Skip to main content
Journal of Orthopaedic Surgery and Research logoLink to Journal of Orthopaedic Surgery and Research
. 2025 Dec 31;21:70. doi: 10.1186/s13018-025-06563-9

Macrophage-derived exosomal miR-466i-5p and miR-365-2-5p stimulated by BMP-2 promote osteogenesis

Ran Lu 1,2,#, Haitao Dong 1,2,#, Wanting Li 2, Na Wang 2, Yao Yao 2, Su Chen 1,2,✉
PMCID: PMC12866557  PMID: 41476212

Abstract

Background

Macrophage-derived exosomes and exosomal microRNAs (miRNAs) are critical mediators of bone marrow mesenchymal stem cell (BMSC) differentiation. However, their regulatory mechanisms under bone morphogenetic protein 2 (BMP2) stimulation remain unclear.

Methods

This study identified macrophage-derived exosomes stimulated or unstimulated by BMP2 (BMP2-Exos and DMEM-Exos, respectively) and co-cultured them with BMSCs to assess the effects of BMP2-Exos on BMSC osteogenic differentiation (n = 3). Bioinformatic methods were used to analyze differentially expressed miRNAs, and RNA sequencing (RNA-Seq) was used to examine the exosomal miRNA expression profiles of BMP2-Exos and DMEM-Exos to elucidate underlying mechanisms.

Results

Six miRNAs were upregulated and one miRNA was downregulated after osteogenic induction. Gene ontology and pathway analyses revealed that the target genes of differentially expressed exosomal miRNAs regulate various biological processes, including protein binding, metabolic processes, and biological regulation, and are enriched in osteogenic differentiation-related pathways, such as the PI3K-Akt signaling pathway and regulation of the actin cytoskeleton. Bioinformatic analysis identified elevated expression of microRNA-466i-5p (miR-466i-5p) and microRNA-365-2-5p (miR-365-2-5p) in BMP2-Exos, which may promote the osteogenic differentiation of BMSCs.

Conclusions

BMP2-activated macrophage-derived exosomes regulate BMSC osteogenic differentiation through miR-466i-5p and miR-365-2-5p, thereby revealing a novel therapeutic target for exosome-based bone regeneration strategies.

Keywords: BMP-2, Macrophage, Exosome, miR-466i-5p, miR-365-2-5p osteogenesis

Introduction

Osteoimmune regulation underlies oral implant osseointegration and its perturbation, modulating the osteoimmune microenvironment at the bone-implant interface. During implantation, immune cells, especially macrophages, are present throughout the healing process, ensuring defense against pathogens and releasing a complex array of effectors to regulate osseointegration. Studies have shown that macrophages contribute significantly to the immunoregulation of mesenchymal stem cells and osteoblast function in bone homeostasis and repair [1, 2], thereby playing an important role in material-related immune responses and bone formation [3].

Among the osteoinductive molecules discovered thus far, bone morphogenetic protein 2 (BMP2) is the most widely used growth factor for bone regeneration [4–7]. However, the regenerative potential of BMP2 is often accompanied by certain adverse events and complications. Several side effects, such as ectopic bone formation, inflammation, bone resorption, and hematoma, have been reported with the clinical use of BMP2 [8]. In addition, high doses of BMP2 are needed required because of the poor retention rate of some BMP2 carriers and the age-associated reduction in BMP2-mediated bone-healing activity in elderly patients [9–11], thereby compromising the safety of BMP2.

Exosomes are small membrane-enclosed vesicular particles carrying specific microRNAs (miRNAs) that integrate with neighboring cells or reach distant tissues and organs through the circulatory pathway, thus mediating intercellular communication [12, 13]. Overall, they serve as key regulatory molecules in bone regeneration [14–16]. Abnormal expression of intracellular miRNAs may alter regulatory functions at the post-transcriptional level, inducing a series of biological functional changes and disease occurrence [17, 18], revealing that osteogenic differentiation is regulated by specific exosome-derived miRNAs [19–21].

Although these studies have shown the promising applications of exosomes in regenerative medicine, knowledge of the bone regenerative potential of macrophage-derived exosomes remains limited. Studies have shown that exosomes derived from macrophages stimulated by BMP2 play essential roles in bone marrow mesenchymal stem cell (BMSC) differentiation [22]; however, the specific mechanism remains unknown. Therefore, in this study, we investigated the regulatory role of BMP2/macrophage-derived exosomes in the osteogenic differentiation of BMSCs and the molecular mechanisms of macrophage-derived exosomal miRNAs in BMSC differentiation. Our findings revealed that microRNA-466i-5p (miR-466i-5p) and microRNA-365-2-5p (miR-365-2-5p) were highly enriched in BMP2/macrophage-derived exosomes (BMP2-Exos) and were endocytosed by BMSCs, thereby influencing their differentiation.

Materials and methods

Cell culture, stimulation, and exosome isolation

A murine macrophage cell line, RAW 264.7 (ATCC), and murine bone marrow mesenchymal stromal cells (BMSCs, ATCC) were used in this study. RAW 264.7 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific, China), supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin/streptomycin (Gibco), in a humidified incubator at 37 °C with 5% CO2. BMSCs were treated with DMEM containing osteogenic components: 2 mM β-glycerophosphate, 100 µM l-ascorbic acid 2-phosphate, and 10 nM dexamethasone (Sigma-Aldrich, USA).

RAW 264.7 cells were stimulated with or without 200 ng/mL BMP2 (Noveprotein Scientific Inc., China) for 12 h. After washing thrice with phosphate-buffered saline (PBS), the cells were incubated in 10 mL serum-free DMEM at 37 °C for 24 h to collect conditioned medium (CM). The CM was centrifuged at 300×g and 4 °C for 10 min, then filtered through 0.22-µm filters to remove apoptotic bodies, microvesicles, and cell debris. Next, exosomes were isolated from the CM through ultracentrifugation of the supernatant at 100,000×g and 4 °C for 90 min. The resulting exosome pellets were resuspended in 2 mL ice-cold PBS, centrifuged again at 100,000×g and 4 °C for 90 min, and finally resuspended in 100 µL PBS for storage at − 80 °C until further analysis. Exosomes derived from DMEM-stimulated RAW 264.7 cells were regarded as DMEM-Exos, whereas those from BMP2-stimulated cells were regarded as BMP2-Exos.

Exosome identification

Transmission electron microscopy (TEM)

TEM was used to confirm the presence of exosomes in the purified samples. Specifically, 10 µL of extracted exosomes was placed on carbon/formvar-coated copper TEM grids for 10 min. After incubation at room temperature for 5 min, the grids were stained with 2% uranyl acetate for 1 min, washed twice with deionized water, gently blotted onto Whatman filter paper, and air-dried. Imaging was performed using a TEM (JEM-1400, JEOL, Japan) at 80–120 kV.

Nanoparticle tracking analysis (NTA)

The sample pool was cleaned with deionized water, and the instrument was calibrated using polystyrene microspheres (diameter: 110 nm). Next, the sample pool was washed with PBS. The exosomes were moderately diluted with PBS; specifically, 10 μL of exosomes were diluted to 30 μL and slowly injected into the sample pool. After adjusting the focal length, the standard operating procedure for sample size observation and calculation was followed. Each sample was tested in triplicate.

Western blot analysis

Using the specific binding principle of antigens and antibodies, exosome marker proteins were detected, enabling their identification at the protein level. The concentration of secreted proteins was determined using a bicinchoninic acid protein quantification kit. Based on these results, samples (ranging 10–30 μg) were mixed proportionally with buffer, vortexed, and denatured in a 95 °C water bath for 5 min before electrophoresis. Next, the separation gel was removed, and the target proteins, including positive exosome markers CD63, TSG101, and ALIX, as well as the negative marker Calnexin (collectively referred to as the “three non-exosome markers”), were transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked with a 3% BSA solution and subsequently subjected to primary antibodies (#25682-1-AP, #28283-1-AP, #12422-1-AP, and #10427-2-AP; Proteintech, 1:5000) and secondary antibody (#115-035-003 and Jackson, 1:5000) incubation, development, fixation, and exposure.

Exosome uptake assay

Exosomes were incubated with PKH-67 dye (Sigma-Aldrich, USA) in Diluent C for 5 min. Staining was terminated by adding DMEM containing 5% FBS. The exosomes were then washed in PBS at 100,000×g for 1 h and added to the BMSC culture medium. After 6 h of incubation, cells were fixed with 4% paraformaldehyde for 10 min. Cell nuclei were stained with 6-diamidino-2-phenylindole (DAPI) solution according to the manufacturer’s instructions. Imaging was performed using the LSM710 confocal imaging system (Carl Zeiss, Oberkochen, Germany).

Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

BMSCs were cultured in osteogenic medium supplemented with equal quantities of DMEM-Exo or BMP2-Exo for 3 d. Total RNA was extracted using TRIzol reagent (Lot #15596-018, Ambion™, Life Technologies Pty Ltd., Australia) according to the manufacturer’s instructions. Reverse transcription was conducted using the DyNAmo™ cDNA Synthesis Kit (Finnzymes, Genesearch Pty Ltd., Australia). qRT-PCR was performed using the QuantStudio™ Real-Time PCR System (Applied Biosystems, USA) using a two-step protocol: 95 °C for 2 min, followed by 45 cycles of 95 °C for 5 s, 60 °C for 10 s, and 72 °C for 15 s. The expressions of target genes including ALP, OPN, OCN, Col-I, OPG, GAPDH, miR-466i-5p, miR-365-2-5p, miR-342-5p, miR-712-5p, miR-185-5p, and miR-222-5p were quantified. Primer sequences are listed in Table 1. GAPDH and U6 were used as internal controls for mRNA and miRNA analyses, respectively.

Table 1.

PCR primer sequences used in this study

Gene Forward primers (5′ to 3′) Reverse primers (3′ to 5′)
ALP GAACAGAACTGATGTGGAATACGAA CAGTGCGGTTCCAGACATAGTG
OPN GTGATTTGCTTTTGCCTGTTTG GGAGATTCTGCTTCTGAGATGGG
OCN GAACAGACAAGTCCCACACAGC TCAGCAGAGTGAGCAGAAAGAT
Col-I GATGTTGAACTTGTTGTTGCTGAGGG GGCAGGCGAGATGGCTTATT
OPG ATTGGCTGAGTGTTTTGGTGGA GCTGGAAGGTTTGCTCTTGTGA
GAPDH TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG
miR-466i-5p ACCCAATGTGTGTGTGTGTG CGAGGAAGAAGACGGAAGAAT
miR-365-2-5p TTAAGGGACTTTCAGGGGCA CGAGGAAGAAGACGGAAGAAT
miR-342-5p TTCGAGGGGTGCTATCTGTG CGAGGAAGAAGACGGAAGAAT
miR-712-5p TTATACTCCTTCACCCGGGC CGAGGAAGAAGACGGAAGAAT
miR-185-5p TGCATGGAGAGAAAGGCAGT CGAGGAAGAAGACGGAAGAAT
miR-222-5p TGGATCTCAGTAGCCAGTGT CGAGGAAGAAGACGGAAGAAT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT

Western blot analysis

BMSCs were cultured in osteogenic medium supplemented with DMEM-Exo or BMP2-Exo for 3 d. Whole cell lysates were collected by adding 250 µL of radioimmunoprecipitation assay (RIPA) buffer (P0013B; Beyotime, China) containing protease inhibitor (P1081; Beyotime, China). Equal quantities of protein (15 µg) were resolved on 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) for 90 min, then transferred onto 0.45-µm polyvinylidene fluoride (PVDF) membranes activated with methanol. Membranes were incubated overnight at 4 °C with primary antibodies: β-tubulin, ALP (1:1000, ab108337; Abcam); β-catenin (1:1000, ab4074; Abcam); BMP2 (1:1000; ab82511, Abcam); ATG5 (1:1000, Cat. No. 12994; Cell Signaling Technology); and LC3-I/II (1:1000, Cat. No. 2775; Cell Signaling Technology). After washing with Tris-buffered saline (TBS; Solarbio, China) with Tween-20 (0.1%), the blots were incubated with IRDye 680RD goat anti-mouse IgG (H + L) (1:5000; LI-COR Biotechnology), then washed thrice with TBS-Tween 20 (0.1%). Protein signals were visualized using the Odyssey Infrared Imaging System (LI-COR Biotechnology, USA), and the relative intensity of protein bands was quantified relative to β-tubulin using Image Studio™ Software.

RNA sequencing (RNA-Seq) and bioinformatics analysis

The miRNA expression profiles of DMEM-Exos and BMP2-Exos were compared using small (s)RNA-Seq. Total exosome-derived RNA was purified using the ExoRNeasy Maxi Kit (Qiagen, USA). RNA purity was assessed with the NanoPhotometer® spectrophotometer (IMPLEN, CA, USA); concentration was measured using the Qubit® RNA Assay Kit on the Qubit® 2.0 Fluorometer (Life Technologies, CA, USA); and integrity was evaluated using the RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).

For the small RNA library preparation, 10 ng of total RNA per sample was used. Sequencing libraries were generated using the VAHTS Small RNA Library Prep Kit for Illumina (Vazyme, NR811-01/02, China) following the manufacturer’s instructions, and index codes were added to attribute sequences to each sample. Library quality was assessed using the Agilent Bioanalyzer 2100 system with DNA high-sensitivity chips. Index-coded samples were clustered on a cBot Cluster Generation System using the TruSeq SR Cluster Kit v3-cBot-HS (Illumina, USA), according to the manufacturer’s instructions. Library preparations were sequenced on an Illumina NovaSeq platform, yielding 50 bp single-end reads. Bowtie [23] was used to map small RNA tags to reference sequences. Differential expression analysis was performed using the DESeq2 R package (v1.24.0), and p values were adjusted using the Benjamini–Hochberg method. A corrected p value threshold of 0.05 and |log2FC|≥ 1 were set to determine significant differential expression. miRanda and RNAhybrid [24] were used to predict miRNA target genes in animals. Next, Gene Ontology (GO) enrichment analysis was conducted on differentially expressed miRNA target gene candidates using GOseq, which adjusts for gene length bias based on the Wallenius non-central hypergeometric distribution [25]. Kyoto Encyclopedia of Genes and Genomes (KEGG) [26] is a database resource for understanding high-level functions and utilities of biological systems, such as cells, organisms, and ecosystems, from molecular-level information, particularly large-scale datasets generated by genome sequencing and other high-throughput technologies (http://www.genome.jp/kegg/). Finally, the KOBAS [27] software was used to test the statistical enrichment of target gene candidates in KEGG pathways.

Transfection of miRNA-lipid nanoparticles (miRNA-LNPs)

BMSCs (5 × 104) were seeded in 12-well culture plates. A lipid–ethanol cocktail comprising synthesized MC3, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and DMG-PEG2000 was prepared at a total lipid concentration of 50 mM. Each lipid was dissolved in ethanol at a molar ratio of 50:10:38.5:1.5. The stock lipid solution was diluted 1:3 with ethanol to achieve a final ethanol concentration of 66.7% (v/v) and a total lipid concentration of 3.33 mM. This step ensured controlled mixing of aqueous miRNAs during microfluidic processing. All chemicals were purchased from Sigma-Aldrich. Next, microfluidic mixing was used for miRNA encapsulation, and miRNA-LNPs were used to transfect the cells with miRNA mimics: miR-466i-5p (UGUGUGUGUGUGUGUGUGUG), miR-365-2-5p (AGGGACUUUCAGGGGCAGCUGUG), and negative controls (LNPs).

Alkaline phosphatase staining (ALP) and alizarin red staining (ARS)

BMSCs were treated with osteogenic differentiation induction medium for 7 d. Cells from different groups were then treated with an alkaline phosphatase chromogenic kit (Solarbio, China).

On day 14, the ARS assay was performed. The cells were fixed for 20 min with 1 mL of 4% neutral formaldehyde solution, washed with PBS, and treated with 1 mL of 1% Alizarin Red (Sigma-Aldrich) for 5 min. All images of the stained cells were captured using a ZEISS Axio Vert.A1 microscope (Germany), and the Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA) was applied to analysis each photo to obtain the tissue area, positive area, and positive rate.

Statistical analysis

All data are expressed as mean ± standard deviations (SD, n = 3). Statistical analyses were performed using GraphPad Prism 10 (version 10.1.2) for Windows (GraphPad Software Inc.). Individual pairwise comparisons were performed using Student’s t-test and one-way ANOVA. Statistical significance was set at p < 0.05.

Results

Exosome characterization

We characterized and quantified the previously isolated exosomes. Representative TEM images showed the general morphology of exosomes isolated from DMEM- or BMP2-treated macrophages (Fig. 1A). The isolated exosomes exhibited a cup or spherical shape with no significant morphological differences. NTA analysis showed that the average particle size was 81.4 nm with a concentration of 1.39 × 1010 particles/mL in DMEM-Exo, whereas the average particle size was 81.3 nm with a concentration of 9.04 × 109 particles/mL in BMP2-Exo (Fig. 1B). Representative western blot images revealed the expression of exosome surface markers (Fig. 1C), confirming that all exosomes expressed exosome-specific markers (CD63, TSG101, and ALIX), whereas Calnexin a negative marker, was absent.

Fig. 1.

Fig. 1

Morphological characterization of exosomes derived from control or BMP2 stimulated macrophages. A Representative TEM images of exosomes isolated from macrophages stimulated with DMEM or BMP2, respectively. B The particle size distribution and concentration of exosomes were measured by NTA. C Western blot analysis of the exosome-specific markers (CD63, TSG101, and ALIX) and endoplasmic reticulum protein (calnexin)

Internalization of exosomes by BMSCs

To investigate whether BMSCs can internalize exosomes, exosomes were stained with PKH-67 and incubated with BMSCs for 6 h. Fluorescence microscopy showed that a substantial number of exosomes (green dots) were internalized by BMSCs after 6 h of incubation (Fig. 2).

Fig. 2.

Fig. 2

Laser scanning confocal microscopy analysis of the internalization of PKH-67-labelled exosomes by BMSCs. PKH-67-labeled exosomes (green) were accumulated in the BMSCs after 6 h coincubation. The nuclei of BMSCs were stained with DAPI (blue). Low magnification scale bar: 20 μm and High magnification scale bar: 50 μm

Osteogenic activity of BMSCs stimulated with DMEM-Exo or BMP2-Exo

To investigate the effects of DMEM-Exo and BMP2-Exo on BMSC differentiation, equal quantities of exosomes were incubated with BMSCs for 3 d in osteogenic medium. qRT-PCR and western blotting were performed to assess gene expression and protein levels of osteogenic markers, respectively.

The expression levels of osteogenesis-related markers, including ALP, osteopontin (OPN), osteocalcin (OCN), collagen type I (Col-I), and osteoprotegerin (OPG), were measured using qRT-PCR. As shown in Fig. 3A, the expression of ALP, OPN, OCN, Col-I, and OPG was significantly increased in cells treated with BMP2-Exo.

Fig. 3.

Fig. 3

Osteogenesis of BMSCs stimulated by DMEM-exo or BMP2-exo. A RNA expression of osteogenesis-related genes (ALP, OPN, OCN, Col-I and OPG). Data were expressed as the mean ± SD for three independent experiments. B Protein expression of early osteoblast differentiation marker (ALP), β-catenin, BMP2, autophagy-related proteins (ATG5, LC3-I, and LC3-II) assessed by Western blot. Data were expressed as the mean ± SD for three independent experiments. The protein levels were quantitated by densitometry quantitation normalized to β-Tubulin. *p < 0.05, **p < 0.01, ***p < 0.001

As shown in Fig. 3B, protein levels of ALP, β-catenin, BMP2, autophagy-related protein 5 (ATG5), microtubule-associated protein light chain 3-I (LC3-I), and microtubule-associated protein light chain 3-II (LC3-II) were markedly increased after BMP2-Exo treatment.

miRNA profiles of exosomes derived from RAW264.7 stimulated by BMP2

To determine the potential molecular mechanism of BMP2-Exo, miRNA sequencing analysis was performed on DMEM-Exos and BMP2-Exos.

BMP2 stimulation of RAW264.7 resulted in marked shifts in the miRNA cargo of exosomes. As shown in Fig. 4A, the heat map illustrates sample clusters on the abscissa and gene clusters on the ordinate, highlighting clear differences in miRNA expression between the two groups. Six miRNAs (miR-466i-5p, miR-365-2-5p, miR-342-5p, miR-712-5p, miR-185-5p, and miR-222-5p) were upregulated, whereas one miRNA (miR-96-5p) was downregulated in BMP2-Exos compared with DMEM-Exos (|log2FC|≥ 1, corrected p value < 0.05), as shown in the volcano plot (Fig. 4B).

Fig. 4.

Fig. 4

The exosomal miRNA differential expression profiles: A the heat map of differentially expressed exosomal miRNAs; B the volcano plot of differentially expressed exosomal miRNAs

qPCR verification of miRNA expression

Based on the miRNA profiling data, we selected six upregulated miRNAs (miR-466i-5p, miR-365-2-5p, miR-342-5p, miR-712-5p, miR-185-5p, and miR-222-5p) and validated their expression using qRT-PCR. As shown in Fig. 5, two of the six selected miRNAs (miR-466i-5p and miR-365-2-5p) were significantly upregulated in BMP2-Exos compared to DMEM-Exos (p < 0.05).

Fig. 5.

Fig. 5

Validation of RNA sequencing data by qRT-PCR. Data were expressed as the mean ± SD for three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001

Pathway and gene ontology (GO) analysis of exosomal miRNAs

Exosomal miRNAs can influence the osteogenic differentiation process by targeting genes that regulate signaling pathways involved in cell differentiation. Therefore, we performed GO enrichment analyses to explore the potential functions of the differentially expressed miRNAs. The GO enrichment analysis indicated that the candidate target genes were associated with several biological processes, cellular components, and molecular functions. Notably, functions such as protein binding and metabolic processes were primarily affected by the differentially expressed miRNAs (Fig. 6).

Fig. 6.

Fig. 6

GO analyses and KEGG pathway analysis: A enrichment map of GO analyses-biological process, cellular component, and molecular function; B enrichment map of KEGG pathway analysis

Subsequent KEGG pathway analysis indicated the potential roles of these BMP2-Exo-specific miRNAs in signaling pathways known to be important in osteoinduction, which were primarily enriched in the PI3K-AKt signaling pathways (Fig. 6).

Based on the miRNA sequencing, GO and KEGG pathway enrichment analyses, miR-466i-5p and miR-365-2-5p appeared to have positive effects on osteoblast differentiation. Therefore, these two miRNAs were selected as potential key factors to determine whether they are related to the promotional effect of BMP2-Exos on osteogenesis.

miR‑466i‑5p and miR-365-2-5p promote BMSC osteogenic differentiation

To investigate the effects of miR-466i-5p and miR-365-2-5p on BMSC osteogenic differentiation, BMSCs were transfected with miR-466i-5p-LNPs, miR-365-2-5p-LNPs, or negative control LNPs. ALP activity was positively correlated with miR-466i-5p or miR-365-2-5p expression during osteogenesis differentiation. As shown by Alizarin red staining, mineralization increased following stimulation with miR-466i-5p-LNPs or miR-365-2-5p-LNPs (Fig. 7). ALP and ARS staining indicated that overexpression of miR-466i-5p or miR-365-2-5p induced more pronounced ALP activity and calcium nodule formation.

Fig. 7.

Fig. 7

The effect of miR-365-2-5p and miR-466i-5p on osteogenic differentiation. A The influence of miR-365-2-5p and miR-466i-5p on osteogenesis of BMSCs was observed by ALP staining (scale bar: 100 mm). B The influence of miR-365-2-5p and miR-466i-5p on extracellular matrix mineralization was observed by ARS staining (scale bar: 100 mm). *p < 0.05, **p < 0.01, ***p < 0.001

Discussion

Macrophages are pivotal cells in the bone marrow and represent some of the first cell types that interact with foreign pathogens and implanted medical devices [28–30]. These cells are rapidly recruited to sites of infection and injury, where they regulate tissue homeostasis through innate and adaptive immunity and wound healing [31, 32]. BMP2-induced osteogenic effects are associated with interactions between macrophages and BMSCs. Although the immunomodulatory role of macrophages in bone repair is well established, our data highlight the importance of exosomes and miRNAs in mediating the effects of macrophages on bone regeneration. Moreover, monitoring ATG5 and LC3 provides direct insight into the autophagic status of cells, which is closely linked to their capacity for osteogenic differentiation. ATG5 and LC3-II/LC3-I ratio are widely recognized as key molecular markers of autophagy which are highly relevant in osteogenic differentiation [33, 34]. Research has confirmed increased LC3-II/LC3-I ratio and ATG5 expression in BMP2-exo-treated MSCs correlated with enhanced osteogenic differentiation and autophagy activation [22]. Autophagy interacts with immune regulation—such as macrophage polarization—further influencing the bone regenerative microenvironment.

In this study, we used the mouse macrophage cell line RAW264.7 to investigate the effects of BMP2 stimulation on exosome production and characterization. Our results revealed that macrophage-derived exosomes were taken up by BMSCs and enhanced their osteogenic differentiation. Moreover, exosomes derived from BMP2-stimulated macrophages exhibited elevated levels of miR-466i-5p and miR-365-2-5p, which promoted osteogenic differentiation of BMSCs. Since miRNAs are highly enriched in exosomes and vary with culture conditions [35–37], we hypothesized that exosomal miRNAs may partially contribute to the observed effects.

miRNAs in exosomes can be delivered into receptor cells to modulate neighboring and distant cells and are involved in bone regeneration. Our study revealed differential expression of exosomal miRNAs in BMP2-stimulated macrophages, many of which have been reported to be related to osteogenesis.

miR-466i-5p, overexpressed in BMP2-macrophage exosomes, was identified as a key regulator of BMSC differentiation in the present study. Previously identified as a pivotal regulator of osseous endothelial cells and a therapeutic target for age-related osteoporosis [38], the role of miR-466i-5p in the regulation of BMSC function via macrophage-derived exosomes is novel. Our study elucidated the mechanism through which exosomal miR-466i-5p promotes BMSC osteogenesis. In addition, miR-365-2-5p was overexpressed in BMP2-macrophage exosomes and promoted osteogenic differentiation, consistent with previous findings that M2 exosome-derived miR-365-2-5p enhances MC3T3-E1 osteogenesis and inhibits OLFML1 expression, leading to impaired osteoblast differentiation and abnormal bone tissue development [39].

miR-342-5p inhibits osteogenesis. Studies have reported that miR-342-5p inhibits odontogenic/osteogenic differentiation of human dental pulp stem cells by targeting Wnt7b [40]. However, in our study, BMP2-stimulated macrophage exosomes showed increased miR-342-5p levels, which may be related to early-stage osteogenesis angiogenesis [41, 42]. miR-712-5p and miR-222-5p may also be associated with angiogenesis for the reason that miR-712-5p expression is significantly upregulated in proliferative vascular diseases [43], and miR-222-5p regulates human mesenchymal stem cell differentiation into VSMCs for vascular grafts [44]. The increase of miR-185-5p inhibiting osteogenesis [45, 46] and angiogenesis [47, 48] may help regulate bone homeostasis. Moreover, decreased expression of miR-96-5p has been observed to inhibit osteoclast formation and bone resorption [49, 50]. In our study, miR-96-5p expression in macrophage exosomes decreased after BMP2 stimulation, which may be related to the promotion of osteogenesis.

GO analysis indicated that the majority of differentially expressed exosomal miRNAs were involved in key molecular mechanisms related to osteogenic differentiation, including localization, metabolic processes, cellular organization, molecular function, catalytic activity, and protein binding. KEGG analysis showed that the target genes were primarily enriched in the PI3K-Akt signaling pathway [51]. It has been reported that macrophage polarization mechanisms are related to the PI3K-AkT signaling pathway [52, 53]. Although the direct experimental validation of macrophage-derived exosomes (BMP2-Exo) activating the PI3K-Akt signaling pathway in osteogenesis remains to be conducted, accumulating evidence from both our KEGG pathway analysis and recent studies strongly implicates the PI3K/AKT signaling pathway as a central mechanism in exosome-mediated osteogenic differentiation. This is highlighted by the finding that miR-374-5p inhibits osteogenesis by targeting PTEN, a key negative regulator of PI3K/AKT [54]. And multiple osteo-promotive agents [55, 56], have been shown to enhance osteogenic differentiation via PI3K/AKT activation, effects that are reversible with the inhibitor LY294002. Crucially, direct evidence for exosomal involvement comes from Liu et al. [57], who reported that exosomes derived from platelet-rich plasma (PRP-exos) promote cartilage repair through the PI3K/AKT pathway. Therefore, these findings provide a compelling rationale for the hypothesis that macrophage-derived exosomes may similarly promote osteogenesis by activating the PI3K/AKT signaling cascade.

The phenotypic switch from pro-inflammatory M1 to anti-inflammatory M2 macrophages plays a critical role in coordinating tissue repair and regeneration by modulating immune responses [58–60]. Macrophage-derived exosomes, which are hypoimmunogenic, have therapeutic potential for cell-free clinical applications in humans. M2-Exos promote the proliferation and osteogenic differentiation of BMMSCs, suppress pro-inflammatory factors such as TNF-α and IL-6, enhance anti-inflammatory factor IL-10, stimulate bone formation and angiogenesis, reduce osteoclastogenesis, and modulate macrophage polarization from M1 to M2 phenotype [61]. However, the clinical translation of miRNA-based treatments is significantly hindered by the lack of effective delivery systems and targeted efficiency [62, 63]. Therefore, it is necessary to verify their effects on bone formation in animal models. This strategy may serve as an ideal “inducing factor” in bone engineering and aid in repairing clinical bone defects in the future. Exosomal miRNAs may play a crucial role in promoting osteogenic differentiation of BMSCs and enhancing bone regeneration. This study provides a foundation for understanding exosome-mediated osteogenic differentiation of BMSCs. Further exploration of the detailed mechanisms is necessary.

Conclusions

In summary, these findings indicate that exosomal miR-466i-5p and miR-365-2-5p in macrophages stimulated by BMP2 promote osteogenic differentiation of BMSCs and may represent a novel feasible treatment strategy for bone regeneration.

Author contributions

Conceptualization, R.L, H.D and S.C; methodology, R.L and H.D; software, W.L; validation, R.L, H.D and W.L; formal analysis, R.L and W.L; investigation, W.L, Y.Y and N.W; resources, S.C; data curation, R.L, H.D and W.L; writing—original draft preparation, R.L and W.L; writing—review and editing, R.L, H.D and W.L; visualization, W.L; supervision, S.C; project administration, S.C; funding acquisition, R.L and S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Beijing Hospitals Authority's Ascent Plan (Code:DFL20221301), and Capital Medical University Nature Science Foundation (No.PYZ24183).

Data availability

All data generated or analyzed during this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ran Lu and Haitao Dong contributed equally to this work.

References

  • 1.Kang M, Huang CC, Lu Y, Shirazi S, Gajendrareddy P, Ravindran S, et al. Bone regeneration is mediated by macrophage extracellular vesicles. Bone. 2020;141:115627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Batoon L, Millard SM, Wullschleger ME, Preda C, Wu AC, Kaur S, et al. CD169(+) macrophages are critical for osteoblast maintenance and promote intramembranous and endochondral ossification during bone repair. Biomaterials. 2019;196:51–66. [DOI] [PubMed] [Google Scholar]
  • 3.Liu A, Jin S, Fu C, Cui S, Zhang T, Zhu L, et al. Macrophage-derived small extracellular vesicles promote biomimetic mineralized collagen-mediated endogenous bone regeneration. Int J Oral Sci. 2020;12(1):33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hu T, Abbah SA, Toh SY, Wang M, Lam RW, Naidu M, et al. Bone marrow-derived mesenchymal stem cells assembled with low-dose BMP-2 in a three-dimensional hybrid construct enhances posterolateral spinal fusion in syngeneic rats. Spine J. 2015;15(12):2552–63. [DOI] [PubMed] [Google Scholar]
  • 5.Kim MG, Kang TW, Park JY, Park SH, Ji YB, Ju HJ, et al. An injectable cationic hydrogel electrostatically interacted with BMP2 to enhance in vivo osteogenic differentiation of human turbinate mesenchymal stem cells. Mater Sci Eng C Mater Biol Appl. 2019;103:109853. [DOI] [PubMed] [Google Scholar]
  • 6.Tan J, Zhang M, Hai Z, Wu C, Lin J, Kuang W, et al. Sustained release of two bioactive factors from supramolecular hydrogel promotes periodontal bone regeneration. ACS Nano. 2019;13(5):5616–22. [DOI] [PubMed] [Google Scholar]
  • 7.Karpov TE, Peltek OO, Muslimov AR, Tarakanchikova YV, Grunina TM, Poponova MS, et al. Development of optimized strategies for growth factor incorporation onto electrospun fibrous scaffolds to promote prolonged release. ACS Appl Mater Interfaces. 2020;12(5):5578–92. [DOI] [PubMed] [Google Scholar]
  • 8.James AW, LaChaud G, Shen J, Asatrian G, Nguyen V, Zhang X, et al. A review of the clinical side effects of bone morphogenetic protein-2. Tissue Eng Part B Rev. 2016;22(4):284–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Decambron A, Fournet A, Bensidhoum M, Manassero M, Sailhan F, Petite H, et al. Low-dose BMP-2 and MSC dual delivery onto coral scaffold for critical-size bone defect regeneration in sheep. J Orthop Res. 2017;35(12):2637–45. [DOI] [PubMed] [Google Scholar]
  • 10.Krishnan L, Priddy LB, Esancy C, Klosterhoff BS, Stevens HY, Tran L, et al. Delivery vehicle effects on bone regeneration and heterotopic ossification induced by high dose BMP-2. Acta Biomater. 2017;49:101–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Charles LF, Woodman JL, Ueno D, Gronowicz G, Hurley MM, Kuhn LT. Effects of low dose FGF-2 and BMP-2 on healing of calvarial defects in old mice. Exp Gerontol. 2015;64:62–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gao H, Zhang L, Wang Z, Yan K, Zhao L, Xiao W. Research progress on transorgan regulation of the cardiovascular and motor system through cardiogenic exosomes. Int J Mol Sci. 2022. 10.3390/ijms23105765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Brandao BB, Lino M, Kahn CR. Extracellular miRNAs as mediators of obesity-associated disease. J Physiol. 2022;600(5):1155–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Komatsu DE, Duque E, Hadjiargyrou M. MicroRNAs and fracture healing: pre-clinical studies. Bone. 2021;143:115758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hadjiargyrou M, Komatsu DE. The therapeutic potential of MicroRNAs as orthobiologics for skeletal fractures. J Bone Miner Res Off J Am Soc Bone Miner Res. 2019;34(5):797–809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shan SK, Lin X, Li F, Xu F, Zhong JY, Guo B, et al. Exosomes and bone disease. Curr Pharm Des. 2019;25(42):4536–49. [DOI] [PubMed] [Google Scholar]
  • 17.Hou X, Peng G, Zhao W, Cheng X, Wang Q, Gan T, et al. Association of elevated exosomal miR-21 levels with nonunion in clavicular fractures post-ORIF: a prospective analysis. Injury. 2024;55(12):111963. [DOI] [PubMed] [Google Scholar]
  • 18.Zhang D, Wu Y, Li Z, Chen H, Huang S, Jian C, et al. MiR-144-5p, an exosomal miRNA from bone marrow-derived macrophage in type 2 diabetes, impairs bone fracture healing via targeting Smad1. J Nanobiotechnology. 2021;19(1):226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xiong Y, Chen L, Yan C, Zhou W, Yu T, Sun Y, et al. M2 macrophagy-derived exosomal miRNA-5106 induces bone mesenchymal stem cells towards osteoblastic fate by targeting salt-inducible kinase 2 and 3. J Nanobiotechnol. 2020;18(1):66. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 20.Xu T, Luo Y, Wang J, Zhang N, Gu C, Li L, et al. Exosomal miRNA-128-3p from mesenchymal stem cells of aged rats regulates osteogenesis and bone fracture healing by targeting Smad5. J Nanobiotechnol. 2020;18(1):47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Pan S, Yin Z, Shi C, Xiu H, Wu G, Heng Y, et al. Multifunctional injectable hydrogel microparticles loaded with miR-29a abundant BMSCs derived exosomes enhanced bone regeneration by regulating osteogenesis and angiogenesis. Small. 2024;20(16):e2306721. [DOI] [PubMed] [Google Scholar]
  • 22.Wei F, Li M, Crawford R, Zhou Y, Xiao Y. Exosome-integrated titanium oxide nanotubes for targeted bone regeneration. Acta Biomater. 2019;86:480–92. [DOI] [PubMed] [Google Scholar]
  • 23.Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. MicroRNA targets in Drosophila. Genome Biol. 2003;5(1):R1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Young MD, Wakefield MJ, Smyth GK, Oshlack A. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol. 2010;11(2):R14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008;36(Database issue):D480–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mao X, Cai T, Olyarchuk JG, Wei L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics. 2005;21(19):3787–93. [DOI] [PubMed] [Google Scholar]
  • 28.Zaveri TD, Lewis JS, Dolgova NV, Clare-Salzler MJ, Keselowsky BG. Integrin-directed modulation of macrophage responses to biomaterials. Biomaterials. 2014;35(11):3504–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Saleh LS, Bryant SJ. In vitro and in vivo models for assessing the host response to biomaterials. Drug Discov Today Dis Model. 2017;24:13–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Vassey MJ, Figueredo GP, Scurr DJ, Vasilevich AS, Vermeulen S, Carlier A, et al. Immune modulation by design: using topography to control human monocyte attachment and macrophage differentiation. Adv Sci. 2020;7(11):1903392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tripathi AS, Zaki MEA, Al-Hussain SA, Dubey BK, Singh P, Rind L, et al. Material matters: exploring the interplay between natural biomaterials and host immune system. Front Immunol. 2023;14:1269960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chen AC, Ciridon W, Creason S, Ratner BD. Surface immobilized alpha-1 acid glycoprotein and collagen VI modulate mouse macrophage polarization and reduce the foreign body capsule. J Biomed Mater Res Part A. 2024;112(8):1241–9. [DOI] [PubMed] [Google Scholar]
  • 33.Xing Y, Liu C, Zhou L, Li Y, Wu D. Osteogenic effects of rapamycin on bone marrow mesenchymal stem cells via inducing autophagy. J Orthop Surg Res. 2023;18(1):129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Niu Q, Chen H, Ou Q, Yang S, Peng Y, Xie Y, et al. Klotho enhances bone regenerative function of hPDLSCs via modulating immunoregulatory function and cell autophagy. J Orthop Surg Res. 2023;18(1):400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wozniak M, Peczek L, Czernek L, Duchler M. Analysis of the miRNA profiles of melanoma exosomes derived under normoxic and hypoxic culture conditions. Anticancer Res. 2017;37(12):6779–89. [DOI] [PubMed] [Google Scholar]
  • 36.Yuze M, Liu N, Shao X, Shi T, Lin J, Liu B, et al. Mechanical loading on osteocytes regulates thermogenesis homeostasis of brown adipose tissue by influencing osteocyte-derived exosomes. J Orthop Transl. 2024;48:39–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Marote A, Teixeira FG, Mendes-Pinheiro B, Salgado AJ. MSCs-derived exosomes: cell-secreted nanovesicles with regenerative potential. Front Pharmacol. 2016;7:231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang Z, Hu B, Chen X, Zhang Z, Liu L, Li N, et al. Integrative analyses of genetic characteristics associated with skeletal endothelial cells. Braz J Med Biol Res. 2024;57:e13339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hou C, Zhang Y, Lv Z, Luan Y, Li J, Meng C, et al. Macrophage exosomes modified by miR-365-2-5p promoted osteoblast osteogenic differentiation by targeting OLFML1. Regen Biomater. 2024;11:rbae018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zeng K, Li W, Kang Q, Li Y, Cheng Q, Xia W. miR-342-5p inhibits odonto/osteogenic differentiation of human dental pulp stem cells via targeting Wnt7b. Oral Dis. 2023;29(5):2107–16. [DOI] [PubMed] [Google Scholar]
  • 41.Yan XC, Cao J, Liang L, Wang L, Gao F, Yang ZY, et al. miR-342-5p is a notch downstream molecule and regulates multiple angiogenic pathways including notch, vascular endothelial growth factor and transforming growth factor beta signaling. J Am Heart Assoc. 2016;5(2):e003042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li X, Li K, Yu G, Yu C, Liu C. miR-342-5p inhibits expression of Bmp7 to regulate proliferation, differentiation and migration of osteoblasts. Mol Immunol. 2019;114:251–9. [DOI] [PubMed] [Google Scholar]
  • 43.Qin Y, Zheng B, Yang GS, Zhou J, Yang HJ, Nie ZY, et al. Tanshinone ⅡA inhibits VSMC inflammation and proliferation in vivo and in vitro by downregulating miR-712-5p expression. Eur J Pharmacol. 2020;880:173140. [DOI] [PubMed] [Google Scholar]
  • 44.Gu W, Hong X, Le Bras A, Nowak WN, Issa Bhaloo S, Deng J, et al. Smooth muscle cells differentiated from mesenchymal stem cells are regulated by microRNAs and suitable for vascular tissue grafts. J Biol Chem. 2018;293(21):8089–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang J, Xu N, Yu C, Miao K, Wang Q. LncRNA PART1/miR-185-5p/RUNX3 feedback loop modulates osteogenic differentiation of bone marrow mesenchymal stem cells. Autoimmunity. 2021;54(7):422–9. [DOI] [PubMed] [Google Scholar]
  • 46.Liu ZH, Qi DD, Li X, Zhang SQ, Zhao Y, Fu LX, et al. LncRNA SNHG14 promotes osteogenic differentiation of human bone marrow-derived mesenchymal stem cells via regulating miR-185-5p/WISP2 axis. J Biol Regul Homeost Agents. 2021;35(2):605–15. [DOI] [PubMed] [Google Scholar]
  • 47.Wei J, Zhao Y. MiR-185-5p protects against angiogenesis in polycystic ovary syndrome by targeting VEGFA. Front Pharmacol. 2020;11:1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Li CC, Qiu XT, Sun Q, Zhou JP, Yang HJ, Wu WZ, et al. Endogenous reduction of miR-185 accelerates cardiac function recovery in mice following myocardial infarction via targeting of cathepsin K. J Cell Mol Med. 2019;23(2):1164–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wang T, Mo L, Ou J, Fang Q, Wu H, Wu Y, et al. Proteus mirabilis vesicles induce mitochondrial apoptosis by regulating miR96-5p/Abca1 to inhibit osteoclastogenesis and bone loss. Front Immunol. 2022;13:833040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Sun X, Pu Y, Dong S, Dong Q. LncRNA urothelial cancer associated 1 promotes the osteogenic differentiation of human periodontal ligament stem cells by regulating the miR-96-5p/Osx axis. Arch Oral Biol. 2024;158:105855. [DOI] [PubMed] [Google Scholar]
  • 51.Long J, Yao Z, Zhang W, Liu B, Chen K, Li L, et al. Regulation of osteoimmune microenvironment and osteogenesis by 3D-printed PLAG/black phosphorus scaffolds for bone regeneration. Adv Sci. 2023;10(28):e2302539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Du J, Chu Y, Hu Y, Liu J, Liu H, Wang H, et al. A multifunctional self-reinforced injectable hydrogel for enhancing repair of infected bone defects by simultaneously targeting macrophages, bacteria, and bone marrow stromal cells. Acta Biomater. 2024;189:232–53. [DOI] [PubMed] [Google Scholar]
  • 53.Zheng Z, Gan S, Yang S, Hou C, Zhu Z, Wang H, et al. Enhanced surface hydrophilicity improves osseointegration of titanium implants via integrin-mediated osteoimmunomodulation. J Mater Chem B. 2025;13(2):496–510. [DOI] [PubMed] [Google Scholar]
  • 54.Long G, Liu F, Cheng H, Guo J, Wang P, Luo Y, et al. miR-374-5p inhibits osteogenesis by targeting PTEN/PI3K/AKT signaling pathway. J Orthop Surg Res. 2025;20(1):283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Gao F, Xia SL, Wang XH, Zhou XX, Wang J. Cornuside I promoted osteogenic differentiation of bone mesenchymal stem cells through PI3K/Akt signaling pathway. J Orthop Surg Res. 2021;16(1):397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Jing WB, Ji H, Jiang R, Wang J. Astragaloside positively regulated osteogenic differentiation of pre-osteoblast MC3T3-E1 through PI3K/Akt signaling pathway. J Orthop Surg Res. 2021;16(1):579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Liu X, Chen R, Cui G, Feng R, Liu K. Exosomes derived from platelet-rich plasma present a novel potential in repairing knee articular cartilage defect combined with cyclic peptide-modified beta-TCP scaffold. J Orthop Surg Res. 2024;19(1):718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Chisari E, Rehak L, Khan WS, Maffulli N. The role of the immune system in tendon healing: a systematic review. Br Med Bull. 2020;133(1):49–64. [DOI] [PubMed] [Google Scholar]
  • 59.Scala P, Rehak L, Giudice V, Ciaglia E, Puca AA, Selleri C, et al. Stem cell and macrophage roles in skeletal muscle regenerative medicine. Int J Mol Sci. 2021. 10.3390/ijms221910867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Andia I, Atilano L, Maffulli N. Biological targets of multimolecular therapies in middle-age osteoarthritis. Sports Med Arthrosc Rev. 2022;30(3):141–6. [DOI] [PubMed] [Google Scholar]
  • 61.Yuan N, Zhang W, Yang W, Ji W, Li J. Exosomes derived from M2 macrophages prevent steroid-induced osteonecrosis of the femoral head by modulating inflammation, promoting bone formation and inhibiting bone resorption. J Orthop Surg Res. 2024;19(1):243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Giordano L, Porta GD, Peretti GM, Maffulli N. Therapeutic potential of microRNA in tendon injuries. Br Med Bull. 2020;133(1):79–94. [DOI] [PubMed] [Google Scholar]
  • 63.Oliviero A, Della Porta G, Peretti GM, Maffulli N. MicroRNA in osteoarthritis: physiopathology, diagnosis and therapeutic challenge. Br Med Bull. 2019;130(1):137–47. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are available from the corresponding author upon reasonable request.


Articles from Journal of Orthopaedic Surgery and Research are provided here courtesy of BMC

RESOURCES