CD43 expressed in Sertoli, Leydig and germ cells inhibits testicular function and represents a potential target to treat male infertility or effect male contraception

Abstract

CD43 is a heavily glycosylated transmembrane molecule that plays critical roles in leukocyte activation and adhesion. Previously, only hematopoietic cells were thought to normally express CD43. However, our immunohistochemical analysis of normal human testes demonstrates that the N-terminal domain of CD43 is expressed in the cytoplasm of Sertoli and Leydig cells while the C-terminal domain is expressed separately in the nucleus of Sertoli and germ cells. The observation that normal testicular cells express CD43 is entirely novel and indicates that testes function is controlled in ways not previously imagined. In order to begin to identify these CD43-dependent functions, CD43 expression was knocked down in the human germ cell line TCam-2. This knockdown changed the expression of both Transition Protein 1 and Acrosin consistent with spermatid maturation having been driven forward. In addition, down-regulation of CD43 in the mouse Leydig cell line MLTC-1 significantly induced its secretion of estradiol, testosterone and progesterone. Based on these data we propose that CD43 actively inhibits testicular function and its aberrant over-expression may contribute to male infertility. Therapeutics that induce such over-expression may represent a means of effecting male contraception.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12958-025-01410-2.

Introduction

CD43 is a type-Ia transmembrane molecule critical to leukocyte activation and adhesion [1–3]. The N-terminal extracellular region is a rod-like structure of 235 amino acids that is heavily glycosylated and extends 45 nm from the cell surface [4–6]. The transmembrane region comprises 23 amino acids and the intracellular region of 123 amino acids anchors the protein to the cytoskeleton by binding actin, ezrin, and moesin [4, 5, 7, 8].

CD43 has been described as a Janus molecule after the Roman god with two faces [2]. This analogy reflects the finding that CD43 can perform diametrically opposite functions. First, depending upon how it is engaged at the cell surface, CD43 can either induce or protect against leukocyte apoptosis [9–13]. Second, depending upon the status of leukocyte activation, CD43 can act either as an anti-adhesion barrier molecule or a pro-adhesion receptor [13–21].

While leukocytes are at rest, the length, bulk and strong negative charge of the extracellular domain of CD43 combine to inhibit adhesion and maintain leukocytes in the circulation [14–17]. During leukocyte activation, expression of CD43 is reduced by proteolysis and repression of its gene [22–28]. In addition, CD43 is excluded from foci of cell–cell contact [7, 16, 29–31]. Together, this down-regulation and redistribution of CD43 facilitate intercellular interaction effected by other leukocyte molecules such as the β2 integrins [29]. Furthermore, changes in glycosylation of the extracellular region allow the CD43 that remains at the cell surface to act as a pro-adhesive counter receptor for galectin-1, ICAM-1, E-selectin, sialoadhesin and MHC Class I [13, 16, 18–21, 30, 32, 33].

During leukocyte activation, cleavage of the extracellular domain triggers subsequent cleavage of the intracellular domain and its translocation to the nucleus where it protects against apoptosis and drives proliferation by binding β-catenin [22, 26, 34, 35]. In addition, the intracellular domain mediates activation signals by binding tyrosine kinases Fyn and Lck and the serine/threonine kinase STANK [36–39]. Activation signals transduced by CD43 can lead to phosphorylation of Shc, Syk, Lyn, Vav, PLCγ2, SLP-76, CD3ζ, PKM2, Bad and STAT3 [40–44]. These events result in activation of Lck, Fyn, Src, PI3 K, p38, MAPK and PKC, repression of the Ras inhibitor Cbl and translocation of ERK2 and ERK5 into the nucleus [43–48]. Ultimately the intracellular signaling cascades mediated by CD43 induce DNA-binding of AP-1, CREB, NFAT and NF-kB and increased expression of IL2, IL4, IL4R, IFNγ, IFNγR, CD69, CD40-L, c-MYC and CyclinD1 [34, 43, 48–50].

Historically, CD43 expression was reported to be restricted to leukocytes and platelets [1–3]. However, we and others have shown that CD43 is also expressed in lung, cervix, breast, colon and salivary gland cancers where it drives malignant progression [51–61]. During the course of an immunohistochemical screen of additional cancers we found malignant testicular tissue also expressed CD43. However, unexpectedly, we also found CD43 expression by apparently normal adjacent tissue. Cancer can change the gene expression profile of nearby normal tissue [62–64]. Consequently, we analyzed entirely normal testis tissue that had been resected from trauma victims. This tissue was also CD43-positive. The observation that normal human testes express CD43 is entirely novel and indicates that testicular function is controlled in ways previously unknown.

Methods

Patient material

A retrospective search was conducted of the de-identified files of the Gundersen Foundation BioBank and the Department of Pathology at Gundersen Medical Center, La Crosse, WI. Five cases of testicular cancer and three cases of accidental trauma to normal testis tissue were identified. Paraffin-embedded formalin-fixed tissue representing each type of case was sectioned, stained with haematoxylin and eosin and the histological diagnosis verified. All file searches and subsequent experimental procedures were approved by the Human Subjects Committee of Gundersen Health System, La Crosse, WI, USA.

Immunohistochemistry

Formalin-fixed paraffin-embedded blocks containing human testes tissue were serially sectioned at 4 μm and dried overnight on Colorfrost Plus microscope slides (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Next, sample slides were deparaffinised by a 60-min incubation at 60 °C followed by four changes of xylene, three changes of 100% ethanol, two changes of 95% ethanol and storage in tap water. One slide from each block was stained with haematoxylin and eosin Y. The remaining slides were subjected to a 20-min incubation at 90–100 °C in the presence of Epitope Retrieval Solution, pH 9 (Dako North America, Inc., Carpinteria, CA, USA). Next, the slides were rocked for 5 min at room temperature with tissue covered by the peroxidase blocking reagent of the EnVision System-HRP (DAB) (Dako North America, Inc.). A rocking incubation was then performed at room temperature for 30 min with Surfact-Amps X-100 (Thermo Fisher Scientific, Inc.). One slide from each block was rocked for 45 min at room temperature with either an IgG non-immune rabbit or mouse antibody diluted as recommended by the manufacturer (Epitomics, Inc., Burlingame, CA, USA). One slide from each block was identically incubated with either a 1: 2400 dilution of the rabbit polyclonal antibody SSGZ or a 1: 100 dilution of the mouse monoclonal antibody L10 that specifically recognize the C and N termini of CD43, respectively [60, 65]. Serial rocking incubations were next performed at room temperature for 30 min with labelled polymer-HRP anti-rabbit or anti-mouse, twice for 5 min with Wash Buffer and 5 min with DAB Chromogen (Dako North America, Inc.). Counterstaining was accomplished by dipping the slides in haematoxylin, rinsing with tap water, dipping in 1% glacial acetic acid, rinsing again in tap water and then dipping in 1% ammonium hydroxide. Rinsing in 100% ethanol then xylene dehydrated the tissue that was finally protected by glass coverslips mounted with Permount (Thermo Fisher Scientific, Inc.). Immunohistochemical analysis of the mouse Leydig cell line TM3 was undertaken by growing the cells on cell culture chamber slides and evaluating CD43 expression in the same way as the mouse monoclonal L10 but using the mouse monoclonal antibody DF-T1 that recognizes the N-terminal domain of mouse CD43 (GeneTex, Inc., Irvine, CA).

Cell culture

The human germ cell line TCam-2 was kindly provided by Dr. Sohei Kitazawa (Ehime University Graduate School of Medicine, Japan [66, 67]. They were cultured in RMPI1640 supplemented with 10% heat-inactivated fetal calf serum, 2 mM glutamine and 1% penicillin/streptomycin. The mouse Leydig cell lines TM3 (CRL-1714™) and MLTC-1 (CRL-2065™) were obtained from the American Type Culture Collection and grown according to their specifications (Manassas, VA, USA) [68, 69]. The growth medium for TCam-2 and MLTC-1 cells stably expressing shRNA was supplemented with 0.6 μg/ml and 6.0 μg/ml puromycin, respectively. All cultures were grown in a tissue culture incubator that maintained a humidified atmosphere of 5% carbon dioxide at 37 °C.

Generation of cell lines stably expressing shRNA

The control cell line TCam-43(+) was generated by transfection of the human germ cell line TCam-2 with the linearized plasmid pRFP-C-RS expressing shRNA with the ineffective target sequence GCACUACCAGAAGCUAACUCAGAUAGUACU (OriGene Technologies, Inc., Rockville, MD). The CD43-targeting cell line TCam-43(-) was generated by transfection of TCam-2 with a mixture of four linearized pRFP-C-RS plasmids expressing shRNA binding human CD43 mRNA at the coding-strand sequences ACACCGUGACAGGUGGAACCAUAACAACG, ACGCUCACCACUUUCUUUGGCAGACGGAA, GAGCCAACAACCUACCAGGAAGUUUCCAU and UGGCAACUGACUCUCUGGAGACCUCCACU. Stable expression of the control and CD43-targeting plasmids was selected with 0.6 μg/ml puromycin. The mouse Leydig cell line MLTC-1 was transfected with a linearized pRS plasmid expressing a non-effective shRNA cassette with the target coding-strand sequence GCACUACCAGAAGCUAACUCAGAUAGUACU (OriGene Technologies, Inc.). Stable expression of this plasmid was selected by 6.0 μg/ml purocmycin to generate the cell line MLTC-43(+). MLTC-1 was also transfected with a mixture of four pRS plasmids expressing shRNA targeting mouse CD43 mRNA at the coding-strand sequences CUCUGUGGCUACAACAGUAAGCUCCAAGA, CAUAUCACAGCUCCAAGUACCUCUGAAGC, CAACUUCUGACGGUCCACAAGCCAAAGAU and CACAGCAACCAGUUCUGUGGAGAGUUCCA (OriGene Technologies, Inc.). Stable expression of these plasmids was selected by 6.0 μg/ml puromycin to generate MLTC-43(-).

Enzyme linked immunosorbant assays

Cultures of the daughter cell lines MLTC-43(+) and MLTC-43(-) were established, harvested by trypsinization and resuspended in 50 ml of growth medium. The number of cells per ml was determined by counting on a hemocytometer and 1 × 10⁶ of each line was seeded separately in 30 ml of identical growth medium. After 24 h the growth medium was harvested, cleared by centrifugation and estradiol, testosterone and progesterone levels measured by the clinical laboratory of Gundersen Health System, La Crosse, WI using enzyme linked immunosorbant assays (ELISA). This laboratory is certified by the Clinical Laboratory Improvement Amendments of 1988 (CLIA).

Results

CD43 is expressed in normal human testes

During an immunohistological screen of testicular cancers we observed CD43 expression not only by malignant cells but also by apparently normal cells. In order to confirm CD43 expression in normal human testes we analyzed non-malignant tissue that had been resected from patients who had suffered accidental trauma (Fig. 1). This analysis demonstrates that the N-terminus of CD43 is expressed in the cytoplasm of normal Sertoli and Leydig cells while the C-terminus is expressed in the nucleus of normal Sertoli cells, spermatogonia and pachytene spermatocytes but absent from spermatids. Therefore, as germ cells differentiate, CD43 appears to be progressively down-regulated. Also, since the patterns of N and C terminal expression do not overlap, these domains seem to exist in testes as separate entities analogous to what occurs during normal leukocyte activation and breast cancer [22, 26, 34, 35, 61]. Further analysis indicates that testicular CD43 is found in spherical cytoplasmic and punctate nuclear structures (Fig. 2).

Fig. 1.

CD43 expression in normal human testis. Immunohistochemistry using antibodies L10 and SSGZ that bind, respectively, the N and C terminus of CD43 [60, 65]. Leydig cells (Ly), Sertoli cells (Sr), spermatids (ST) pachytene spermatocytes (PS), spermatogonia (Sp) and myoid cells (My) are annotated

Fig. 2.

Cytoplasmic and nuclear expression of CD43. Immunohistochemistry using antibodies L10 and SSGZ that bind, respectively, the N and C terminus of CD43 [60, 65]. Pachytene spermatocytes (PS) and increasingly mature spermatids (STa-c) are annotated

CD43 inhibits human germ cell differentiation

In order to begin to determine the function of CD43 in the testis we generated two daughter lines from the human germ cell line TCam-2 [66, 67]. The first daughter, named TCam-43(+), stably expresses a scrambled ineffective shRNA and the second, named TCam-43(-), stably expresses four shRNAs complementary to different regions of CD43 mRNA (OriGene Technologies, Inc., Rockville, MD). Western blotting demonstrated that CD43 expression was effectively knocked-down in TCam-43(-) compared to TCam-43(+) (Fig. 3). This down-regulation mimics CD43 repression observed during germ cell differentiation in vivo (Figs. 2 and 3). CD43 repression appears a driver of germ cell differentiation as it causes an increase in the molecular weight of Transition Protein 1 (TNP1) and changes in Acrosin expression (Fig. 3). The increase in TNP1 molecular weight is consistent with CD43 repression inducing post-translational modifications such as serine phosphorylation, arginine or lysine methylation and/or lysine acetylation. These modifications target TNP1 for complete replacement with protamines that allow formation of highly condensed chromatin in mature sperm [70–74]. Changes in Acrosin expression include a shift to a lower molecular weight form consistent with the processing of Preproacrosin to Proacrosin and a shift from cytoplasmic to nuclear expression consistent with translocation from the golgi apparatus to the acrosome cap of the mature sperm nucleus [75–77].

Fig. 3.

CD43 repression drives molecular events characteristic of germ cell differentiation. The human germ cell line TCam-2 was transfected with a linearized plasmid expressing a non-effective shRNA cassette (OriGene Technologies, Inc.). Stable expression of this plasmid was selected by purocmycin to generate the cell line TCam-43(+). TCam-2 was also transfected with a mixture of four plasmids expressing shRNA targeting human CD43 mRNA at 4 separate coding-strand sequences (OriGene Technologies, Inc.). Stable expression of these plasmids was selected by puromycin to generate TCam-43(-). Upper Panels: Total protein extracts were prepared from TCam-43(+) and TCam-43(-) and subjected to western blotting using the anti-CD43 antibody SSGZ [60], the anti-TNP1 antibody LS-C81760 (LifeSpan BioSciences, Inc., Seattle, WA) and the anti-Acrosin antibody ab125362 (Abcam, Inc., Cambridge, MA). The two proteins detected with anti-Acrosin are consistent with Preproacrosin (PP.Acrosin) and Proacrosin (P.Acrosin). Lower Panels: Cytoplasmic and nuclear protein extracts were prepared separately and analyzed with anti-Acrosin as above. Antibodies to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and TATA-binding protein (TBP) were used to control for gel loading. Uncropped western blot images are presented in Supplementary file 1

CD43 inhibits hormone secretion from mouse Leydig cells

Immunohistochemical analysis demonstrates that CD43 is expressed in human testicular cells in vivo (Figs. 2 and 3). Analysis of TCam-2 demonstrates this expression is mimicked in a human germ cell line where it inhibits differentiation (Fig. 3). Next we sought to determine if testicular CD43 expression is evolutionarily conserved. This we demonstrated by immunohistochemical analysis of the mouse Leydig cell line TM3 (Fig. 4) [68]. Mimicking human Leydig cells in vivo, the N-terminal domain of TM3 CD43 is expressed in the cytoplasm and in vesicle-like structures.

Fig. 4.

The N-terminus of CD43 is expressed in the cytoplasm of mouse Leydig cells. The mouse Leydig cell line TM3 was grown on cell culture chamber slides then subjected to immunohistochemical analysis using a non-immune IgG control antibody or the mouse monoclonal antibody DF-T1 that recognizes the N-terminal domain of mouse CD43 (GeneTex, Inc., Irvine, CA) [78, 79]

In order to begin to determine the function of CD43 in mouse Leydig cells we generated two daughter lines from the mouse Leydig cell line MLTC-1 [69]. The first daughter, named MLTC-43(+), stably expresses a scrambled ineffective shRNA and the second, named MLTC-43(-), stably expresses four shRNAs complementary to different regions of mature CD43 mRNA (OriGene Technologies, Inc., Rockville, MD). When the culture media conditioned by these daughter lines was analyzed, CD43 repression was found to induce estradiol, testosterone and progesterone secretion by 32%, 60% and 53%, respectively (P < 0.01) (Fig. 5).

Fig. 5.

CD43 repression induces steroid hormone secretion from mouse Leydig cells. Actively proliferating cultures of MLTC-43(+) and MLTC-43(-) were established, harvested and 1 × 10⁶ of each seeded separately in 30 ml of identical growth medium. After 24 h the growth medium was harvested, cleared by centrifugation and estradiol, testosterone and progesterone levels measured by ELISA (n = 3)

Discussion

Immunohistochemical analysis of the human testis demonstrates that the N-terminal domain of CD43 is expressed in the cytoplasm of Sertoli and Leydig cells while the C-terminal domain is expressed separately in the nucleus of Sertoli and germ cells (Figs. 1 and 2). The mechanisms by which these CD43 moieties are generated are unknown. At the RNA level possible mechanisms include the use of alternative transcription initiation sites [80–82], various forms of RNA editing [83–92], differential splicing [93–99] and/or the utilization of alternative polyadenylation signals [100–102]. At the protein level differential expression of the N and C terminals of CD43 could be caused by the use of alternative translation initiation and termination signals [103–106] and/or proteolytic cleavage events [22, 25, 26, 34, 35, 107–112]. In addition, like leukocyte CD43, testicular function of CD43 could be controlled by differential glycosylation [13, 16, 17, 30, 32, 33, 112–120], sumoylation [22, 121, 122] and/or subcellular localization [22, 123–125].

The N-terminal domain of CD43 is expressed in punctate structures within the cytoplasm of Sertoli and Leydig cells while the C-terminal domain is expressed in punctate structures within the nucleus of Sertoli and germ cells (Fig. 1). In leukocytes CD43 can localize to exosomes, endosomes, microvesicles, vacuoles and PML nuclear bodies [22, 123–125]. Furthermore, breast cancer cells secrete CD43 in exosomes [64]. Similar entities likely represent the punctate structures that harbor CD43 in testicular cells. The functional role played by CD43 in these structures remains to be determined.

The function of Leydig cells is controlled in large part by luteinizing hormone (LH), an intrinsic circadian clock and crosstalk secretions with Sertoli and germ cells [126–146]. Major control of Sertoli cell function is exerted by follicle-stimulating hormone (FSH) and crosstalk secretions with Leydig and germ cells [142–163]. Germ cell differentiation is dependent upon crosstalk secretions with Leydig and Sertoli cells and can be mimicked in vitro by the combined action of epidermal growth factor (EGF), fibroblast growth factor-4 (FGF-4), transforming growth factor-β (TGF-β) and bone morphogenetic protein-4 (BMP-4) [160–172]. With regard to the endocrine, paracrine and circadian control of testicular CD43 gene expression, it is important to note that the nucleotide sequences of the promoter regions of the human and mouse CD43 genes are evolutionally conserved and both contain elements that could confer circadian transcription by binding CLOCK:BMAL1 and members of the REV-ERB and ROR nuclear receptor families (Fig. 6) [173–183]. In addition, it is intriguing that in both the mouse and human genome the CD43 gene overlaps or is closely linked with the genes encoding epididymis secretory sperm binding protein Li 90n and zymogen granule protein 16 implicated in sperm capacitation [184–190].

Fig. 6.

Evolutionary conservation of the human and mouse CD43 gene promoters. Nucleotide sequences of the proximal promoter regions of the human and mouse CD43 genes. The most 5’ major transcription initiation site for each gene is marked with a vertical arrow [191, 192]. The know locations of binding by Sp1, MeCP2 (Me), Purα and hnRNP-K in the human gene and sequences that conform to their consensus binding sites in the mouse gene are indicated by filled ovals [27, 28, 193–196]. Closely spaced repeats of E-box and E-box-like (E’) elements that potentially bind the CLOCK:BMAL1 heterodimer to effect circadian transcription are indicated by blue text [173, 174]. Adjacent CT-rich elements conferring robust binding of CLOCK:BMAL1 are indicated by pink text [175]. RORE boxes that potentially mediate circadian transcription by binding members of the REV-ERB and ROR nuclear receptor families are indicated in red text [176–183]

CD43 expression represents new biology for the human testes with potential implications for the development of new approaches to the treatment of male infertility. In about one third of cases the etiology of male infertility remains unknown and is termed idiopathic male infertility [197]. Despite the fact that these men have no history of diseases affecting fertility and show normal findings in physical examinations and endocrine, genetic and biochemical laboratory testing, their semen analysis often reveals abnormal semen parameters. In addition, patients with idiopathic male infertility often exhibit germ cell aplasia or Sertoli cell-only syndrome (SCOS) [198–201]. This condition is characterized by severely reduced or absent spermatogenesis despite the presence of both Sertoli and Leydig cells. It will be of interest to determine if idiopathic male infertility is characterized by abnormal testicular expression of CD43. If this proves to be the case, correction of such abnormal expression would represent a novel therapeutic strategy. Conversely, drugs causing a pattern of CD43 expression mimicking that in idiopathic male infertility would represent a novel means of male contraception.

Semen analysis is the test of choice for assessing the male partner in an infertile couple [202]. However, a major limitation of semen analysis is its emphasis on sperm evaluation over the characterization of seminal plasma that represents 95% of the ejaculate [203]. Seminal plasma is constituted by secretions derived from the testes, epididymis, seminal vesicles and the prostate as well as the bulbouretheral and periurethral glands [203]. Analysis of human seminal plasma has begun to yield biomarkers for male fertility and infertility [203–216]. Most proteins in seminal plasma bind to the sperm surface through exosomes where they modulate sperm function, interaction with the female reproductive tract and finally fertilization [203, 217–231]. CD43 has been found in exosomes secreted by breast cancer endothelium [64]. In addition, the N-terminal domain of leukocyte CD43 can be shed into blood plasma where it is know as galactoglycoprotein [107]. These findings indicate that CD43 moieties likely form constituents of seminal plasma and alterations in their expression could represent noninvasive biomarkers of male infertility. In this regard it is also important to note that male mice where the CD43 gene has been knocked-out are fertile [232]. Consequently, male infertility is likely to be characterized by the abnormal presence not absence of CD43.

Conclusions

We report for the first time that CD43 is expressed in normal human testes. During germ cell differentiation CD43 is down-regulated driving changes in the expression of both Transition Protein 1 and Acrosin consistent with spermatid maturation. In addition, down-regulation of CD43 in Leydig cells induces secretion of steroid hormones. The exact molecular mechanisms by which CD43 effects these changes in germ and Leydig cells remains to be determined. Nevertheless, based on our current data, we tender the hypotheses that CD43 actively inhibits testicular function, its aberrant expression may contribute to male infertility and manipulation of its expression may represent new means of treatment and contraception. In addition, specific patterns of CD43 expression in the seminal plasma could predict the success of conventional in vitro fertilization or intracytoplasmic sperm injection. Embryo transfer during assisted reproduction is significantly improved by exposure to seminal plasma [233, 234]. Consequently, targeting molecular defects in seminal plasma CD43 might have therapeutic benefit.

Authors’ contributions

C.S.S. performed the research, wrote the main manuscript and prepared all the figures. Q.F. performed the research. Both authors reviewed the manuscript.

Funding

The funds for the reported research were provide by Gundersen Health System, La Crosse, Wisconsin, USA.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Archived de-identified human tissue was analyzed by immunohistochemistry as approved by the human ethics committee of Gundersen Health System, La Crosse, Wisconsin, USA.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.