):249. doi: 10.3390/plants12020249. [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Petrov V.D., Van Breusegem F. Hydrogen peroxide—a central hub for information flow in plant cells. AoB Plants. 2012;2012 doi: 10.1093/aobpla/pls014. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Balashov N.V., Borisova-Mubarakshina M.M., Vetoshkina D.V. The effect of hydrogen peroxide on the redistribution of antenna complexes between photosystems in higher plants. Biochemistry (Mosc) 2025;90(7):943–955. doi: 10.1134/S000629792507002X. [DOI] [PubMed] [Google Scholar]
76.Caverzan A., Casassola A., Brammer S.P. Antioxidant responses of wheat plants under stress. Genet Mol Biol. 2016;39(1):1–6. doi: 10.1590/1678-4685-GMB-2015-0109. [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Khan P., Abdelbacki A.M., Albaqami M., Jan R., Kim K.M. Proline promotes drought tolerance in maize. Biology. 2025;14(1):41. doi: 10.3390/biology14010041. [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Mwadzingeni L., Shimelis H., Tesfay S., Tsilo T.J. Screening of bread wheat genotypes for drought tolerance using phenotypic and proline analyses. Front Plant Sci. 2016;7:1276. doi: 10.3389/fpls.2016.01276. [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Chowdhury M.K., Hasan M.A., Bahadur M.M., et al. Evaluation of drought tolerance of some wheat (Triticum aestivum L.) genotypes through phenology, growth, and physiological indices. Agronomy. 2021;11(9):1792. doi: 10.3390/agronomy11091792. [DOI] [Google Scholar]
80.Hasanuzzaman M., Hossain M.A., Da Silva J.T., Fujita M. Plant Response and Tolerance to Abiotic Oxidative Stress: Antioxidant Defense Is a Key Factor. Springer; 2012. Crop stress and its management: perspectives and strategies; pp. 261–315. [DOI] [Google Scholar]
81.Ishfaq N., Waraich E.A., Ahmad M., et al. Mitigating drought-induced oxidative stress in wheat (Triticum aestivum L.) through foliar application of sulfhydryl thiourea. Sci Rep. 2024;14(1) doi: 10.1038/s41598-024-52982-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Li W., Tian Z., Yu D. WRKY13 acts in stem development in Arabidopsis thaliana. Plant Sci. 2015;236:205–213. doi: 10.1016/j.plantsci.2015.04.010. [DOI] [PubMed] [Google Scholar]
83.Zhou S., Zheng W.J., Liu B.H., et al. Characterizing the role of TaWRKY13 in salt tolerance. Int J Mol Sci. 2019;20(22):5712. doi: 10.3390/ijms20225712. [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Todaka D., Nakashima K., Shinozaki K., Yamaguchi-Shinozaki K. Toward understanding transcriptional regulatory networks in abiotic stress responses and tolerance in rice. Rice. 2012;5:1–9. doi: 10.1186/1939-8433-5-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Mao X., Zhang H., Qian X., Li A., Zhao G., Jing R. TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J Exp Bot. 2012;63(8):2933–2946. doi: 10.1093/jxb/ers007. [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Sakuma Y., Maruyama K., Osakabe Y., et al. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell. 2006;18(5):1292–1309. doi: 10.1105/tpc.105.035881. [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Anbazhagan K., Bhatnagar-Mathur P., Vadez V., Dumbala S.R., Kishor P.K., Sharma K.K. DREB1A overexpression in transgenic chickpea alters key traits influencing plant water budget across water regimes. Plant Cell Rep. 2015;34(2):199–210. doi: 10.1007/s00299-014-1706-3. [DOI] [PubMed] [Google Scholar]
88.Kusano T., Berberich T., Harada M., Suzuki N., Sugawara K. A maize DNA-binding factor with a bZIP motif is induced by low temperature. Mol Gen Genet. 1995;248:507–517. doi: 10.1007/BF02191598. [DOI] [PubMed] [Google Scholar]
89.Li S. Novel insight into functions of ascorbate peroxidase in higher plants: more than a simple antioxidant enzyme. Redox Biol. 2023;64 doi: 10.1016/j.redox.2023.102789. [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Fleta-Soriano E., Díaz L., Bonet E., Munné-Bosch S. Melatonin may exert a protective role against drought stress in maize. J Agron Crop Sci. 2017;203(4):286–294. doi: 10.1111/jac.12202. [DOI] [Google Scholar]
91.Bhattacharjee S. Reactive oxygen species and oxidative burst: Roles in stress, senescence, and signal transduction in plants. Curr Sci. 2005;89(7):1113–1121. [Google Scholar]
92.Shakirova F.M., Allagulova C.R., Bezrukova M.V., Gimalov F.R. Induction of expression of the dehydrin gene TADHN and accumulation of abscisic acid in wheat plants in hypothermia. Dokl Biochem Biophys. 2005;400 doi: 10.1134/S1607672905060046. [page range unavailable] [DOI] [PubMed] [Google Scholar]
93.Rorat T., Grygorowicz W.J., Irzykowski W., Rey P. Expression of KS-type dehydrins is primarily regulated by factors related to organ type and leaf developmental stage during vegetative growth. Planta. 2004;218(5):878–885. doi: 10.1007/s00425-003-1166-8. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data 1

mmc1.docx^{(10.5MB, docx)}

Data Availability Statement

Data used during the preparation of this manuscript is available within the article.

[b0005] 1.Khalid A., Hameed A., Shamim S., Ahmad J. Divergence in single kernel characteristics and grain nutritional profiles of wheat genetic resources and association among traits. Front Nutr. 2022;8 doi: 10.3389/fnut.2021.805446. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0010] 2.Riaz M.W., Yang L., Yousaf M.I., et al. Effects of heat stress on growth, physiology of plants, yield, and grain quality of different spring wheat (Triticum aestivum L.) genotypes. Sustainability. 2021;13(5):2972. doi: 10.3390/su13052972. [DOI] [Google Scholar]

[b0015] 3.High Level Panel of Experts on Food Security and Nutrition (HLPE). Sustainable agricultural development for food security and nutrition: What roles for livestock? Rome, Italy: Committee on World Food Security; 2016. Available from: http://www.fao.org/fileadmin/user_upload/hlpe/hlpe_documents/HLPE_Reports/HLPE-Report-10_EN.pdf.

[b0020] 4.Shewry P.R., Hey S.J. The contribution of wheat to the human diet and health. Food Energy Security. 2015;4(3):178–202. doi: 10.1002/fes3.64. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0025] 5.Abdalla A., Stellmacher T., Becker M. Trends and prospects of change in wheat self-sufficiency in Egypt. Agriculture. 2023;13(1):7. doi: 10.3390/agriculture13010007. [DOI] [Google Scholar]

[b0030] 6.Hamada A., Said M.T., Ibrahim K.M., Saber M., Sayed M.A. A predictive study of the redistribution of some bread wheat genotypes in response to climate change in Egypt. Agronomy. 2022;12(1):113. doi: 10.3390/agronomy12010113. [DOI] [Google Scholar]

[b0035] 7.Hamzawy A., Al-Mailam M., Arkeh J. Carnegie Endowment for International Peace; Washington, DC: 2023. Climate change in Egypt: opportunities and obstacles. Available from: https://carnegieendowment.org. [Google Scholar]

[b0040] 8.Zampieri M., Ceglar A., Dentener F., Toreti A. Wheat yield loss attributable to heat waves, drought, and water excess at the global, national, and subnational scales. Environ Res Lett. 2017;12(6) doi: 10.1088/1748-9326/aa723b. [DOI] [Google Scholar]

[b0045] 9.Duvnjak J., Lončarić A., Brkljačić L., et al. Morpho-physiological and hormonal response of winter wheat varieties to drought stress at the stem elongation and anthesis stages. Plants. 2023;12(3):418. doi: 10.3390/plants12030418. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0050] 10.Khan A.A., Wang Y.F., Akbar R., Alhoqail W.A. Mechanistic insights and future perspectives of drought stress management in staple crops. Front Plant Sci. 2025;16 doi: 10.3389/fpls.2025.1547452. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0055] 11.Song X., Li Y., Hou X. Genome-wide analysis of the AP2/ERF transcription factor superfamily in chinese cabbage (Brassica rapa ssp. pekinensis) BMC Genomics. 2013;14:1–15. doi: 10.1186/1471-2164-14-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0060] 12.Franco-Zorrilla J.M., López-Vidriero I., Carrasco J.L., Godoy M., Vera P., Solano R. DNA-binding specificities of plant transcription factors and their potential to define target genes. Proc Natl Acad Sci U S A. 2014;111(6):2367–2372. doi: 10.1073/pnas.1316278111. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0065] 13.Golldack D., Lüking I., Yang O. Plant tolerance to drought and salinity: stress regulating transcription factors and their functional significance in the cellular transcriptional network. Plant Cell Rep. 2011;30:1383–1391. doi: 10.1007/s00299-011-1068-0. [DOI] [PubMed] [Google Scholar]

[b0070] 14.Jin J., Zhang H., Kong L., Gao G., Luo J. PlantTFDB 3.0: a portal for the functional and evolutionary study of plant transcription factors. Nucleic Acids Res. 2014;42(D1):D1182–D1187. doi: 10.1093/nar/gkt1016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0075] 15.Wang Q., Wu Y., Ozavize S.F., Qiu C.W., Holford P., Wu F. Genotypic differences in morphological, physiological, and agronomic traits in wheat (Triticum aestivum L.) in response to drought. Plants. 2024;13(2):307. doi: 10.3390/plants13020307. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0080] 16.Baloglu M.C., Inal B., Kavas M., Unver T. Diverse expression pattern of wheat transcription factors against abiotic stresses in wheat species. Gene. 2014;550(1):117–122. doi: 10.1016/j.gene.2014.08.037. [DOI] [PubMed] [Google Scholar]

[b0085] 17.Liu C., Mao B., Ou S., et al. OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol Biol. 2014;84:19–36. doi: 10.1007/s11103-013-0120-8. [DOI] [PubMed] [Google Scholar]

[b0090] 18.Niu C.F., Wei W., Zhou Q.Y., et al. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012;35(6):1156–1170. doi: 10.1111/j.1365-3040.2012.02480.x. [DOI] [PubMed] [Google Scholar]

[b0095] 19.Wang C., Deng P., Chen L., et al. A wheat WRKY transcription factor TaWRKY10 confers tolerance to multiple abiotic stresses in transgenic tobacco. PLoS One. 2013;8(6) doi: 10.1371/journal.pone.0065120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0100] 20.He Y., Li W., Lv J., Jia Y., Wang M., Xia G. Ectopic expression of a wheat MYB transcription factor gene, TaMYB73, improves salinity stress tolerance in Arabidopsis thaliana. J Exp Bot. 2012;63(4):1511–1522. doi: 10.1093/jxb/err388. [DOI] [PubMed] [Google Scholar]

[b0105] 21.Liu M., Wang Z., Xiao H.M., Yang Y. Characterization of TaDREB1 in wheat genotypes with different seed germination under osmotic stress. Hereditas. 2018;155:1–9. doi: 10.1186/s41065-018-0053-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0110] 22.Kobayashi F., Maeta E., Terashima A., Kawaura K., Ogihara Y., Takumi S. Development of abiotic stress tolerance via bZIP-type transcription factor LIP19 in common wheat. J Exp Bot. 2008;59(4):891–905. doi: 10.1093/jxb/ern011. [DOI] [PubMed] [Google Scholar]

[b0115] 23.Zhang Y., Zheng L., Yun L., et al. Catalase (CAT) gene family in wheat (Triticum aestivum L.): Evolution, expression pattern, and function analysis. Int J Mol Sci. 2022;23(1):542. doi: 10.3390/ijms23010542. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0120] 24.Raza A., Su W., Gao A., et al. Catalase (CAT) gene family in rapeseed (Brassica napus L.): Genome-wide analysis, identification, and expression pattern in response to multiple hormones and abiotic stress conditions. Int J Mol Sci. 2021;22(8):4281. doi: 10.3390/ijms22084281. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0125] 25.Zhai C.Z., Zhao L., Yin L.J., et al. Two wheat glutathione peroxidase genes whose products are located in chloroplasts improve salt and H2O2 tolerances in Arabidopsis. PLoS One. 2013;8(9) doi: 10.1371/journal.pone.0073989. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0130] 26.Bray E.A. Plant responses to water deficit. Trends Plant Sci. 1997;2(2):48–54. doi: 10.1016/S1360-1385(97)82562-9. [DOI] [Google Scholar]

[b0135] 27.Wang Y., Xu H., Zhu H., et al. Classification and expression diversification of wheat dehydrin genes. Plant Sci. 2014;214:113–120. doi: 10.1016/j.plantsci.2013.10.010. [DOI] [PubMed] [Google Scholar]

[b0140] 28.Cooper A.J. Grower Books; London: 1979. The ABC of NFT. [Google Scholar]

[b0145] 29.Michel B.E., Kaufmann M.R. The osmotic potential of polyethylene glycol 6000. Plant Physiol. 1973;51(5):914–916. doi: 10.1104/pp.51.5.914. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0150] 30.Pieczynski M., Marczewski W., Hennig J., et al. Down-regulation of CBP80 gene expression as a strategy to engineer a drought-tolerant potato. Plant Biotechnol J. 2013;11(4):459–469. doi: 10.1111/pbi.12033. [DOI] [PubMed] [Google Scholar]

[b0155] 31.Xu W., Cui K., Xu A., Nie L., Huang J., Peng S. Drought stress condition increases root to shoot ratio via alteration of carbohydrate partitioning and enzymatic activity in rice seedlings. Acta Physiol Plant. 2015;37:1–11. doi: 10.1007/s11738-015-1873-9. [DOI] [Google Scholar]

[b0160] 32.Metzner H., Rau H., Senger H. Untersuchungen zur synchronisierbarkeit einzelner pigmentmangelmutanten von Chlorella. Planta. 1965;65(2):186–194. doi: 10.1007/BF00384998. [DOI] [Google Scholar]

[b0165] 33.Horvath G., Kissimon J., Faludi-Dániel Á. Effect of light intensity on the formation of carotenoids in normal and mutant maize leaves. Phytochemistry. 1972;11:183–187. doi: 10.1016/S0031-9422(00)86816-8. [DOI] [Google Scholar]

[b0170] 34.Kissimon J. International Workshop and Training Course on Microalgal Biology and Biotechnology. 1999. Analysis of the photosynthetic pigment composition; pp. 13–26. [Google Scholar]

[b0175] 35.Kato M., Shimizu S. Chlorophyll metabolism in higher plants. Chlorophyll degradation in senescing tobacco leaves: phenolic-dependent peroxidative degradation. Can J Bot. 1987;65:729–735. doi: 10.1139/b87-101. [DOI] [Google Scholar]

[b0180] 36.Giannopolitis C.N., Ries S.K. Superoxide dismutases: I. Occurrence in higher plants. Plant Physiol. 1977;59(2):309–314. doi: 10.1104/pp.59.2.309. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0185] 37.Sun Q., Hu J.J. 1st ed. Northwest A&F University Press; Shaanxi, China: 2005. Method of and phytophysiology research. [Google Scholar]

[b0190] 38.Velikova V., Yordanov I., Edreva A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Sci. 2000;151(1):59–66. doi: 10.1016/S0168-9452(99)00197-1. [DOI] [Google Scholar]

[b0195] 39.Bates L.S., Waldren R.P., Teare I.D. Rapid determination of free proline for water-stress studies. Plant Soil. 1973;39(1):205–207. doi: 10.1007/BF00018060. [DOI] [Google Scholar]

[b0200] 40.Shi Q., Guo L., Ma M., et al. Global transcriptome analysis uncovers the gene co-expression regulation network and key genes involved in grain development of wheat (Triticum aestivum L.) Funct Integr Genomics. 2019;19(6):853–866. doi: 10.1007/s10142-019-00678-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0205] 41.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

[b0210] 42.Bishop O.N. Longman Penguin; London: 1983. Statistics in biology; pp. 56–63. [Google Scholar]

[b0215] 43.Bellucci M., Mostofa M.G., Weraduwage S.M., et al. The effect of constitutive root isoprene emission on root phenotype and physiology under control and salt stress conditions. Plant Direct. 2024;8(7) doi: 10.1002/pld3.617. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0220] 44.Kim K.H., Lee B.M. Effects of climate change and drought tolerance on maize growth. Plants. 2023;12(20):3548. doi: 10.3390/plants12203548. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0225] 45.Yılmaz P., Babat C.F., Yılmaz C. Comparison of short-term physiological and biochemical effects of drought stress on two wheat cultivars. Braz Arch Biol Technol. 2023;66 doi: 10.1590/1678-4324-20232220705. [DOI] [Google Scholar]

[b0230] 46.Zahedi S.M., Karimi M., Venditti A., Zahra N., Siddique K.H., Farooq M. Plant adaptation to drought stress: the role of anatomical and morphological characteristics in maintaining the water status. J Soil Sci Plant Nutr. 2025;25(1):409–427. doi: 10.1007/s42729-024-01591-9. [DOI] [Google Scholar]

[b0235] 47.Litvin A.G., van Iersel M.W., Malladi A. Drought stress reduces stem elongation and alters gibberellin-related gene expression during vegetative growth of tomato. J Am Soc Hortic Sci. 2016;141(6):591–597. doi: 10.21273/JASHS03885-16. [DOI] [Google Scholar]

[b0240] 48.Ahmad A., Aslam Z., Javed T., et al. Screening of wheat (Triticum aestivum L.) genotypes for drought tolerance through agronomic and physiological response. Agronomy. 2022;12:287. doi: 10.3390/agronomy12020287. [DOI] [Google Scholar]

[b0245] 49.Tawfik M.M., Bahr A.A., Salem A.K.M. Response of kaller grass (Leptochloa fusca L.) to biofertilizer inoculation under different levels of seawater irrigation. J Appl Sci Res. 2006;2(12):1203–1211. [Google Scholar]

[b0250] 50.Loftus S., Sauer A.M., Schneider E.M., et al. Distinct water and phosphorus extraction patterns are key to maintaining the productivity of sorghum under drought and limited soil resources. Sci Rep. 2025;15(1):4949. doi: 10.1038/s41598-025-12345-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0255] 51.Nyaupane S., Poudel M.R., Panthi B., et al. Drought stress effect, tolerance, and management in wheat–a review. Cogent Food Agric. 2024;10(1) doi: 10.1080/23311932.2023.2296094. [DOI] [Google Scholar]

[b0260] 52.Orabi S.A., Hussein M.M., Zaki S.S., Sharara F.A. Influence of hydrogen peroxide on growth, yield, and biochemical constituents of canola plants grown under different irrigation intervals. Curr Sci Int. 2018;7:407–418. [Google Scholar]

[b0265] 53.Bardhan K., York L.M., Hasanuzzaman M., Parekh V., Jena S., Pandya M.N. Can smart nutrient applications optimize the plant's hidden half to improve drought resistance? Physiol Plant. 2021;172(2):1007–1015. doi: 10.1111/ppl.13338. [DOI] [PubMed] [Google Scholar]

[b0270] 54.Li L., Li H., Liu N., et al. Water use characteristics and drought tolerant ability of different winter wheat cultivars assessed under whole growth circle and at seedling stage. Agric Water Manag. 2024;300 doi: 10.1016/j.agwat.2024.108921. [DOI] [Google Scholar]

[b0275] 55.Mickky B.M., Aldesuquy H.S. Impact of osmotic stress on seedling growth observations, membrane characteristics, and antioxidant defense system of different wheat genotypes. Egypt J Basic Appl Sci. 2017;4(1):47–54. doi: 10.1016/j.ejbas.2016.11.002. [DOI] [Google Scholar]

[b0280] 56.Keyvan S. The effects of drought stress on yield, relative water content, proline, soluble carbohydrates, and chlorophyll of bread wheat cultivars. J Anim Plant Sci. 2010;8:1051–1060. [Google Scholar]

[b0285] 57.Takács G., Gergely I., Ördög V., Vörös L., Iváncsics J. Approaches to studying wheat and maize drought stress responses. Plant Soil. 2025:1–18. doi: 10.1007/s11104-025-06987-3. [DOI] [Google Scholar]

[b0290] 58.Joshi R., Karan R. In: Molecular Approaches in Plant Abiotic Stress. Gaur R.K., Sharma P., editors. CRC Press; Boca Raton, FL: 2013. Physiological, biochemical, and molecular mechanisms of drought tolerance in plants; pp. 209–231. [Google Scholar]

[b0295] 59.Eftekhari A., Baghizadeh A., Yaghoobi M.M., Abdolshahi R. Differences in the drought stress response of DREB2 and CAT1 genes and evaluation of related physiological parameters in some bread wheat cultivars. Biotechnol Biotechnol Equip. 2017;31(4):709–716. doi: 10.1080/13102818.2017.1320956. [DOI] [Google Scholar]

[b0300] 60.Licaj I., Di Meo M.C., Fiorillo A., Samperna S., Marra M., Rocco M. Comparative analysis of the response to polyethylene glycol-simulated drought stress in roots from seedlings of “modern” and “ancient” wheat varieties. Plants. 2023;12(3):428. doi: 10.3390/plants12030428. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0305] 61.Stiven G., Sanaratna T. Salicylic acid induced physiological and biochemical changes in wheat seedlings under water stress. Plant Growth Regul. 2006;39:137–141. doi: 10.1007/s10725-006-9114-3. [DOI] [Google Scholar]

[b0310] 62.Huang B., Huang D., Zhang J., et al. Barley young leaf chlorina, a putative pentatricopeptide repeat gene, is essential for chloroplast development in young leaves. Plant Mol Biol. 2025;115(2):36. doi: 10.1007/s11103-025-01336-7. [DOI] [PubMed] [Google Scholar]

[b0315] 63.Hosseinzadeh S.R., Amiri H., Ismaili A. Evaluation of photosynthesis, physiological, and biochemical responses of chickpea (Cicer arietinum L. cv. Pirouz) under water deficit stress and use of vermicompost fertilizer. J Integr Agric. 2018;17:2426–2437. doi: 10.1016/S2095-3119(18)62071-6. [DOI] [Google Scholar]

[b0320] 64.Sikuku P.A., Netondo G.W., Onyango J.C., Musyimi D.M. Chlorophyll fluorescence, protein, and chlorophyll content of three NERICA rainfed rice varieties under varying irrigation regimes. J Agric Biol Sci. 2010;5(1):19–25. [Google Scholar]

[b0325] 65.Ghanem H.E., Al-Farouk M.O. Wheat drought tolerance: Morpho-physiological criteria, stress indexes, and yield responses in newly sand soils. J Plant Growth Regul. 2024;43(7):2234–2250. doi: 10.1007/s00344-024-11111-1. [DOI] [Google Scholar]

[b0330] 66.Batool M., El-Badri A.M., Wang Z., et al. Rapeseed morpho-physio-biochemical responses to drought stress induced by PEG-6000. Agronomy. 2022;12(3):579. doi: 10.3390/agronomy12030579. [DOI] [Google Scholar]

[b0335] 67.Kiani R., Arzani A., Mirmohammady Maibody S.A.M. Polyphenols, flavonoids, and antioxidant activity involved in salt tolerance in wheat, Aegilops cylindrica and their amphidiploids. Front Plant Sci. 2021;12 doi: 10.3389/fpls.2021.646221. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0340] 68.ul Islam SN, Asgher M, Khan NA. Hydrogen peroxide and its role in abiotic stress tolerance in plants. In: Gasotransmitters Signaling in Plant Abiotic Stress: Gasotransmitters in Adaptation of Plants to Abiotic Stress. Cham: Springer International Publishing; 2023:167-195. doi:10.1007/978-3-031-09348-8_8.

[b0345] 69.Sharma B., Yadav L., Shrestha A., et al. Drought stress and its management in wheat (Triticum aestivum L.): a review. Agric Sci Technol. 2022;14(1):3–14. [Google Scholar]

[b0350] 70.Lum M.S., Hanafi M.M., Rafii Y.M., Akmar A.S.N. Effect of drought stress on growth, proline, and antioxidant enzyme activities of upland rice. J Anim Plant Sci. 2014;24(5):1487–1493. [Google Scholar]

[b0355] 71.Seleiman M.F., Al-Suhaibani N., Ali N., et al. Drought stress impacts on plants and different approaches to alleviate its adverse effects. Plants. 2021;10(2):259. doi: 10.3390/plants10020259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0360] 72.Qayyum A., Al Ayoubi S., Sher A., et al. Improvement in drought tolerance in bread wheat is related to an improvement in osmolyte production, antioxidant enzyme activities, and gaseous exchange. Saudi J Biol Sci. 2021;28(9):5238–5249. doi: 10.1016/j.sjbs.2021.05.064. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0365] 73.Dvojković K., Plavšin I., Novoselović D., et al. Early antioxidative response to desiccant-stimulated drought stress in field-grown traditional wheat varieties. Plants. 2023;12(2):249. doi: 10.3390/plants12020249. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0370] 74.Petrov V.D., Van Breusegem F. Hydrogen peroxide—a central hub for information flow in plant cells. AoB Plants. 2012;2012 doi: 10.1093/aobpla/pls014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0375] 75.Balashov N.V., Borisova-Mubarakshina M.M., Vetoshkina D.V. The effect of hydrogen peroxide on the redistribution of antenna complexes between photosystems in higher plants. Biochemistry (Mosc) 2025;90(7):943–955. doi: 10.1134/S000629792507002X. [DOI] [PubMed] [Google Scholar]

[b0380] 76.Caverzan A., Casassola A., Brammer S.P. Antioxidant responses of wheat plants under stress. Genet Mol Biol. 2016;39(1):1–6. doi: 10.1590/1678-4685-GMB-2015-0109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0385] 77.Khan P., Abdelbacki A.M., Albaqami M., Jan R., Kim K.M. Proline promotes drought tolerance in maize. Biology. 2025;14(1):41. doi: 10.3390/biology14010041. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0390] 78.Mwadzingeni L., Shimelis H., Tesfay S., Tsilo T.J. Screening of bread wheat genotypes for drought tolerance using phenotypic and proline analyses. Front Plant Sci. 2016;7:1276. doi: 10.3389/fpls.2016.01276. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0395] 79.Chowdhury M.K., Hasan M.A., Bahadur M.M., et al. Evaluation of drought tolerance of some wheat (Triticum aestivum L.) genotypes through phenology, growth, and physiological indices. Agronomy. 2021;11(9):1792. doi: 10.3390/agronomy11091792. [DOI] [Google Scholar]

[b0400] 80.Hasanuzzaman M., Hossain M.A., Da Silva J.T., Fujita M. Plant Response and Tolerance to Abiotic Oxidative Stress: Antioxidant Defense Is a Key Factor. Springer; 2012. Crop stress and its management: perspectives and strategies; pp. 261–315. [DOI] [Google Scholar]

[b0405] 81.Ishfaq N., Waraich E.A., Ahmad M., et al. Mitigating drought-induced oxidative stress in wheat (Triticum aestivum L.) through foliar application of sulfhydryl thiourea. Sci Rep. 2024;14(1) doi: 10.1038/s41598-024-52982-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0410] 82.Li W., Tian Z., Yu D. WRKY13 acts in stem development in Arabidopsis thaliana. Plant Sci. 2015;236:205–213. doi: 10.1016/j.plantsci.2015.04.010. [DOI] [PubMed] [Google Scholar]

[b0415] 83.Zhou S., Zheng W.J., Liu B.H., et al. Characterizing the role of TaWRKY13 in salt tolerance. Int J Mol Sci. 2019;20(22):5712. doi: 10.3390/ijms20225712. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0420] 84.Todaka D., Nakashima K., Shinozaki K., Yamaguchi-Shinozaki K. Toward understanding transcriptional regulatory networks in abiotic stress responses and tolerance in rice. Rice. 2012;5:1–9. doi: 10.1186/1939-8433-5-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0425] 85.Mao X., Zhang H., Qian X., Li A., Zhao G., Jing R. TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J Exp Bot. 2012;63(8):2933–2946. doi: 10.1093/jxb/ers007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0430] 86.Sakuma Y., Maruyama K., Osakabe Y., et al. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell. 2006;18(5):1292–1309. doi: 10.1105/tpc.105.035881. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0435] 87.Anbazhagan K., Bhatnagar-Mathur P., Vadez V., Dumbala S.R., Kishor P.K., Sharma K.K. DREB1A overexpression in transgenic chickpea alters key traits influencing plant water budget across water regimes. Plant Cell Rep. 2015;34(2):199–210. doi: 10.1007/s00299-014-1706-3. [DOI] [PubMed] [Google Scholar]

[b0440] 88.Kusano T., Berberich T., Harada M., Suzuki N., Sugawara K. A maize DNA-binding factor with a bZIP motif is induced by low temperature. Mol Gen Genet. 1995;248:507–517. doi: 10.1007/BF02191598. [DOI] [PubMed] [Google Scholar]

[b0445] 89.Li S. Novel insight into functions of ascorbate peroxidase in higher plants: more than a simple antioxidant enzyme. Redox Biol. 2023;64 doi: 10.1016/j.redox.2023.102789. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b0450] 90.Fleta-Soriano E., Díaz L., Bonet E., Munné-Bosch S. Melatonin may exert a protective role against drought stress in maize. J Agron Crop Sci. 2017;203(4):286–294. doi: 10.1111/jac.12202. [DOI] [Google Scholar]

[b0455] 91.Bhattacharjee S. Reactive oxygen species and oxidative burst: Roles in stress, senescence, and signal transduction in plants. Curr Sci. 2005;89(7):1113–1121. [Google Scholar]

[b0460] 92.Shakirova F.M., Allagulova C.R., Bezrukova M.V., Gimalov F.R. Induction of expression of the dehydrin gene TADHN and accumulation of abscisic acid in wheat plants in hypothermia. Dokl Biochem Biophys. 2005;400 doi: 10.1134/S1607672905060046. [page range unavailable] [DOI] [PubMed] [Google Scholar]

[b0465] 93.Rorat T., Grygorowicz W.J., Irzykowski W., Rey P. Expression of KS-type dehydrins is primarily regulated by factors related to organ type and leaf developmental stage during vegetative growth. Planta. 2004;218(5):878–885. doi: 10.1007/s00425-003-1166-8. [DOI] [PubMed] [Google Scholar]

PERMALINK

Assessment of key transcription factors and drought-responsive genes in wheat cultivars under drought stress

Mohamed A Sakr

Eman A El-Khateeb

Hanan I Sayed-Ahmed

Reda M Gaafar

Abstract

1. Introduction

2. Materials and methods

2.1. Plant materials

2.2. Germination of wheat seeds

2.3. Transplanting of wheat seedlings on a hydroponic aqueous culture system and growth conditions

Table 1.

2.4. Induction of osmotic stress using PEG 6000 (25%)

Fig. 1.

2.5. Growth parameters measurements

2.6. Relative water content and Root-Shoot ratio

2.7. Determination of photosynthetic activity, chlorophyll a, chlorophyll b, and carotenoid content

2.8. Estimation of CAT, POD, and SOD antioxidant enzyme activities

2.9. Determination of MDA, H2O2, and proline contents

3. Gene expression analysis

3.1. RNA Extraction, cDNA Synthesis, and qRT-PCR

Table 2.

3.2. Statistical analysis

4. Results

4.1. Impacts of PEG-induced osmotic stress on growth parameters of wheat seedlings

Fig. 2.

4.2. Impacts of PEG-induced osmotic stress on relative water content and root-shoot ratio of wheat seedlings

Table 3.

4.3. Impacts of PEG-induced osmotic stress on photosynthetic activity, chlorophyll a, chlorophyll b, and carotenoids in wheat seedlings

Fig. 3.

5. Impacts of PEG-induced osmotic stress on differential response of antioxidant enzymes in wheat seedlings

Table 4.

5.1. Impacts of PEG-induced osmotic stress on MDA, H2O2, and proline levels in wheat seedlings

Fig. 4.

5.2. Gene expression analysis of transcription factors and osmotic stress -responsive genes in wheat seedlings

5.3. Tfs genes TaMYB73, TaNAC2, TaOBF-1B, TaWRKY13, and WDERB-2B

Fig. 5.

5.4. Osmotic stress -related antioxidant genes TaAPX, TaCAT, and W106

Fig. 6.

5.5. Osmotic stress responsive genes TaDHN2.1

5.6. Heatmap analysis of expressed genes

Fig. 7.

6. Discussion

7. Conclusion

8. Statements and declarations

CRediT authorship contribution statement

Funding

Declaration of competing interest

Footnotes

Appendix A. Supplementary data

Data availability

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

2.9. Determination of MDA, H₂O_2, and proline contents

5.1. Impacts of PEG-induced osmotic stress on MDA, H₂O_2, and proline levels in wheat seedlings