Exploring novel resistant sources for chilli leaf curl disease in Capsicum annuum L. germplasm for genetic enhancement

Abstract

Chilli, as a vegetable and spice, is an important constituent of Indian food. The major constraint that hampers chilli production is Chilli leaf curl disease (ChiLCD). It often leads to heavy yield losses as a result of which the farmers do not prefer chilli cultivation. Therefore, the present investigation has been undertaken to screen and evaluate chilli germplasm conserved in National genebank of India and identify lines resistant to ChiLCD. We screened 500 chilli accessions for four consecutive years (2021–2024) to identify the resistant lines. In the 2021 screening, 16 accessions were found highly resistant, 40 resistant, 33 moderately susceptible, 23 susceptible, and 388 highly susceptible. Accessions showing symptoms of Chilli leaf curl disease in each season were discarded, whereas resistant accessions were retained for repeated screening. From the advanced screening and validation during 2022–2024, some promising accessions were identified as EC771555, IC643853, EC772795, EC787119, EC769427, and IC607252 which maintained low disease incidence (≤ 5% PDI) and severity score one. Another 28 accessions were found resistant to ChiLCD. Quantitative PCR also confirmed very low viral titres (0.1-0.3-fold) in resistance accessions. The identified promising accessions can be used as donors in chilli improvement programs to develop resilient varieties that express good yield and quality under high disease pressure, reducing reliance on chemical controls. They also offer genetic resources for studying resistance mechanisms and molecular markers development for sustainable agriculture which leads to reduced production costs.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-23977-x.

Introduction

Chilli pepper (Capsicum annuum L.), an often cross-pollinated, diploid (2n = 2x = 24) annual belonging to the family Solanaceae, is a spice as well as an important vegetable crop grown worldwide. Peppers have a variety of uses which are eaten as a vegetable and used as a colorant and flavouring agent in various food industries. In addition, they are also popular in the pharmaceutical industry because of their herbal ingredients. Chilli peppers originated from the Andes Mountains region in South America, where they were first domesticated approximately 8,000–10,000 years ago¹. Now they are grown in almost all parts of the world. India is the largest producer, consumer, and exporter of chilli in the world. It is grown over an area of 411 thousand hectares, with a production of 4,363 thousand metric tons of chilli-green. For dried chilli, the area under cultivation was 702 thousand hectares, with a production of 2,049 thousand metric tons in the year 2020-21 (https://www.agricoop.gov.in). As per the Spices Board, Ministry of Commerce and Industry, Government of India, provisional estimates for the year 2023-24 indicate that chilli exports have a share of 33.81% of the total exports. The estimated economic value generated from these exports is 124,924.85 million rupees (https://www.indianspices.com/).

Although chilli peppers are generally resilient, their production is often restricted by a variety of biotic stresses, including pathogens like fungi, bacteria, and viruses, as well as insect pests, with viruses acting as the major global constraint. Currently, nearly 75 viruses have been documented to infect chilli peppers, 37 of which are recognized species and 6 tentative species according to the International Committee on Taxonomy of Viruses^2,3. Begomoviruses have recently emerged as an increasing concern for the cultivation of this spice crop in India^4,5. Of these begomoviruses, chilli leaf curl is the predominant disease. The begomoviruses genome is composed of circular ssDNA, encoding either monopartite (mostly DNA-A-like) or bipartite (two components, DNA-A and DNA-B), each ranging from 2.5 to 3 kb in size. The primary regions in Old World regions—Asia, Africa, and Europe—are monopartite, though there are some exceptions. In contrast, in New World regions such as North America and Latin America, bipartite genomes are predominant⁶. Southwest Asia is unique because both types are found there.

ChiLCD was first described from the Jodhpur district of Rajasthan state in India by Senanayake et al., (2007)⁷. It is a complex disease infected by numerous begomoviruses in India, particularly Chilli leaf curl virus (ChiLCV), Chilli leaf curl India virus (ChiLCINV), Chilli leaf curl Vellanad virus (ChiLCVV), Tomato leaf curl Joydebpur virus (ToLCJV), Tomato leaf curl Bangalore virus (ToLCBaV), Tomato leaf curl Palampur virus (ToLCPalV) and Tomato leaf curl New Delhi virus (ToLCNDV)^7–10. Chilli leaf curl disease manifests through distinct symptoms that compromise the health of Capsicum annuum plants, including leaf curling, crinkling, cupping, puckering, chlorosis, reduction in leaf area, enation, dense foliage, plant stunting, and reduced fruit size, making them unsuitable for marketing. These symptoms not only diminish the aesthetic appeal of plants but also significantly reduce their yield potential. In severe infections, plants fail to produce any fruit, leading to a complete loss of yield of up to 100%, forcing farmers to refrain from chilli cultivation^11–13. Whiteflies (Bemisia tabaci L.) are major vectors for the transmission of begomoviruses. They persistently transmit the virus after successful acquisition with an incubation period of a few hours to days¹⁴. Besides being vectors, whiteflies are also sucking pests that directly damage plants by reducing their photosynthetic efficiency. Their nymphs excrete honeydew, leading to the growth of sooty mold, which further diminishes photosynthesis. The recent surge in whitefly populations has been identified as a significant factor contributing to ChiLCD epidemics in recent years¹⁵.

Insecticide treatment has been the traditional method of controlling whitefly vectors in ChiLCD management. However, use of pesticides is more costly and less effective for farmers, putting consumers and the environment at risk¹⁶. Furthermore, the export of chilli is restricted by pesticide residues. In addition, using pesticides to eliminate whitefly vectors is frequently ineffective because they are typically applied after symptoms start to show, which may already be too late for the virus to spread². Given the economic importance of chilli as a crop worldwide and the current state of affairs where disease outbreaks, climate change, and population growth pose growing threats to food security, it is critical to find new sources of resistance to the rapidly evolving begomoviruses in chilli peppers. Since the inception of crop improvement programs germplasms have contributed new genes, making them a critical resource for future food security. In this situation, enhancing the genetic resistance of chilli to ChiLCD is essential. The most efficient, dependable, and economical way to treat viral infections at the moment is host plant resistance¹⁷. Resistance genes must be found and introduced through resistance breeding, even if producing ChiLCD-resistant cultivars is difficult. In the present study, we aimed to screen several chilli genotypes to identify chilli leaf curl disease resistant genotypes which can be used in breeding programs to develop new resistant cultivars for both open fields and protected cultivation conditions.

Methodology

Source of chilli germplasm

The materials for the present study consisted of 500 diverse chili pepper germplasm accessions obtained from the National Genebank of India, ICAR-NBPGR, New Delhi. These accessions were randomly selected from the entire lot available at NBPGR, specifically focusing on major chilli-growing regions where ChiLCV is widespread. The collection comprised 399 indigenous accessions representing material from 27 states and three union territories of India, along with 101 exotic accessions procured from Taiwan, the United States of America, Hungary, Guatemala, China, Spain, the United Kingdom, Brazil, Bulgaria, Peru, and Thailand (Fig. 1A & B). Three susceptible checks, viz. Pusa Jwala, Kashi Anmol and LCA334 were also used.

Fig. 1.

Geographical distribution of chilli germplasm accessions based on passport data. (A) World map showing exotic collection from 11 countries. (B) Map of India illustrating distribution across 30 states. Both maps were created by the authors using R version 4.4.1 software and are original, not adapted from any external source.

Experimental location and screening time

The experiments were conducted at the research farm of ICAR-NBPGR, New Delhi, which experiences an overlap of monsoon-influenced humid subtropical and semi-arid climates. Two chilli pepper crops can be cultivated each year during the summer (Zaid) and Kharif seasons at New Delhi. At the time, whitefly populations are generally on the increase, attaining their peak at the fruiting stage¹⁸. In contrast, whitefly populations peak during the early phases of growth and flowering during the Kharif season. ToLCJV, ToLCNDV, and ChiLCV are the main chilli viruses that infect plants at this location with ChiLCV being the most frequently detected in diseased samples¹⁸. The vector associated with these viruses in India is Bemisia tabaci Asia II 1¹⁹.

Experimental design and disease scoring

Five hundred chilli accessions were screened for ChiLCD in Augmented Block Design consisting of 20 blocks under natural disease incidences in the Kharif season, 2021. In each block, 25 accessions and three susceptible check varieties (Pusa Jwala, Kashi Anmol, and LCA334) were planted. The check varieties were planted randomly after every seven accessions. Ten plants of each accession were planted in two rows, each 3 m long, with 60 cm spacing between rows and 45 cm between plants within each row. Border rows were planted with susceptible checks to increase disease pressure. Observations on symptom expression were recorded at one-week intervals following infestation. Disease response for each accession were assessed at 30-, 60-, 90- and 120-days post-transplanting using a symptom severity scale ranging from 0 to 5, as described by Banerjee and Kalloo²⁰ (Table 1). Standard agronomic practices were adhered throughout the cropping period. Disease reaction was assessed for all plants in each accession under test, with ten plants scored per accession. The percent disease incidence (PDI) was calculated using the following formula, as described by Srivastava et al.¹⁸

Table 1.

Symptom severity grade on a 0–5 scale for ChiLCD given by Banerjee and Kalloo²⁰.

Score	Description	Disease reaction and code
0	0 indicates no symptoms	Symptomless/immune, SL
1	Up to 5% curling and clearing of upper leaves	Highly resistant, HR
2	6–25% curling, clearing of leaves and swelling of veins	Resistant, R
3	26–50% curling, puckering and yellowing of leaves, and swelling of veins	Moderately susceptible, MS
4	51–75% leaf curling, stunted plant growth and blistering of internodes	Susceptible, S
5	> 75% curling and deformed small leaves, stunted plant growth with small flowers and no or small fruit set	Highly susceptible, HS

Confirmation of disease resistance response

On the basis of preliminary screening results of the disease reaction in the cropping season, 2021, accessions showing resistant, highly resistant and few susceptible reactions were selected for further evaluation in the summer and Kharif seasons of 2022 in the same farm area under natural epiphytotic conditions. For further validation, the accessions were subsequently planted during summer and Kharif seasons of 2023, and the summer season of 2024 in ABD design as mentioned in the section “Experimental design and disease scoring”.  The accessions identified as highly resistant after multi-season and multi-year evaluations and validation, along with a few highly susceptible accessions and checks, were validated in controlled conditions under challenged inoculation with viruliferous whiteflies in the summer season of 2024. For challenge inoculation five viruliferous white flies were released on each of the test plant following Mangal et al. (2024) and the symptoms were recorded at seven, 14, 21, and 35 days after challenge inoculation, and PDI was calculated.

Detection of the presence of virus and viral titer Estimation

As ChiLCV is the predominant virus causing chilli leaf curl disease at the location of the experiment site²¹, chilli accessions were screened for the presence of virus using ChiLCV-specific primers and q-PCR was conducted to estimate viral titres in the accessions under study. Leaf samples from the selected accessions were collected for DNA extraction because begomoviruses are ssDNA viruses. Genomic DNA was extracted from the young leaf tissue (the top four leaves) of each germplasm accession following the CTAB method²². Viral titers were quantified using a relative quantification approach, wherein plant samples from Kashi Anmol were used as calibration samples. Three biological replicates per accession were used, and Ca-actin served as the housekeeping gene²³. Primers for the estimation of viral titer were designed from the AC1/AC4 region of the ChiLCV genome. The sequences of the internal control actin were forward primer 5′ GAAGCTCAATCCAAACGTGGTATT 3′ and reverse primer 5′ CTCAAACATGATTTGTGTCATC 3′. Three technical replicates were run in real-time PCR to account for pipetting errors. For qRT-PCR, 5 µL of SYBR Green master mix (Applied Biosystems, CA, USA), 3 µl nuclease-free water, and 1 µl (200 nm) each of forward and reverse primers for the desired gene were used. The PCR program consisted of an initial denaturation at 94 °C for 5 min, 40 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 35 s, and extension at 72 °C for 35 s. The ΔCt value of the target gene was normalized to that of internal control, β-actin. ΔΔCt values were used to plot the graph to obtain the relative titer of the virus in plants with different percent disease incidence values.

Statistical analysis

The data recorded on all accessions were used for identification of genotypes as resistant or susceptible based on the disease scoring described in section “Experimental design and disease scoring”. The Wilcoxon signed-rank test, a non-parametric test, was performed using IBM^®SPSS^® version 17 statistical software²⁴. A test was conducted on paired samples to evaluate the null hypothesis (H0) with a significance level of α = 0.05. H0 states that there was no difference in the percent disease incidence of ChiLCD between the two validation screenings conducted under natural conditions in Kharif 2023 and the summer of 2024.

Results

Preliminary screening of chilli germplasm for resistance to ChiLCD

In this study, we have preliminarily screened 500 chilli accessions under natural epiphytotic conditions for resistance to ChiLCD in order to assess disease reaction. The results revealed significant disease incidence during Kharif season, 2021 with considerable variations among the accessions for disease reactions. The susceptible chilli accessions manifested various symptoms including leaf curling, vein banding, reduction in leaf size, leaf cupping, leaf crowding, and plant stunting (Fig. 2). On the basis of screening with PDI values, 16 accessions were highly resistant, 40 resistant, 33 moderately susceptible, 23 susceptible, and 388 highly susceptible. No accession was immune or symptomless against the disease (Supplementary Table S1; Fig. 3). Graphical representation of germplasm on severity scale was observed to be largely skewed with most accessions classified as highly susceptible (Fig. 3).

Fig. 2.

Symptoms of ChiLCD (A) healthy plant, (B) leaf size reduction and puckering, (C) upward curling, (D) crowding and cupping of leaves (E) plant stunting, (F) Field view, (G) Vein banding.

Fig. 3.

Classification of 500 chilli germplasm accessions based on ChiLCV disease reaction from Summer 2021 preliminary screening and their percent share. HS: highly susceptible, S: susceptible, MS: moderately susceptible, R: resistance, I: Immune.

Multi-cycle screening for validation of disease resistance

Based on the preliminary screening during 2021, 56 accessions including 16 highly resistant and 40 resistant, 7 highly susceptible accessions along with three susceptible checks were selected for further screening during the summer and Kharif seasons of 2022. Of the 16 highly resistant accessions screened, 6 (EC771555, IC643853, EC772795, EC787119, EC769427, and IC607252) expressed high level of resistance with PDI values ranging from 0 to 4.34% and the remaining 10 highly resistant accessions exhibited a resistant reaction with PDI values varying from 5.6 to 25.0. Out of those 40 resistant accessions, 21 accessions maintained consistently resistant reactions, 13 became moderately susceptible, and 6 turned out to be susceptible at the time of completion of the advanced screening (Table 2). All the highly susceptible accessions and checks revealed highly susceptible reactions having PDI values ranging from 75 to 100%.

Table 2.

Percents the disease incidence of ChiLCV and basic passport information for promising Chilli germplasm identified from the screening of 500 Chilli accessions from 2021 to 2024, assessed at 120 days after transplanting.

PS = Preliminary screening; PDI = Average percent disease incidence (%); DR = Disease reaction; HR = Highly resistant; R = Resistant; MS = Moderately susceptible; S = Susceptible; HS = Highly susceptible Flower colour = 1-White; 4-yellow green; 5-purple with white base; 6-white with purple base; 8-purple; Fruit colour = 3-green; 5-purple; Fruit shape = 1-elongated; 2-round; 3-trangular; 4-companulate; 5-blocky. * The grey shaded portion indicates chilli germplasm excluded based on their susceptible response in previous season(s).

Validation of chilli accession for ChiLCD

Thirty-seven resistant genotypes comprising six highly resistant and 31 resistant lines from the second stage of screening along with a few highly susceptible genotypes and susceptible checks were validated over two consecutive years during the summer and Kharif seasons of 2023 and the summer season of 2024. All six highly resistant accessions viz., EC771555, IC643853, EC772795, EC787119, EC769427, and IC607252 consistently maintained high level of resistance to ChiLCD which can be utilized in chilli crop improvement programs as donors. Out of 31 resistant accessions, five accessions, IC634639, IC634642, IC630352, IC642177, and EC787126 became moderately susceptible and the remaining 26 accessions consistently demonstrated resistance to ChiLCD during validation period (Table 2; Fig. 4).

Fig. 4.

Validation screening for ChiLCD under natural conditions (A) EC771555- Highly resistant; (B). Accession IC643853 - Highly resistant;

The statistical analysis verified whether the per cent disease incidence results from Kharif 2023 and summer 2024 are significantly different. Using the Wilcoxon Signed-Rank test on 43 paired accessions; the obtained p-value was 0.088 greater than the significance level of 0.05 (Table 3). This implies that the two seasons are statistically non-significant. Consequently, we fail to reject the null hypothesis, which states that the median difference in disease incidence between Kharif 2023 and Summer 2024 is zero. Further, the coefficient of determination (R²) gives a measure on how much the variation in PDI values for Kharif 2023 and Summer 2024 reflects the uniformity of reaction of germplasm to chilli leaf curl disease. The presence of an R² value at 0.9958 reveals a strong correlation (p < 0.001) in the trend (Fig. 5). However, the p-value is close to 0.05, suggesting a trend towards significance, which may warrant further investigation with a larger sample size or under controlled experimental conditions. The high number of ties (15 out of 43 genotypes) suggests similar disease responses across seasons, indicating that genotypic effects are more dominant and stable than seasonal variation. While seasonal factors may contribute, their influence was not statistically consistent in this dataset. This will be addressed in the continuation of our multilocation trials.

Table 3.

Summary of Wilcoxon signed rank test for Kharif 2023 - summer 2024 disease screening under natural conditions.

		N	Mean rank	Sum of ranks
Kharif 2023 - summer 2024	Negative ranks	10	2.216	22.16
	Positive ranks	18	2.666	47.99
	Ties	15
	Total	43
Standard Deviation: 36.0
Standardized Test Statistic: 128.0
Asymptotic Significance (2-sided test): 0.088*

* = The significance level is 0.05.

Fig. 5.

Correlation of ChiLCD Percent Disease Incidence (PDI) between Kharif 2023 and summer 2024 under natural conditions.

Artificial screening for validation

Finally, six accessions EC771555, IC643853, EC772795, EC787119, EC769427 and IC607252 identified as highly resistant, were brought into further artificial screening with challenged inoculation along with a few highly susceptible accessions and checks (Fig. 6). In this test, all the six accessions recorded a PDI value ranging from 0 to 2% and demonstrated a high resistance reaction to ChiLCD (Table 4). These results fit in and match with those that underwent advanced evaluation and validation under natural epiphytotic conditions. Indeed, the six accessions consistently showed high level of resistance to ChiLCD, whereas all highly susceptible accessions and the three checks exhibited susceptible reactions.

Fig. 6.

Challenge inoculation of chilli germplasm for ChiLCD validation during summer 2024. A. Screening of germplasm under insect-proof cages, B-D. Symptoms observed in susceptible accessions (B. leaf puckering C. crowding of leaves and D. Leaf curling), E-G healthy resistant accessions.

Table 4.

Percent disease incidence (PDI) of Chilli germplasm to ChiLCD after challenge inoculation with the ChiLCV under artificial conditions.

N.	Accession	7 D	14 D	21 D	35 D	Disease score	Disease reaction
1	EC771555	0	0	2.00	2.00	1	Highly resistant
2	IC643853	0	0	0	0	1	Highly resistant
3	EC772795	0	0	0	1.0	1	Highly resistant
4	EC787119	0	0	1.00	2.00	1	Highly resistant
5	EC769427	0	0	0	0	1	Highly resistant
6	IC607252	0	0	0	0	1	Highly resistant
7	EC402117	53.66	74.56	83.00	100.00	5	Highly susceptible
8	IC644156	72.34	97.86	100.00	100.00	5	Highly susceptible
9	IC642940	62.56	96.67	100.00	100.00	5	Highly susceptible
10	EC391080	58.33	75.00	100.00	100.00	5	Highly susceptible
11	Kashi Anmol	47.67	95.00	100.00	100.00	5	Highly susceptible
12	Pusa Jwala	60.15	96.67	100.00	100.00	5	Highly susceptible
13	LCA334	53.25	90.00	100.00	100.00	5	Highly susceptible

N = serial number; D = number of days after inoculation.

Detection of virus presence and estimation of viral titer load

The results proved that the accession IC642940 was the most susceptible, with the highest relative viral load of 90774.5-fold, followed by IC644156 (3956.5-fold), and EC772791 (12.8-fold). On the other hand, IC643853 was the most resistant accession since no detectable viral load recorded on it. There were some other highly resistant accessions where viral titers ranged from 0.1 to 0.3-fold, included IC607252 (0.1-fold), EC771555 (0.2-fold), EC772795 (0.2-fold), EC769427 (0.2-fold), and EC787119 (0.3-fold). The susceptible accessions were EC391080 (7.3-fold), EC402117 (3.9-fold) 522 Tripura (2.7) and EC354890 (1.1-fold). The checks Kashi Anmol, Pusa Jwala and LCA334 gave relatively high viral loads at 1.0 to 1.4-fold, indicating their susceptibility to ChiLCD (Fig. 7).

Fig. 7.

Relative viral titre in various chilli germplasm against chilli leaf curl virus (ChiLCV).

Discussion

Chilli leaf curl disease (ChiLCD) infected by ChiLCV has emerged as a significant barrier to chilli production in all its growing areas. For instance, due to the synergistic potential relationships between begomoviruses, rapid expansion of new viruses and strains results from genetic recombination added to an acquisition of additional DNA components. These emerging strains may efficiently overcome the known gene or QTL configurations determine the host plant resistance in chilli²⁵. Thus, it is crucial to identify genetic sources of new genes that are resistant to disease which may be repositories of new gene combinations and resistance mechanisms. Eventually, genetic resources can contribute more resistant varieties with durable resistance that can keep pace with a virulent virus strain. The present study aimed to critically identify new sources of resistance against ChiLCD available at the National Genebank of Indian chilli germplasm collections, which have been inadequately explored. The experimental location, a known endemic area that commonly experiences severe outbreaks under natural disease conditions. However, using artificial inoculation in a controlled environment ensured uniform incidence of the disease and eliminating any chance of escape.

Such promising resistant germplasm sources need first to be identified before embarking on the processes to develop disease-resistant varieties. This task becomes unattainable when thousands of germplasm entries have to be screened under artificial conditions. Thus, it is more practical to conduct initial screening under natural epiphytotic conditions in the field, at least eliminating those accessions expressing susceptible reactions. We screened 500 chilli germplasm accessions against ChiLCD under natural conditions and identified 16 highly resistant, 40 resistant, and 444 ranging from moderately susceptible to highly susceptible. For further studies, we selected 56 germplasm lines from either highly resistant or resistant. Similarly, Abhishek et al.²⁶ screened 1127 cowpea germplasm accessions against begomoviruses in the preliminary screening to eliminate susceptible accessions for further evaluation and artificial screening.

To identify and confirm the resistance against ChiLCD, those accessions which were resistant in the preliminary screening were subjected to advanced screening and validation for three years and five seasons (2022–2024) in a disease hotspot area. Those accessions whose PDI was more than 25 were classified as moderately to highly susceptible and were subsequently excluded from further testing. Of the 16 accessions initially deemed highly resistant, only 10 remained resistant, with only 6 continuing to exhibit high resistance. Among 40 resistant accessions, 21 maintained resistances, 13 turned moderately susceptible and six became susceptible. The ChiLCD susceptible accessions displayed a range of symptoms, including leaf upward curling, reduced leaf size, puckering, and a significant reduction in fruit production, where some plants did not fruit under severe infection. Hence, there was a marked reduction in yield per plant. These susceptible accessions were deselected from further validation.

A total of 37 accessions were taken up for two years more validation under natural conditions prevailing in an endemic area. Five among 31 resistant accessions expressed as moderately susceptible, while the remaining 26 showed consistency in resistance to ChiLCD throughout the validation period. The disease reaction regarding six highly resistant accessions EC771555, IC643853, EC772795, EC787119, EC769427 and IC607252 was found stable as PDI values were maintained below 5.0%. Similarly, Srivastava et al.¹⁸ elaborated that out of 60 genotypes, including commercial varieties, advanced breeding lines, and germplasm, only three resistant lines were identified for ChiLCD, after three years of screening during six seasons and one year of preliminary assessments under natural epiphytotic conditions.

The Wilcoxon Signed-Rank test has indicated that the distribution of Percent Disease Incidence (PDI) between Kharif 2023 and summer 2024 is similar. The greater the PDI, the higher the virus incidence. This sort of consistency suggests that the genotypes may possess a stable resistance to chilli leaf curl disease (ChiLCD) across different seasons and inoculation pressures. The high number of ties (15 out of 43 genotypes) suggests similar disease responses across seasons, indicating that genotypic effects are more dominant and stable than seasonal variation. However, the p-value was close to 0.05, suggesting a trend towards significance, which may warrant further investigation with a larger sample size or under controlled experimental conditions. While seasonal factors may contribute, their influence was not statistically consistent in this dataset. This will be addressed in the continuation of our multilocation trials. This stability reflects a strong genetic basis for resistance to ChiLCD. In contrast, Gayacharan et al.²⁷ applied the Wilcoxon Signed-Rank test to evaluate chickpea germplasm reaction to Ascochyta blight at two locations and found significant difference. They attributed the variation in disease severity to environmental conditions or distinct races of pathogens.

Challenge inoculation with viruliferous whiteflies under controlled conditions of highly resistant accessions yielded consistent results. The artificial screening of these chilli accessions through challenge inoculation manifested as evidence for resistance against ChiLCD. These findings complement the advanced screening and validations conducted under natural epiphytotic conditions and absolutely assure that these accessions are sources of high resistance. Thus, they could be of interest for further use in breeding programs aimed at creating ChiLCD-resistant varieties. Similar to our studies, Srivastava et al.²⁸ screened wild species Solanum pseudocapsicum to confirm the resistance source of the CHiLCD host. They identified resistant accession during four years of independent testing in natural epiphytotic conditions, which was subsequently subjected to challenge inoculation, to confirm their resistance to ChiLCV and ToLCNDV in this accession.

Additionally, the resistant accessions also display great diversity in flower colour, fruit colour and fruit shape. Accessions EC787119 has purple flowers, while others have white. EC787119 and EC362911 bear purple fruits, while the rest of the accessions, fruits are green. The fruit shapes also vary with accessions EC772795 and EC787119 produce triangular fruits; nearly round fruits by EC790579, blocky fruits by EC119698 and EC787137 accession and the others being elongated. This variation offers plant breeders a range of option from suitable accessions to meet the specific needs of breeding programs. Similarly, Srivastava et al.¹⁸ also observed variability in fruit colour and shape during their screening of chilli genotypes for ChiLCD.

The six highly resistant accessions identified in our study confirms their resistance to the viral strains currently prevalent in this region under both natural incidence and controlled challenge inoculation using with ChiLCV, the predominant begomovirus strain present at the New Delhi location. However, we recognize that begomovirus populations and strains vary across agro-climatic zones. A stable, resistant source can be identified through multi-location and multi-season evaluation for ChiLCD resistance. Therefore, multi-location trials will be undertaken in future to evaluate whether these accessions also maintain resistance against the diverse begomovirus strains present in other parts of the country. This will help establish the stability and broad-spectrum effectiveness of their resistance. Such stability is vital for developing long-term, disease-resistant varieties. In plant breeding, a genotype’s ability to maintain resistance across various environments and inoculation pressures is essential for its sustained use. The strong genetic basis for the resistance offers immediate breeding value and insights into ChiLCD resistance, potentially leading to more resilient and stable-yielding chilli cultivars.

The qRT-PCR was carried out to quantify the viral titre in chilli germplasm. Results highlighted that there was a significant variation in susceptibility and tolerance of chilli accessions to ChiLCD, as evidenced by their respective viral loads. Of the accessions under study, IC642940 emerged as the highly susceptible with the highest relative viral load of 90,774.5-fold. Accessions IC644156 and EC772791 also displayed notable susceptibility. The exceptionally high viral load in IC642940, compared to the susceptible checks, may be explained by genotype-specific host–virus interactions wherein this accession supports more efficient ChiLCD replication and accumulation. In contrast, the susceptible checks (Kashi Anmol, Pusa Jwala, and LCA334), though symptomatically susceptible, likely possess some basal defense or partial tolerance mechanisms that limit excessive viral multiplication, resulting in lower viral titers. This suggests that IC642940 is highly vulnerable to ChiLCD infection and unsuitable for resistant breeding programmes.

Accession IC643853 was identified as the most resistant because no viral load was detected, indicating its robust mechanisms for effective inhibition of ChiLCD replication, making it a crucial source of ChiLCD resistance in breeding programmes. Some of the other accessions, IC607252, EC771555, EC772795, EC769427, and EC787119 demonstrated high level of resistance because of very low viral titers loads ranged from 0.1 to 0.3-fold, suggesting that they have highly integral resistance traits. These accessions also expressed highly resistant reactions in multi-season and multi-year evaluation and validation including artificial screening under challenged inoculation. They could, therefore, also serve as valuable genetic resources for developing new resistant cultivars of chilli. On the other hand, the checks Kashi Anmol, Pusa Jwala, and LCA334 exhibited relatively high viral loads ranging from 1.0 to 1.4-fold, confirming their susceptibility to ChiLCD. The results demonstrate its effectiveness as a tool for providing its applicability in confirming ChiLCD infection and assessing resistance in chilli genotypes. Our findings align with the work of Mangal e al.¹³, who also used the qRT-PCR viral titre method to confirm the presence of virus in chilli genotypes against ChiLCD.

Conclusion

We were able to successfully identify and validate chilli accessions with high resistance to ChiLCD under a stringent multi- season and multi-year screening regime supplemented with artificial inoculation. Of the 500 accessions screened, six accessions namely EC771555, IC643853, EC772795, EC787119, EC769427, and IC607252 expressed high level of resistance with PDI values ranging from 0 to 4.34%. Further, 26 accessions were categorised as resistant, 51 as moderately resistant, 29 as susceptible and 388 as highly susceptible. The statistical analysis for disease resistance revealed no significant difference between Kharif 2023 and summer 2024 seasons, indicating stable resistance. Highly susceptible accession IC642940 and IC644156 exhibited high viral titres of 90,774.5 and 3,956.5, respectively, whereas the highly resistant accessions showed very low viral titres (0.1 to 0.3-fold) in the same qPCR. This was further confirmed by artificial inoculation, where PDI values of resistant accessions remained between 0 and 2%. The present research provides robust evidence that these accessions may be suitable for use in chilli crop improvement programs for enhancing resistance to ChiLCD, thereby contributing to greater crop stability and increased crop yield in affected regions of India where losses may be even higher. Future research should focus on the genetic characterization of these accessions to identify specific resistance genes, which could further enhance the effectiveness of breeding strategies aimed at combating ChiLCD in chilli crops.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

DDD performed data curation, formal analysis, and drafted the manuscript. VS and HM contributed to data curation and manuscript drafting. MM carried out investigation and methodology and provided supervision, along with reviewing and editing the manuscript. AS conceptualized the study, conducted investigation and methodology, supervised the work, and reviewed and edited the manuscript. BM designed and executed the challenge inoculation experiment. KSH provided supervision. CP managed the project and provided resources. RPG contributed to investigation, provided resources, and supervised the study. GJA and SDM performed formal analysis. RKG administered the project and provided supervision. JCR acquired funding and contributed to manuscript reviewing and editing. GPS provided overall supervision. VKS conceptualized the study, acquired funding, designed the investigation and methodology, managed the project and resources, supervised the work, validated the findings, and contributed to manuscript visualization, review, and editing.

Data availability

All data generated or analyzed during this study are included in the paper (and its Supplementary Information files).

Competing interests

The authors declare no competing interests.