GLCCI1 alleviates airway remodeling in asthmatic mice by inhibiting ZEB1-mediated epithelial-mesenchymal transition

Abstract

Background

Asthma is a heterogeneous disease characterized by chronic airway inflammation and airway hyperresponsiveness. Our previous study found that glucocorticoid-induced transcript 1 (GLCCI1) is down-regulated in the lung tissues of asthmatic mice. This work attempted to determine the precise mechanism of GLCCI1 in asthma.

Methods

The asthma mouse model was constructed by administration of ovalbumin (OVA). OVA challenge elevated airway resistance and increased the levels of inflammatory factors (IL-1β, TNF-α, IL-13, TGF-β, IL-4, and IL-5) in the asthmatic mice. Histological analysis revealed enhanced inflammation and collagen deposition in lung tissues of asthmatic mice. GLCCI1 overexpression reduced airway resistance, lung inflammation, and fibrosis in asthmatic mice. In vitro, airway epithelial cells (BEAS-2B) were treated with TNF-α to mimic the condition of asthma.

Results

GLCCI1 overexpression enhanced the phosphorylation of PI3K, AKT, and mTOR, thereby activating the PI3K/AKT/mTOR signaling pathway in asthmatic mice and TNF-α-treated BEAS-2B. GLCCI1 up-regulation inhibited the expression of ZEB1, N-cadherin, Vimentin and elevated E-cadherin in asthmatic mice and TNF-α-treated BEAS-2B. The influence conferred by GLCCI1 overexpression was reversed by ZEB1 upregulation. It indicated that GLCCI1 suppressed ZEB1-mediated epithelial-mesenchymal transition (EMT). Both LY294002 (PI3K inhibitor) and Rapamycin (mTOR inhibitor) treatment reversed GLCCI1 overexpression-induced inhibition of ZEB1-mediated EMT in TNF-α-treated BEAS-2B.

Conclusion

In summary, this work demonstrated that GLCCI1 overexpression inhibits ZEB1-mediated epithelial-mesenchymal transition by activating PI3K/AKT/mTOR signaling pathway, thereby alleviating airway remodeling in asthmatic mice. Thus, this study suggests that GLCCI1 may be a potential target for asthma treatment.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s12931-025-03476-3.

Introduction

Asthma is an airway inflammatory disease characterized by the diffuse infiltration of various inflammatory cells in the airways, which is jointly induced by multiple immune cells [1]. Asthma often leads to symptoms such as shortness of breath, chest tightness, cough, recurrent wheezing, excessive mucus secretion and goblet cell hyperplasia, which directly affects human health [2]. Its global prevalence varies widely across countries, ranging from approximately 1–18% [3]. According to the Global Burden of Disease Study, there are about 240 million asthma patients worldwide, and there is an increasing trend [4]. It is expected to reach 300 million by 2025. Thus, asthma has become a significant disease burden in the healthcare system.

Airway hyperresponsiveness and airway remodeling are two important features of asthma [5]. Airway remodeling is driven by chronic airway inflammation, leading to incomplete, irreversible changes in airway structure. Repeated acute exacerbations of airway inflammation can lead to airflow limitation, airway narrowing, and airway hyperresponsiveness. Epithelial-mesenchymal transition (EMT) plays an important role in airway remodeling. It can lead to fibrosis of the asthmatic airway epithelium, promote smooth muscle proliferation, disrupt the epithelial barrier, and aggravate airway inflammation [6].

GLCCI1 is a gene regulated by glucocorticoid signaling, and its role in asthma has gradually attracted attention in recent years [7]. Previous studies have demonstrated that GLCCI1 expression is significantly downregulated in the lung tissues of asthmatic mice, and its overexpression alleviates airway remodeling by inhibiting autophagy of airway epithelial cells (BEAS-2B) [8, 9]. Autophagy, a critical catabolic process, is tightly regulated by several signaling pathways, among which the PI3K/AKT/mTOR axis serves as a central hub [10]. This pathway not only modulates autophagy but is also extensively involved in regulating EMT, a key driver of airway structural remodeling [11, 12]. Notably, Kim has revealed that GLCCI1 is closely associated with PI3K signaling pathway in podocyte foot rats [13], suggesting a potential regulatory role of GLCCI1 in this pathway. Nevertheless, whether GLCCI1 can affect PI3K/AKT/mTOR signaling pathway in asthmatic mice has not been reported. Therefore, we hypothesize that GLCCI1 attenuates airway remodeling in asthma by activating the PI3K/AKT/mTOR signaling pathway.

Zinc finger E-box binding homeobox 1 (ZEB1) belongs to the ZEB transcription factor family. The expression of ZEB1 is regulated by WNT, NF-κB and other signaling pathways. Importantly, ZEB1 is an important driver of EMT onset [14, 15]. On the one hand, the zinc finger structure of ZEB1 binds to the E-box in the promoter region of the E-cadherin, which directly inhibits the expression of E-cadherin and initiates the EMT process [16]. On the other hand, ZEB1 contains a C-terminal binding protein (CtBP) interaction domain that can interact with CtBP, which can inhibit E-cadherin gene expression. Third, the complex formed by ZEB1 and histone deacetylase may inhibit E-cadherin expression by participating in the transcriptional splicing of E-cadherin [17]. Therefore, ZEB1 can induce the EMT process by inhibiting the expression of E-cadherin. Additionally, the PI3K/AKT/mTOR signaling pathway interacts with ZEB1 in various cancers [18]. The STRING database also shows a possible interaction between ZEB1 and the AKT/mTOR signaling pathway. Thus, we suggest that GLCCI1 may improve airway remodeling and inhibit EMT in asthmatic mice by activating the PI3K/AKT/mTOR signaling pathway and inhibiting ZEB1.

TNF‑α is a key mediator in severe asthma and a potent inducer of airway remodeling [19]. It triggers EMT in airway epithelial cells, leading to loss of E‑cadherin and gain of N‑cadherin and Vimentin — central events in asthma‑related structural changes [20]. TNF‑α exerts these effects by activating downstream signaling pathways such as NF‑κB and MAPK, which are known regulators of EMT and inflammatory responses [21, 22]. Clinically, TNF‑α levels correlate with disease severity and airflow limitation [23]. In addition, TNF‑α has been widely used in vitro to simulate the inflammatory microenvironment of asthma [24, 25]. Therefore, we selected TNF‑α to stimulate BEAS‑2B cells, establishing a translational model to investigate GLCCI1’s role in EMT and airway remodeling.

In this study, the specific mechanisms of action of GLCCI1 in asthma are studied using an OVA-induced mouse model and a TNF-α-treated BEAS-2B cell model, providing a new theoretical basis and potential targets for asthma treatment.

Methods

Animals

Female BALB/c mice were employed based on their established sensitivity in allergic asthma models [26]. Female BALB/c mice (weighing 18–20 g; Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China) were raised under constant conditions (temperature 20–24 °C, relative humidity 40–60%). All procedures were conducted with the approval of the Ethics Committee guidelines and Animal Ethics Standards of Second Affiliated Hospital of Nanchang University (the approval number: NCUSYDWFL-2020–149), and conformed to the care and handling of animals as outlined in the Canadian Council on Animal Care’s Guide to the Care and Use of Experimental Animals.

Asthmatic mouse model

Asthmatic mouse model was constructed by administration of ovalbumin (OVA) following the previous report [27]. Mice were sensitized with 200 μL of emulsion mixture of OVA (20 μg) and aluminum hydroxide (1 mg) on days 1 and 8 by intraperitoneal injection. On days 15, 16, and 17 after initial sensitization with OVA, mice were aerosolized with 5% (v/v) OVA for 30 min in a whole-body exposure chamber. 3 days after the first OVA challenge, mice were anesthetized with isoflurane and lentiviral particles were administered via tail‑vein injection. The tail was disinfected with 75% alcohol, and the lateral tail vein was punctured at the distal‑to‑middle third using a 26‑gauge needle (10–30°, 2–4 mm depth). Following confirmation of blood reflux, 50 μL of viral suspension containing 2.5 × 10⁶ TU (in sterile PBS) was slowly injected per mouse. The needle was withdrawn, and hemostasis was achieved by gentle compression with a sterile cotton swab for 30–60 s. All lentiviruses (LV‑GLCCI1 and LV‑NC; titer 1 × 10⁹ TU/mL) were produced by GenePharma (Shanghai, China). Mice were intraperitoneally injected with normal saline and then aerosolized with normal saline as a control. Mice were euthanized 24 h after the final OVA challenge for sample collection. Mice were anesthetized with intraperitoneal injection of 10% chloral hydrate (400 mg/kg), and then euthanized by cervical dislocation.

Measurement of bronchial responsiveness

At 24 h after the last OVA challenge, airway responsiveness of mice to methacholine was detected by Whole‑body plethysmography (Buxco Electronics Inc., Troy, NY, USA) as previously reported [28]. Mice were aerosolized with different concentrations (0, 6.25, 12.5, 25, or 50 mg/mL) of methacholine (dissolved in normal saline; Sigma-Aldrich, St. Louis, MO, USA) for 2 min, and the airway resistance of mice was measured. The percentage of baseline airway resistance values was recorded after each concentration of methacholine exposure.

Preparation of serum and bronchoalveolar lavage fluid (BALF)

After the bronchial responsiveness detection, mice were euthanized. The eyeball was quickly extirpated from mice, and the blood was collected. After standing for 30 min, the blood samples were centrifuged at 3000 rpm for 10 min. The supernatant (serum) was collected and stored at −80 °C for further analysis. BALF was collected from the euthanized mice as previously described [29]. The pre-cooled normal saline (0.5 mL) was slowly injected into the tracheal cannula 3 times. The BALF was recovered by gentle aspiration after each infusion. The recovery rate of BALF was more than 80%. The BALF was centrifuged at 1500 rpm for 10 min, and the supernatant was collected for further use.

Enzyme-linked immunosorbent assay (ELISA)

The levels of IL-1β, TNF-α, IL-13 and TGF-β in the serum and BALF, as well as the levels of IL-4 and IL-5 in BALF, were detected by ELISA kits following the manufacturer’s protocols. Mouse IL-1β ELISA kit, Mouse TNF-α ELISA kit, Mouse IL-13 ELISA kit and Mouse TGF-β ELISA kit were purchased from Mlbio (Shanghai, China); Mouse IL-4 ELISA kit and Mouse IL-1β ELISA kit were purchased from Elabscience (Wuhan, Hubei, China). The absorbance of samples was detected by an ELISA reader (BioTek, Winooski, VT, USA).

Histological analysis

After collection of serum and BALF, lung tissues were separated and fixed in 10% neutral-buffered formalin. Then, the lung tissues were embedded in paraffin and cut into sections with 4 μm thickness.

Lung sections were stained with Hematoxylin and Eosin (H&E) Staining Kit (Beyotime, Shanghai, China). The sections were observed under an optical microscope (Olympus, Tokyo, Japan), and the levels of lung inflammation were evaluated blindly [30]. Inflammation was divided into 4 grades: grade 0: normal; grade 1: few inflammatory cells; grade 2: a ring of inflammatory cells with 1 cell layer deep; grade 3: a ring of inflammatory cells with 2–4 cells deep; grade 4: a ring of inflammatory cells with > 4 cell layers deep.

To evaluate the lung fibrosis levels, lung sections were stained with Masson's Trichrome Stain Kit (Solarbio, Beijing, China). The lung sections were observed under an optical microscope (Olympus) and analyzed by Image-Pro Plus software (Version X; Adobe, San Jose, CA). The percentage of collagen fibers = collagen area (blue)/total examined area × 100%.

The proliferation of goblet cells in lung tissue and mucus secretion levels were assessed using a PAS staining kit (Solarbio), followed by observation and recording of images using an optical microscope (Olympus).

The expression of GLCCI1, ZEB1, E-cadherin, and Vimentin proteins in lung tissue was detected using immunohistochemistry (IHC). Lung tissue sections were subjected to dewaxing and rehydration, followed by heat-induced epitope retrieval. Subsequently, endogenous peroxidase activity was blocked using a 3% hydrogen peroxide solution, and the sections were blocked with 5% BSA for 30 min. Next, the primary antibodies for GLCCI1 (1:50 dilution; ipodix, Hubei, China), ZEB1 (1:200 dilution; Abcam, MA, USA), E-cadherin (1:200 dilution; Abcam), and Vimentin (1:200 dilution; Proteintech, Hubei, China) were added and incubated overnight at 4 °C. Next, add enzyme-labeled goat anti-mouse IgG polymer (Zsbio, Beijing, China) was added and incubated at 37 °C for 20 min. Finally, DAB staining (Servicebio, Wuhan, China) was performed, and the results were observed and recorded under an optical microscope (Olympus).

Cell culture

Human bronchial epithelial cells, Bronchial Epithelium transformed with Ad12-SV40 2B (BEAS-2B; Lifeline Cell Technology, Frederick, MD, USA) were cultured in Dulbecco's modified Eagle medium (DMEM; Gibco, Carlsbad, CA, USA) at 37 °C and 5% CO₂. The culture medium was supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Sangon Biotech, Shanghai, China). BEAS-2B cells were treated with 300 ng/mL TNF-α (Sigma-Aldrich) for 48 h as a cell model of asthma. Subsequently, the cells were transfected with GLCCI1 overexpressing or control plasmids and incubated for 24 h, followed by treatment with 100 μM LY294002 (PI3K inhibitor; Santa Cruz) or 10 nM Rapamycin (mTOR inhibitor; Santa Cruz) for 48 h before harvest.

Vectors and cell transfection

For in vitro studies, BEAS-2B cells were transfected with plasmids or siRNAs using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. GLCCI1 overexpression was achieved using the pcDNA3.1-GLCCI1 plasmid, with the empty pcDNA3.1(+) vector serving as a control. GLCCI1 knockdown was performed using specific siRNAs (si-GLCCI1), with a non-targeting siRNA (si-NC) as the control.

To manipulate PI3KCB expression, cells were transduced with lentiviral vectors. The PI3KCB overexpression construct (PI3KCB-OE) and its control (OE-NC), as well as PI3KCB-targeting shRNAs (sh-PI3KCB-1/2) and a non-targeting shRNA control (sh-NC), were delivered via lentivirus, followed by puromycin selection to establish stable cell lines. All these vectors and lentiviral particles were constructed by GenePharma (Shanghai, China).

Western blotting

Lung tissues and BEAS-2B were treated with RIPA lysis buffer (Servicebio), and then total proteins were isolated. 10% SDS-PAGE was performed to separate the proteins. The separated proteins were transferred onto PVDF membranes, and then blocked with 5% non-fat milk at room temperature for 1 h. The membranes were incubated with primary antibodies against GLCCI1 (1:2000 dilution; Goodhere Biotechnology, Hangzhou, China), PI3K (1:1000 dilution; Absin Bioscience, Shanghai, China), AKT (1:1000 dilution; Cell Signaling Technology, Danvers, MA, USA), mTOR (1:1000 dilution; Cell Signaling Technology), p-PI3K (1:1000 dilution; Absin Bioscience), p-AKT (1:1000 dilution; Cell Signaling Technology), p-mTOR (1:1000 dilution; Cell Signaling Technology), ZEB1 (1:1000 dilution; Abcam), E-cadherin (1:1000 dilution; Abcam), N-cadherin (1:1000 dilution; Abcam), Vimentin (1:1000 dilution; Abcam) at 4 °C for 12 h. The membranes were then stained with HRP-conjugated IgG antibody (1:2000 dilution; Abcam) at room temperature for 2 h. GAPDH antibody (1:5000 dilution; Abcam) served as a loading control. The protein bands were visualized by ECL kit (Beyotime). The data were analyzed using Image J software.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from cells using TRIzol reagent (Servicebio), and its concentration was measured. cDNA was synthesized using a PrimeScript™ RT reagent Kit (Takara, Japan). Subsequently, GAPDH was used as the internal reference gene, and amplification was performed using TB Green® Premix Ex Taq™ II (Takara) on a qPCR instrument (Hongshi, Shanghai, China). The primer sequences are shown in Table 1. Finally, the relative expression level of the target gene was calculated using the 2^−∆∆CT method.

Table 1.

Primers of qRT-PCR

Gene	Forward sequence (5’−3’)	Reverse sequence (5’−3’)
GAPDH	CATCACTGCCACCCAGAAGACTG	ATGCCAGTGAGCTTCCCGTTCAG
PI3KCB	AGATCGCTCTGGCCTCATTG	AGCCAGTTCAGAAGGGCATC
GLCCI1	AAGGCGAACCTCCTCTTTGG	CATGACGCAGAACGCTGATG
sh-PI3KCB-1	CCGGTATCCTGTAGCGTGGGTAAATCTCGAGATTTACCCACGCTACAGGATATTTTTG	AATTCAAAAATATCCTGTAGCGTGGGTAAATCTCGAGATTTACCCACGCTACAGGATA
sh-PI3KCB-2	CCGGCCACATTGACTTTGGACATATCTCGAGATATGTCCAAAGTCAATGTGGTTTTTG	AATTCAAAAACCACATTGACTTTGGACATATCTCGAGATATGTCCAAAGTCAATGTGG

Immunofluorescence (IF)

Cells cultured on coverslips were fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, blocked with 5% BSA for 30 min, and then incubated with anti-E-cadherin (1:500 dilution; Proteintech), anti-Vimentin (1:500 dilution; Proteintech), and anti-ZEB1 (1:500 dilution; Proteintech) antibodies at 4 °C overnight. After washing with PBS, FITC-labeled goat IgG antibody (1:300 dilution; Beyotime) was added and incubated in the dark for 2 h. DAPI nuclear staining for 5 min, followed by mounting. Finally, images were observed and acquired using an inverted fluorescence microscope (Leica, Germany).

Statistical analysis

Sample size was set as n = 6 mice per group for in vivo experiments and n = 3 independent replicates for in vitro experiments. Data were analyzed by SPSS 22.0 statistical software (IBM, Armonk, NY, USA) and expressed as mean ± standard deviation. Two-tailed Student’s t-test and one-way ANOVA followed by Tukey’s post hoc test were used to analyze statistical differences. A P value of less than 0.05 was considered statistically significant.

Results

OVA causes alterations in GLCCI1 and PI3K/AKT/mTOR signaling pathways

A mouse model of asthma was established by administering OVA to mice. The airway responsiveness of the mice was examined, and the results showed that OVA treatment significantly enhanced the airway resistance of the mice (Fig. 1A). Then, the levels of inflammatory factors in BALF and serum of mice were detected by ELISA. As shown in Fig. 1B, the levels of IL-1β, TNF-α, IL-13, TGF-β, IL-4, and IL-5 were significantly increased in asthmatic mice compared with normal mice. Histological analysis of H&E staining and Masson staining showed that the levels of inflammation and collagen fibers in the lung tissues of the mice were significantly increased by the administration of OVA (Fig. 1C, D). The observation of the goblet cells of the lung tissues by PAS staining revealed that OVA administration significantly increased goblet cell hyperplasia and mucus secretion in lung tissues (Fig. 1E). Western blot and IHC assay of lung tissues showed that the expression of GLCCI1 was significantly lower in the OVA group (Fig. 1F, G). Additionally, the detection results of Western blot showed that the ratios of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR in lung tissues of the OVA group were significantly lower than those of the Control group (Fig. 1H). Therefore, these findings collectively demonstrated that OVA altered GLCCI1 expression and disrupted PI3K/AKT/mTOR signaling in asthma.

Fig. 1.

OVA induces alterations in GLCCI1 and PI3K/AKT/mTOR signaling pathways. An asthmatic mouse model was constructed by administration of OVA. Normal mice served as controls. A The responsiveness of the mouse airway was examined 24 h after the final challenge (n = 6). B ELISA was performed to measure the levels of IL-1β, TNF-α, IL-13, TGF-β, IL-4, and IL-5 in BALF, and IL-1β, TNF-α, IL-13, and TGF-β in serum (n = 6). C Pathological changes in mouse lung tissue were observed by H&E staining (n = 3). D Masson staining was utilized to observe collagen deposition in lung tissue (n = 3). E PAS staining was performed to observe goblet cells in lung tissue (n = 3). F-G Western blot and IHC were employed to detect GLCCI1 expression in lung tissues (n = 3). Arrows indicate representative areas of positive GLCCI1 expression. H Western blot was employed to assess the expression levels of PI3K, AKT, mTOR, p-PI3K, p-AKT, and p-mTOR in lung tissues (n = 3). Data are presented as mean ± SD. Each dot represents an individual mouse. ^**P < 0.01, ^***P < 0.001 vs. Control group

GLCCI1 regulates the PI3K/AKT/mTOR signaling pathway in vitro

To further validate the regulatory role of GLCCI1 on the PI3K/AKT/mTOR signaling pathway, this study used TNF-α-induced BEAS-2B cells to construct an asthma cell model and then treated them with overexpression of GLCCI1 or si-GLCCI1. Western blot analysis showed that the overexpression of GLCCI1 after TNF-α treatment led to higher GLCCI1 expression level than the Vctor groups, while si-GLCCI1 treatment significantly decreased GLCCI1 expression level in cells (Fig. 2A). In Fig. 2B, C, Western blot results showed that the ratios of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR, whereas GLCCI1 overexpression rescued this reduction. Conversely, si-GLCCI1 treatment further inhibited its expression levels.

Fig. 2.

Experimental evidence that GLCCI1 regulates the PI3K/AKT/mTOR signaling pathway in vitro. 300 ng/mL TNF-α induced BEAS-2B cells to establish asthma cell models, and then treated with overexpression of GLCCI1 or si-GLCCI1. A-C Western blot was carried out to assess the expression levels of GLCCI1 and PI3K/AKT/mTOR-related protein (n = 3). Experimental groups: Control, sh-NC, sh-PI3KCB, OE-NC, PI3KCB-OE. D qRT-PCR was conducted to evaluate PI3KCB and GLCCI1 mRNA expression levels in cells (n = 3). E, F The protein expression levels of PI3K and GLCCI1 in cells were measured by Western blot (n = 3). Data are presented as mean ± SD. Each dot in bar plots represents one independent biological replicate. ^**P < 0.01, ^***P < 0.001 vs. Control group or sh-NC; ^#P < 0.05, ^###P < 0.001 vs. TNF-α + Vector group or OE-NC group; ^$P < 0.05, ^$$$P < 0.001 vs. TNF-α + si-NC group

Human normal bronchial epithelial cells BEAS-2B were cultured in vitro and transfected with sh-PI3KCB-1, sh-PI3KCB-2, and then the transfection efficiency was verified using qRT-PCR and Western blot. In Figure S1A-B, the results showed that the expression levels of PI3KCB and PI3K were significantly reduced after transfection of sh-PI3KCB-1 and sh-PI3KCB-2. The results of the qRT-PCR and Western blot assay showed that the expression levels of both PI3KCB and PI3K were increased after overexpression of PI3KCB (Figure S1C-D). These results confirmed the successful transfection. In Fig. 2D-F, transfection of sh-PI3KCB decreased the expression level of PI3KCB, while PI3KCB-OE treatment showed the opposite trend. However, the expression of GLCCI1 did not change significantly. In summary, in vitro further supported the regulatory role of GLCCI1 in regulating the PI3K/AKT/mTOR signaling.

Effect of GLCCI1 on ZEB1 and EMT

To further investigate the effects of GLCCI1 on ZEB1 and EMT, the expression levels of ZEB1 protein, lung tissue epithelial phenotypic protein E-cadherin and mesenchymal phenotypic proteins N-cadherin and Vimentin were detected in the in vivo and in vitro models. Western blot results in Fig. 3A, B showed that the protein levels of ZEB1, N-cadherin, and Vimentin were significantly increased in the OVA group, while the protein level of E-cadherin was significantly decreased. In the results of in vitro experiments, Western blot showed that overexpression of GLCCI1 reduced the increase in ZEB1 expression level induced by TNF-α, while silencing of GLCCI1 could reverse this decrease (Fig. 3C). Moreover, in Fig. 3D, E, TNF-α induction decreased the expression of E-cadherin and increased the expression of N-cadherin and Vimentin in BEAS-2B cells, which was the same trend as that of GLCCI1 knockdown. In contrast, GLCCI1 overexpression reversed this trend. In summary, the expression of GLCCI1 in asthmatic mice is related to ZEB1 and EMT.

Fig. 3.

Effect of GLCCI1 on ZEB1 and EMT. In vivo experiments were divided into: Control and OVA. A, B Western blot was employed to assess the protein expression levels of ZEB1, N-cadherin, and Vimentin in lung tissues (n = 3). In vitro experiments were divided into: Control, TNF-α, TNF-α + Vector, TNF-α + GLCCI1 overexpression, TNF-α + si-NC, TNF-α + si-GLCCI1. C-E The protein expression levels of ZEB1, E-cadherin, N-cadherin, and Vimentin in cells were measured by Western blot (n = 3). Data are presented as mean ± SD. Each dot represents one independent biological replicate. ^*P < 0.05, ^***P < 0.001 vs. Control group; ^###P < 0.001 vs. TNF-α + Vector group; ^$$$P < 0.001 vs. TNF-α + si-NC group

Clarification of the mechanism by which GLCCI1 regulates TNF-α-induced EMT in bronchial epithelial cells

To further investigate the mechanism by which GLCCI1 regulates EMT, TNF-α-induced BEAS-2B cells were treated with Vector/GLCCI1-OE and/or PI3K inhibitor LY294002/the mTOR inhibitor Rapamycin. The results of Western blotting showed that TNF-α induction inhibited the phosphorylation levels of PI3K, AKT, and mTOR, as indicated by reduced p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR ratios, whereas overexpression of GLCCI1 exhibited the opposite trend. Furthermore, GLCCI1-overexpressing BEAS-2B cells were treated with LY294002 or Rapamycin. The results showed that the phosphorylation of PI3K, AKT, andmTOR pathway was suppressed, as reflected by the significantly reduced ratios of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR, without markedly affecting protein expression (Fig. 4A). ZEB1 was upregulated in the cell model after treatment with TNF-α, and the level of ZEB1 was reduced after overexpression of GLCCI1. Upon addition of the inhibitor, ZEB1 protein levels were significantly increased (Fig. 4B, C). In the cellular model of asthmatic mice, the expression of E-cadherin was decreased, and N-cadherin and Vimentin were increased. overexpression of GLCCI1 increased the expression of E-cadherin and suppressed the expression of N-cadherin and Vimentin, which was reversed by the addition of the inhibitors (Fig. 4D, E). These results confirmed that GLCCI1 effectively inhibited ZEB1 protein expression and the EMT process it mediates at the cellular level by activating the PI3K/AKT/mTOR signaling pathway.

Fig. 4.

Clarification of the mechanism of GLCCI1 regulation of TNF-α-induced EMT in bronchial epithelial cells in vitro. TNF-α induced BEAS-2B cells to establish cell models. GLCCI1 overexpressing BEAS-2B were treated with PI3K inhibitor LY294002 and mTOR inhibitor Rapamycin, respectively. cells were grouped into: the control group, TNF-α induced group, TNF-α + overexpression control group, TNF-α + GLCCI1 overexpression group, TNF-α + GLCCI1 overexpression + LY294002 group, and TNF-α + GLCCI1 overexpression + Rapamycin group. A Western blot was carried out to observe the protein expression levels of PI3K, AKT, mTOR, p-PI3K, p-AKT, and p-mTOR in cells (n = 3). B, C Western blot and IF detection were conducted to measure ZEB1 expression level in cells (n = 3). D, E Western blot and IF were performed to examine E-cadherin, N-cadherin, and Vimentin expression levels in cells (n = 3). Data are presented as mean ± SD. Each dot in bar plots represents one independent biological replicate. ^***P < 0.001 vs. Control group; ^###P < 0.01 vs. TNF-α + Vector group; ^$$$P < 0.001 vs. TNF-α + GLCCI1 group

Overexpression of GLCCI1 improves airway remodeling in vivo

To validate the improvement of airway remodeling in asthma mice by GLCCI1 overexpression in vivo, this study constructed a GLCCI1-overexpressing lentivirus and injected it into asthma mice. The airway assay results in Fig. 5A showed that airway resistance was significantly elevated in asthmatic mice, and overexpression of GLCCI1 rescued airway resistance. The ELISA results showed that the levels of IL-1β, TNF-α, IL-13, and TGF-β in serum, as well as IL-1β, TNF-α, IL-13, TGF-β, IL-4, and IL-5 in BALF, were significantly elevated, whereas overexpression of GLCCI1 reduced the levels of inflammatory factors (Fig. 5B, C). In addition, lung histopathological sections showed that overexpression of GLCCI1 reduced inflammation and collagen fibers in asthmatic mice (Fig. 5D, E). Similarly, PAS staining results indicated that the OVA group showed an increase in the number of goblet cells and mucus hypersecretion. The LV-GLCCI1 group showed a decreased number of goblet cells and mucus secretion in the OVA + LV-GLCCI1 group compared to the OVA + LV-NC group (Fig. 5F). Therefore, these results indicated that GLCCI1 overexpression in vivo significantly improved airway remodeling in asthma mice.

Fig. 5.

Overexpression of GLCCI1 improves airway remodeling in vivo. Construct GLCCI1 overexpression lentivirus and control virus. The experimental animals were randomly grouped into the normal control group, asthma group, control lentivirus group, and GLCCI1 overexpression lentivirus group. A Airway responsiveness was measured 24 h after the last provocation (n = 6). B, C ELISA was performed to measure the levels of IL-1β, TNF-α, IL-13, and TGF-β in serum, and IL-1β, TNF-α, IL-13, TGF-β, IL-4, and IL-5 in BALF (n = 6). D H&E staining was conducted to observe pathological changes in lung tissue (n = 3). E Collagen deposition in lung tissue was observed by Masson staining (n = 3). F PAS staining was used to observe the proliferation of goblet cells and mucus secretion in lung tissue (n = 3). Data are presented as mean ± SD. Each dot represents an individual mouse. ^*P < 0.05, ^**P < 0.01, ^***P < 0.001 vs. Control group; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 vs. OVA + LV-NC group

Overexpression of GLCCI1 improves airway remodeling mechanisms explored in vivo

Finally, GLCCI1 overexpressing lentivirus and control virus were constructed and GLCCI1 protein expression levels in lung tissues were detected using Western blot. The results in Fig. 6A, B showed that OVA treatment downregulated the expression of GLCCI1, which was reversed by overexpression of GLCCI1. The ratios of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR were downregulated in mice after OVA treatment, but this was reversed by overexpression of GLCCI1 (Fig. 6C). Additionally, Western blot and IHC detection of lung tissues confirmed that OVA treatment upregulated ZEB1, whereas overexpression of GLCCI1 decreased ZEB1 (Fig. 6D, E). E-cadherin was downregulated in asthmatic mice, whereas the expression of N-cadherin and Vimentin was increased. However, after overexpression of GLCCI1, the expression trend of EMT-related proteins showed the opposite change (Fig. 6F, G). These results further confirmed that GLCCI1 suppressed ZEB1 and subsequent EMT processes by activating the PI3K/AKT/mTOR signaling pathway, thereby exerting an effect in vivo that improved airway remodeling in asthmatic mice.

Fig. 6.

Investigation of the mechanism of improved airway remodeling by overexpression of GLCCI1 in vivo. The experimental animals were randomly into: Control, OVA, OVA + LV-NC, OVA + LV-GLCCI1. A, B Western blot and IHC were utilized to analyze GLCCI1 expression level in lung tissue (n = 3). C The protein expression levels of PI3K, AKT, mTOR, p-PI3K, p-AKT, and p-mTOR in lung tissue were evaluated by Western blot (n = 3). D, E Western blot and IHC were employed to study ZEB1 expression in lung tissue (n = 3). Arrows indicate typical nuclear positive signals of ZEB1. F, G Western blot and IHC detection of E-cadherin, N-cadherin, and Vimentin expression levels in lung tissue (n = 3). Arrows highlight representative areas of positive staining in each panel. Data are presented as mean ± SD. Each dot represents an individual mouse. ^**P < 0.01, ^***P < 0.001 vs. Control group; ^#P < 0.05, ^##P < 0.01 vs. OVA + LV-NC group

Discussion

Asthma is a heterogeneous disease characterized by chronic airway inflammation and airway hyperresponsiveness. In this work, we constructed an asthma mouse model by administration of OVA and determined the precise mechanism of GLCCI1 in asthma. OVA-induced asthmatic mice displayed higher levels of airway resistance and airway inflammation. The expression of GLCCI1 and the activity of PI3K/AKT/mTORwere decreased, and ZEB1 was up-regulated in asthmatic mice. Moreover, GLCCI1 overexpression inhibited airway remodeling and EMT and repressed ZEB1 expression in asthmatic mice, which was abrogated by ZEB1 upregulation. In vitro, GLCCI1 overexpression activated the PI3K/AKT/mTOR signaling pathway and suppressed EMT in TNF-α-treated BEAS-2B. Both LY294002 and Rapamycin treatment reversed GLCCI1 overexpression-mediated inhibition of EMT and ZEB1 expression in TNF-α-treated BEAS-2B.

GLCCI1 has been reported to participate in the progression of asthma. For instance, lower methylation levels of GLCCI1 are observed in severe asthma patients, and thus GLCCI1 methylation is closely associated with asthma severity [31]. Xun et al. have confirmed that GLCCI1 inhibits the autophagy of BEAS-2B by repressing the expression of WDR45B, which contributes to alleviating airway remodeling in asthmatic mice [8]. Consistent with previous findings, our study confirms that GLCCI1 inhibits airway remodeling in asthma. GLCCI1 was down-regulated in asthmatic mice and TNF-α-treated BEAS-2B. GLCCI1 overexpression alleviated asthma by inhibiting airway remodeling and EMT in vivo and in vitro.

Our data suggest a potential bidirectional negative feedback loop between TNF-α and GLCCI1: TNF-α induction downregulated GLCCI1 in vitro, while GLCCI1 overexpression reduced TNF-α levels in vivo. We hypothesize that in early asthma, TNF-α simultaneously promotes EMT and airway remodeling by suppressing GLCCI1 expression and disrupting its normal regulation of the PI3K/AKT/mTOR pathway. Concurrently, downregulation of GLCCI1 may lose its negative control over TNF-α transcription by impairing AKT signaling's ability to inhibit the NF-κB pathway. Together, these mechanisms form a vicious cycle that drives disease progression. Our study demonstrated that GLCCI1 overexpression disrupted this negative feedback loop, restoring airway homeostasis. Elucidation of this mechanism provides a novel perspective on the pathophysiological process of mutual reinforcement between inflammation and structural abnormalities in asthma, laying a theoretical foundation for developing disease-modifying therapies targeting GLCCI1.

The mechanisms underlying GLCCI1 downregulation and its subsequent activation of the PI3K/AKT/mTOR pathway represent a significant scientific inquiry within our study. TNF‑α may suppress GLCCI1 expression through inflammation‑mediated transcriptional repression or epigenetic modifications, such as NF‑κB‑dependent recruitment of histone deacetylases to the GLCCI1 promoter region [32]. Concurrently, as a glucocorticoid pathway‑associated molecule, GLCCI1 may activate the PI3K/AKT/mTOR pathway through several potential mechanisms: first, by directly interacting with regulatory subunits of PI3K, thereby enhancing PI3K membrane recruitment and activation [33]; second, GLCCI1 may restore and maintain signaling pathway activity by inhibiting PINK1-mediated mitochondrial autophagy [7], thereby alleviating its negative regulation of the PI3K/AKT/mTOR pathway. These plausible mechanisms provide a direction for further research to elucidate the precise regulatory network through which GLCCI1 influences airway remodeling in asthma.

Extensive research indicates that the PI3K/AKT/mTOR pathway is typically activated in asthma [34, 35]. However, this study found that the phosphorylation levels of key proteins in this pathway were significantly reduced in OVA-induced asthmatic mice and in BEAS-2B cells treated with long-term TNF-α, suggesting its activity is suppressed. This observation aligns with Zou et al.'s report, which similarly demonstrated that PI3K/AKT/mTOR pathway activation alleviates asthma symptoms and that LY294002 reverses this protective effect [36]. The reasons for this discrepancy may be as follows: First, TNF-α stimulation may exert feedback inhibition on PI3K/AKT/mTOR signaling through pathways such as IκB kinase activation [37]. Second, the antagonistic interaction between the PI3K/AKT/mTOR pathway and the excessive autophagy activation commonly observed in asthma airway remodeling may further attenuate the signaling output of this pathway [10]. Moreover, in acute stimuli or tumor models, excessive activation of this pathway often drives pathological EMT. Conversely, in the chronic asthma inflammatory environment simulated in this study, the pathway may be functionally suppressed or depleted due to prolonged inflammatory stress. These mechanisms collectively lead to reduced PI3K/AKT/mTOR pathway activity in chronic inflammation. GLCCI1 may restore pathway function by regulating these components, thereby inhibiting EMT.

ZEB1 is one of the important regulators of EMT, and it participates in the progression of various diseases by mediating EMT [14, 38]. For instance, DCAF15 suppresses ZEB1 expression through the ubiquitin–proteasome pathway and blocks the process of EMT, thereby exerting antitumor effect in hepatocellular carcinoma [39]. Aspirin facilitates trophoblast invasion and ZEB1-mediated EMT by inhibiting the expression of miR-200, which contributes to alleviating preeclampsia [40]. ZEB1 is an activator of the EMT process [41]. This work uncovered that ZEB1 was up-regulated in asthmatic mice. ZEB1 up-regulation reversed the influence of GLCCI1 overexpression on airway remodeling and EMT in asthmatic mice. A previous study has demonstrated that ZEB1 recruits Brg1 to regulate EMT in TGF-β-induced human bronchial epithelial cells, which participates in the development of asthma [42]. These findings are consistent with the present work. Thus, ZEB1 might be a new therapeutic target for asthma.

In summary, this work demonstrated that GLCCI1 overexpression inhibited ZEB1-mediated epithelial-mesenchymal transition by activating PI3K/AKT/mTOR signaling pathway, thereby alleviating airway remodeling in asthmatic mice. Thus, this study suggests that GLCCI1 may be a potential target for asthma treatment.

Abbreviations

BALF

Bronchoalveolar lavage fluid

BEAS-2B

Bronchial Epithelium transformed with Ad12-SV40 2B

CtBP

C-terminal binding protein

DMEM

Dulbecco's modified Eagle medium

ELISA

Enzyme-linked immunosorbent assay

EMT

Epithelial-mesenchymal transition

FBS

Fetal bovine serum

GLCCI1

Glucocorticoid-induced transcript 1

H&E

Hematoxylin and eosin

IF

Immunofluorescence

IHC

Immunohistochemistry

OVA

Ovalbumin

siRNA

Small interfering RNA

ZEB1

Zinc finger E-box binding homeobox 1

Authors’ contributions

Q Y: Conceptualization, Data Curation, Methodology, Validation, Formal Analysis, Investigation, Writing-original draft, Writing-Review and Editing. W W: Methodology, Investigation, Writing-original draft, Writing-Review and Editing. G F Z: Investigation, Writing-Review and Editing. H X: Methodology, Writing-Review and Editing. Q F X: Conceptualization, Writing-Review and Editing, Funding acquisition, Supervision.

Funding

This study was supported by the Science and Technology Project Funded by the Education Department of Jiangxi Province (No. GJJ200195) and Natural Science Foundation of Jiangxi Province (No. 20212BAB216046).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

All procedures were conducted with the approval of the Ethics Committee guidelines and Animal Ethics Standards of Second Affiliated Hospital of Nanchang University (the approval number: NCUSYDWFL-2020–149), and conformed to the care and handling of animals as outlined in the Canadian Council on Animal Care’s Guide to the Care and Use of Experimental Animals.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.