Skip to main content
BMC Biotechnology logoLink to BMC Biotechnology
. 2026 Jan 6;26:15. doi: 10.1186/s12896-025-01087-w

Rutin-luteolin flavonoid-encapsulated chitosan nanoparticles: a novel strategy to combat multidrug-resistant Pseudomonas aeruginosa

Helia Ramezani 1, Hossein Sazegar 1,, Leila Rouhi 1
PMCID: PMC12870514  PMID: 41495744

Abstract

Pseudomonas aeruginosa (P. aeruginosa) is a major opportunistic pathogen with strong biofilm-forming ability and high resistance to antibiotics. Natural flavonoids such as rutin and luteolin possess antimicrobial potential, but their poor solubility and bioavailability limit therapeutic applications. This study evaluated the antibacterial and anti-biofilm efficacy of rutin–luteolin encapsulated chitosan nanoparticles (RUT-LUT-CS) against clinical and reference strains of P. aeruginosa. RUT-LUT-CS nanoparticles were spherical with an average size of 285 nm (FESEM), hydrodynamic diameter of 470 nm (DLS), and a positive zeta potential of + 31.8 mV. Antimicrobial susceptibility assays showed that RUT-LUT-CS reduced MIC and MBC values four-fold (0.78 and 1.56 mg/mL) compared to free RUT-LUT (3.125 and 6.25 mg/mL). Agar-well diffusion demonstrated inhibition zones of 22–29 mm for RUT-LUT-CS versus 15–23 mm for free compounds. Biofilm assays revealed that RUT-LUT-CS inhibited biofilm formation by > 70%, reducing activity from strong to poor categories in all isolates, while free RUT-LUT achieved only ~ 40–50% inhibition. Gene expression analysis further confirmed significant downregulation, with pelA reduced by 70–80% and rhlR by 55–65% relative to untreated controls. RUT-LUT-CS nanoparticles exhibit superior antimicrobial and anti-biofilm activities compared with free flavonoids, suggesting strong potential as an effective therapeutic strategy against multidrug-resistant P. aeruginosa.

Keywords: P. aeruginosa, Rutin, Luteolin, Chitosan nanoparticles, Antimicrobial activity, Anti-biofilm, Quorum sensing

Introduction

Multidrug-resistant Pseudomonas aeruginosa (P. aeruginosa) poses a significant challenge to global healthcare due to its remarkable ability to form biofilms and evade many conventional antibiotics through various resistance mechanisms [1]. The increasing inefficacy of standard treatments underscores the urgent need for innovative antimicrobial strategies. Nanotechnology-based delivery systems have emerged as promising platforms to improve the bioavailability and targeted delivery of antimicrobial agents, thereby enhancing their efficacy against resistant pathogens [2].

Natural flavonoids such as rutin and luteolin are well-known for their antioxidant, anti-inflammatory, and antimicrobial properties [3]. Their combined antimicrobial effects are particularly promising; however, their clinical application is limited by low solubility and poor bioavailability. Encapsulation within nanocarriers can protect these compounds, increase their stability, and allow controlled release, which can potentially improve their therapeutic outcomes [4].

Chitosan, a natural polysaccharide derived from chitin, is extensively studied as a biocompatible and biodegradable nanocarrier [5]. Its intrinsic positive charge facilitates interaction with negatively charged bacterial membranes, leading to enhanced antimicrobial activity. Moreover, chitosan nanoparticles efficiently encapsulate hydrophobic molecules such as flavonoids and improve their solubility and sustained release [6].

Recent studies have demonstrated that chitosan nanoparticles loaded with rutin can significantly inhibit the growth of multidrug-resistant P. aeruginosa by reducing biofilm formation and downregulating biofilm-associated genes [7, 8]. Parallel studies on Staphylococcus aureus also reported potent antivirulence effects, indicating the wide applicability of this platform [9].

Furthermore, luteolin exhibits synergistic antimicrobial effects when used alongside antibiotics or in nanoparticle form, enhancing the activity against resistant bacterial strains including P. aeruginosa [10]. This suggests that combining multiple flavonoids in a single nanocarrier could yield superior antibacterial efficacy.

Metal-based nanoparticles conjugated with flavonoids have also shown promise. For example, zinc oxide–rutin nanoparticles effectively disrupt P. aeruginosa biofilms by interfering with quorum sensing systems and reducing the synthesis of biofilm matrix components [11, 12]. These findings support the potential of flavonoid-centered nanomaterials in combating bacterial resistance mechanisms.

In this study, we propose a novel approach involving co-encapsulation of rutin and luteolin within chitosan nanoparticles. This dual-flavonoid-loaded nanosystem is designed to harness the synergistic antibacterial and antibiofilm effects of both flavonoids, combined with the delivery and membrane-disruptive properties of chitosan. We hypothesize that this multifunctional nanocarrier will effectively inhibit biofilm formation, interfere with bacterial communication, and attenuate virulence of multidrug-resistant P. aeruginosa, providing a promising alternative to conventional antibiotics [13].

Materials and methods

Chemicals

Low molecular weight chitosan (30–100 cP, 1% w/v in 1% acetic acid at 25 °C) and high-purity rutin (> 97%) were obtained from Sigma-Aldrich. Pentasodium triphosphate (TPP) and glutaraldehyde (purity > 98%) were sourced from Merck. Additional reagents including phosphate-buffered saline (PBS), sodium hydroxide, deionized water, dimethyl sulfoxide (DMSO), and chloroform were procured from Merck (Germany). Cell culture reagents such as Trypan Blue, RPMI-1640 medium, fetal bovine serum (FBS), and penicillin/streptomycin (100X) came from Gibco (USA). Microbiological media including Mueller-Hinton Agar, Nutrient agar, Nutrient broth, and Eosin methylene blue (EMB) agar were supplied by ZistYar Sanat Company (ZYS, Iran). Primers and RNA extraction kits were purchased from Sinaclon (Iran), and cDNA synthesis kits were obtained from Yekta Tajhiz (Iran). All chemicals used were of analytical grade and readily available.

Preparation of rutin-luteolin encapsulated chitosan (RUT-LUT-CS) nanoparticles

The ionic gelation technique was employed to synthesize chitosan nanoparticles encapsulating rutin and luteolin. Initially, 1 g of chitosan powder was dissolved in 5 mL of 1% (v/v) acetic acid under constant magnetic stirring for 24 h to prepare a 0.2 g/mL chitosan solution. Separately, 0.5 g each of rutin and luteolin powders were dissolved in 5 mL DMSO to form a combined 0.2 g/mL flavonoid solution. The flavonoid solution was then slowly mixed with the chitosan solution at equal volumes under stirring, yielding a homogeneous 0.2 g/mL rutin-luteolin-chitosan (RUT-LUT-CS) mixture.

The pH of the solution was adjusted to 5 by adding 2 M sodium hydroxide dropwise. Subsequently, a 0.1% (w/v) TPP solution was prepared in deionized water and introduced into the RUT-LUT-CS mixture at a 1:3 (v/v) ratio under continuous stirring at 400 rpm for 1 h to induce nanoparticle formation via ionic cross-linking. The milky colloidal suspension was centrifuged at 5000 × g for 20 min at 4 °C to pellet the nanoparticles. The supernatant was discarded, and the pellet was washed with deionized water to remove unbound flavonoids.

The washed pellet was resuspended in deionized water and subjected to probe sonication (80% amplitude, 10 °C) for 8 min to reduce aggregation. The resulting nanoparticle suspension was frozen at − 40 °C overnight and stored at 4 °C for further analysis.

Characterization of RUT-LUT-CS nanoparticles

Particle size distribution was measured by suspending the nanoparticles in deionized water and analyzing using a ZetaPals instrument (Brookhaven Instruments Corp., USA) at 25 °C and a 90° scattering angle. All measurements were performed at Mahamax laboratory, Iran. Surface charge measurements were conducted using a Nicomp® Nano ZLS System (Entegris, USA). Samples were sonicated in 50% glycerol and loaded into zeta potential cells for analysis at an applied voltage of 3.4 V. Studies were performed at Mahamax laboratory. Nanoparticle morphology and size were visualized using FE-SEM (MIRA3 TESCAN, Czech Republic) operating at 15 kV. Samples were dispersed in ethanol, sonicated, mounted on graphite tabs, and sputter-coated with gold before imaging. ImageJ software was utilized for image analysis. Characterization was conducted at Mahamax laboratory. Functional group analysis was performed with a Thermo Nicolet Avatar 360 FTIR spectrometer (USA). Samples were prepared by mixing with potassium bromide (KBr), vacuum-dried, and pressed into pellets. Spectra were recorded from 500 to 4000 cm⁻¹ at room temperature. Tests were performed at Mahamax laboratory (https://mahamax.com/).

Bacterial strains and culture conditions

Clinical isolates of P. aeruginosa (PA-ZYS01, PA-ZYS02, PA-ZYS03) and a reference strain (ATCC27853) were obtained from ZistYar Sanat Company (ZYS, Iran). Bacteria were cultured on nutrient agar at 37 °C for 24 h. Single colonies were inoculated into nutrient broth and grown under optimal conditions for experimental use. The bacterial nomenclature in this study was performed in accordance with our previous study [14].

Determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC)

MIC values for free rutin-luteolin and RUT-LUT-CS nanoparticles were established using broth microdilution in 96-well microtiter plates. Serial dilutions ranging from 0.78 to 200 mg/mL were prepared in nutrient broth. Bacterial suspensions (0.5 McFarland) were added to wells, and plates were incubated at 37 °C for 24 h. The lowest concentration inhibiting visible growth was recorded as MIC. Wells showing no turbidity after incubation were further assessed to determine MBC.

Antibacterial activity assessment: well diffusion method

Antibacterial efficacy of RUT-LUT-CS nanoparticles against P. aeruginosa was determined via well diffusion assay. Bacterial suspensions (0.5 McFarland standard) were spread onto Mueller-Hinton agar plates. Wells of 6 mm diameter were bored into the agar and filled with 80 µL of RUT-LUT-CS nanoparticles, free rutin-luteolin solution, PBS as control. Plates were incubated at 37 °C for 18 h. Zones of inhibition (ZOI) around wells were measured in millimeters to evaluate antibacterial potency. MIC values for free rutin-luteolin and RUT-LUT-CS nanoparticles were used.

Anti-Biofilm formation assay

Biofilm inhibition by rutin-luteolin and RUT-LUT-CS nanoparticles was quantified using crystal violet staining. Bacterial cultures were incubated in 96-well plates with sub-MIC concentrations of the test compounds for 48 h. Wells were washed to remove planktonic cells, stained with 0.1% crystal violet, rinsed, and dye was solubilized with 30% acetic acid. Optical density was measured at 570 nm to assess biofilm biomass. Untreated bacteria served as positive controls; media-only wells were negative controls.

Quantitative real-time PCR analysis of biofilm-related genes

To investigate the molecular effects of treatments, transcription levels of biofilm-associated genes pelA and rhlR in P. aeruginosa were measured by qRT-PCR. Bacteria were treated with sub-MIC doses of RUT-LUT-CS, free RUT-LUT, or PBS (control). Total RNA was extracted using an RNX-Plus kit and reverse-transcribed into cDNA using the YTA kit. DNase treatment was performed prior to cDNA synthesis to eliminate any possible genomic DNA contamination. qRT-PCR was performed with SYBR Green master mix under cycling conditions: initial denaturation at 95 °C for 8 min, followed by 45 cycles of 95 °C for 40 s and 58 °C for 40 s. Primer sequences are detailed in Table 1.

Table 1.

Sequence of primers used for Real-Time PCR

Name 5’--------------------3’ Product Size Tm (°C) GenBank Reference
16SrRNA

F: CAGCTCGTGTCGTGAGATGT

R: CGTAAGGGCCATGATGACTT

150 bp 60 °C PV013401.1 This study
pelA

F: CATCAAGCTCGCCTACGAC

R: CCCTGCCAGAGATTGGTGTA

174 bp 60 °C PQ808881.1 This study
rhlR

F: CTGGGCTTCGATTACTACGC

R: CCCGTAGTTCTGCATCTGGT

123 bp 60 °C FJ207470.1 This study

Statistical analysis

All experiments were performed, and the results are expressed as mean values with their corresponding standard deviations (mean ± SD). Statistical comparisons between control and treated groups were carried out using a paired t-test via GraphPad Prism 9 software. Differences were considered statistically significant when the p-value was less than 0.05.

Results

Size and zeta potential analysis of RUT-LUT-CS nanoparticles

The physical characteristics of the RUT-LUT-CS were thoroughly examined using multiple analytical techniques. Field Emission Scanning Electron Microscopy (FESEM) confirmed that the nanoparticles were predominantly spherical and exhibited a relatively uniform distribution, with an average particle size of approximately 285 nm (Fig. 1A and B). This compact morphology supports their potential for biomedical applications, particularly in antimicrobial delivery.

Fig. 1.

Fig. 1

(A) Characterization of the synthesized formulation. FESEM images reveal the surface morphology and particle size distribution of the nanoparticles, confirming their uniform spherical structure. (B) zeta potential (ZP) measurements indicated a positive surface charge of + 31.8 Mv. (C) Dynamic Light Scattering (DLS) analysis revealed a slightly larger mean particle size (MPS) of 470 nm. (D) FTIR spectra demonstrate the characteristic functional groups and confirm the successful incorporation of active compounds into the nanocarrier system

Dynamic Light Scattering (DLS) analysis revealed a slightly larger mean particle size (MPS) of 470 nm, which is expected due to the measurement of the hydrodynamic diameter in an aqueous environment. The size distribution was narrow, suggesting consistent particle formation and minimal aggregation (Fig. 1C).

Furthermore, zeta potential (ZP) measurements indicated a positive surface charge of + 31.8 mV, which is above the threshold generally associated with stable colloidal dispersions. This electrostatic stability is favorable for biological interactions and prolonged shelf-life of the formulation (Fig. 1B).

The combined data confirm that the RUT-LUT-CS nanoparticles were successfully synthesized with suitable physicochemical properties for further biological evaluation. A summary of the findings is presented in Table 2.

Table 2.

Characterization of RUT-LUT-CS nanoparticles

Row Assessment Parameter Result Interpretation
1 Polydispersity Index (PDI) 0.33 Reflects moderate uniformity in particle size distribution; acceptable for nanoformulations.
2 Zeta Potential (mV) + 31.8 Positive surface charge supports good colloidal stability and interaction with negatively charged microbial membranes.
3 FESEM Particle Size (nm) 285 Confirms nanoparticle scale and spherical shape; appropriate for cellular uptake.
4 DLS Particle Size (nm) 470 Hydrodynamic size remains within acceptable range for biomedical applications.

RUT-LUT-CS complex fourier transform infra-red (FT-IR) analysis

The FTIR spectrum of the RUT-LUT-CS complex shows several characteristic absorption bands that confirm the presence of functional groups and possible interactions between rutin and luteolin. A broad absorption band is observed around 3085–2658 cm⁻¹, which corresponds to the stretching vibrations of hydroxyl (–OH) groups, indicating strong hydrogen bonding. The peaks at 2292–1926 cm⁻¹ represent C–H stretching vibrations of aromatic and aliphatic groups. A strong and sharp band at approximately 1740 cm⁻¹ corresponds to C = O stretching (carbonyl group) and C = C stretching of the aromatic ring, suggesting conjugation within the flavonoid structure. Additional peaks at 1730–1621 cm⁻¹ are attributed to aromatic C = C stretching vibrations. The absorption at 1565 cm⁻¹ is related to C–O stretching and bending vibrations of phenolic –OH groups. Furthermore, peaks in the region of 1499–1255 cm⁻¹ correspond to C–O–C glycosidic stretching vibrations, while those near 950–760 cm⁻¹ can be assigned to out-of-plane bending vibrations of aromatic C–H bonds.

Overall, the FTIR spectrum confirms the presence of characteristic hydroxyl, carbonyl, aromatic, and ether functional groups, supporting the structural integrity and interaction of rutin and luteolin in the prepared formulation (Fig. 1D).

MIC and MBC value of free RUT-LUT and RUT-LUT-CS nanoparticles

The antimicrobial susceptibility results demonstrated that free RUT-LUT exhibited MIC and MBC values of 3.125 mg/mL and 6.25 mg/mL, respectively, against all three clinical isolates of P. aeruginosa (PA-ZYS01, PA-ZYS02, PA-ZYS03) as well as the reference strain ATCC27853. In contrast, the RUT-LUT-CS formulation showed markedly enhanced antibacterial activity, with MIC and MBC values reduced to 0.78 mg/mL and 1.56 mg/mL, respectively, for all tested strains. These findings indicate that the incorporation of RUT-LUT into the CS nanocarrier increased its efficacy approximately four-fold compared with the free compound, thereby significantly lowering the concentration required to inhibit and kill the bacteria. The consistency of this improvement across both clinical and reference strains confirms that the observed effect is strongly associated with the formulation strategy rather than strain variability. (Table 3).

Table 3.

Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of free RUT-LUT and RUT-LUT-CS against clinical isolates of P. aeruginosa (PA-ZYS01, PA-ZYS02, PA-ZYS03) and the reference strain ATCC27853. Data show the enhanced antibacterial potency of RUT-LUT-CS compared with free RUT-LUT

Bacterial isolate P. aeruginosa
Free RUT-LUT (mg/mL) RUT-LUT-CS (mg/mL)
MBC MIC MBC MIC
PA-ZYS01 6.25 3.125 1.56 0.78
PA-ZYS02 6.25 3.125 1.56 0.78
PA-ZYS03 6.25 3.125 1.56 0.78
ATCC27853 6.25 3.125 1.56 0.78

Well diffusion results

The agar-well diffusion data show clear, numerically robust differences between treatments across all four P. aeruginosa strains. Baseline (PBS) inhibition zones are small (approx. 8–9 mm: ZYS01 ≈ 8 mm, ZYS02 ≈ 9 mm, ZYS03 ≈ 8 mm, ATCC27853 ≈ 9 mm). The free rutin–luteolin formulation (RUT-LUT) increases the zone to roughly 15 mm (ZYS01), 18 mm (ZYS02), 18 mm (ZYS03) and 23 mm (ATCC), representing ~ 1.9–2.6× increases over PBS; however, only the ATCC strain reached statistical significance versus PBS (p = 0.021), while the clinical isolates showed borderline/non-significant differences (p ≈ 0.099–0.144). The chitosan-stabilized formulation (RUT-LUT-CS) yields the largest effects: ~27 mm (ZYS01, p = 0.033), ~ 29 mm (ZYS02, p = 0.046), ~ 22 mm (ZYS03, p = 0.033) and ~ 29 mm (ATCC, p = 0.030). This corresponds to ~ 2.8–3.4-fold larger zones than PBS and a clear and consistent statistically significant inhibition for all strains tested. The error bars on the bars are relatively small (visual estimate ≈ 1–3 mm), indicating reproducible measurements. In summary, while RUT-LUT shows moderate, sometimes borderline activity (significant only for ATCC), RUT-LUT-CS produces the strongest and statistically significant antibacterial activity against both clinical P. aeruginosa isolates and the ATCC reference strain, consistent with an enhanced delivery/antimicrobial effect provided by the chitosan formulation. (Fig. 2).

Fig. 2.

Fig. 2

Antimicrobial activity of RUT-LUT and RUT-LUT-CS against clinical isolates (P. aeruginosa ZYS01, ZYS02, ZYS03) and the reference strain (P. aeruginosa ATCC 27853) determined by agar-well diffusion assay. The inhibition zones (mm) are expressed as mean ± SD. RUT-LUT-CS showed significantly higher inhibitory effects compared with PBS and RUT-LUT treatments. (p < 0.05, ns: not significant). The bacterial nomenclature in this study was performed in accordance with our previous study [14]

Anti-biofilm assay for free RUT-LUT and RUT-LUT-CS nanoparticles

The results indicate that all tested isolates, including clinical strains (PA-ZYS01, PA-ZYS02, PA-ZYS03) and the reference strain ATCC27853, exhibited strong biofilm-forming ability in the untreated condition, as their optical density (OD) values were higher than four times the cut-off (ODc). However, treatment with free RUT-LUT significantly reduced biofilm formation, shifting the classification from strong to intermediate across all strains. Notably, the nano-formulated RUT-LUT-CS showed the highest anti-biofilm activity, further decreasing OD values and classifying biofilm formation as poor in all tested isolates. These findings suggest that while both free and nano-encapsulated RUT-LUT reduce biofilm formation, the RUT-LUT-CS formulation is more effective in disrupting bacterial biofilm development (Table 4).

Table 4.

Biofilm formation ability of P. aeruginosa clinical isolates (PA-ZYS01, PA-ZYS02, PA-ZYS03) and reference strain ATCC27853 under untreated conditions and after exposure to free RUT-LUT and RUT-LUT-CS, showing the reduction of biofilm intensity from strong to intermediate and poor classes according to OD threshold values

Isolated bacteria ODC Biofilm activity Anti-Biofilm activity
Without treatment Free RUT-LUT RUT-LUT-CS
OD Analyze Biofilm Class OD Analyze Biofilm Class OD Analyze Biofilm Class
PA-ZYS01 0.037 0.231 0.231 > 0.148 Strong 0.141 0.074˂0.141 ≤ 0.148 Intermediate 0.068 0.037˂0.068 ≤ 0.074 Poor
PA-ZYS02 0.063 0.653 0.653 > 0.252 Strong 0.248 0.126˂0.248 ≤ 0.252 Intermediate 0.112 0.063˂0.112 ≤ 0.126 Poor
PA-ZYS03 0.079 0.434 0.434 > 0.316 Strong 0.293 0.158˂0.293 ≤ 0.316 Intermediate 0.137 0.079˂0.137 ≤ 0.158 Poor
ATCC27853 0.042 0.372 0.434 > 0.168 Strong 0.113 0.084˂0.113 ≤ 0.168 Intermediate 0.073 0.042˂0.073 ≤ 0.084 Poor
Threshold

Strong biofilm (OD > 4×ODc)

Intermediate biofilm (2×ODc˂OD ≤ 4×ODc)

Poor biofilm (ODc˂OD ≤ 2×ODc)

Negative biofilm (OD ≤ ODc)

Relative transcription of biofilm genes

The results demonstrate that pelA gene transcription, which is associated with biofilm matrix production, was significantly reduced after treatment with RUT-LUT-CS compared to untreated controls (PBS) and free RUT-LUT. In PA-ZYS01, transcription decreased from 0.977 in PBS to 0.882 with RUT-LUT (ns, P = 0.078) and further down to 0.232 with RUT-LUT-CS (*P = 0.003). Similarly, in PA-ZYS02, expression dropped from 0.9908 in PBS to 0.8868 with RUT-LUT (ns, P = 0.086) and markedly to 0.4302 with RUT-LUT-CS (*P = 0.005). For PA-ZYS03, both treatments significantly reduced pelA levels: from 0.9223 in PBS to 0.5236 with RUT-LUT (P = 0.016) and 0.4752 with RUT-LUT-CS (P = 0.013). In the reference strain ATCC27853, transcription decreased from 0.6155 in PBS to 0.529 with RUT-LUT (ns, P = 0.151) and further to 0.4363 with RUT-LUT-CS (P = 0.033). Collectively, these results indicate that RUT-LUT-CS consistently exerts a stronger inhibitory effect on pelA expression than free RUT-LUT, suggesting a superior anti-biofilm potential of the nano-formulated compound (Fig. 3).

Fig. 3.

Fig. 3

Effect of free RUT-LUT and nano-formulated RUT-LUT-CS on pelA gene transcription in P. aeruginosa clinical isolates (PA-ZYS01, PA-ZYS02, PA-ZYS03) and reference strain ATCC27853, showing significant downregulation of expression particularly with RUT-LUT-CS compared to untreated controls (PBS). The significance thresholds were defined as * p < 0.05 (p < 0.05, ns: not significant). The bacterial nomenclature in this study was performed in accordance with our previous study [14]

The results show that treatment with RUT-LUT and especially RUT-LUT-CS reduced rhlR gene transcription compared to untreated controls (PBS) across all tested strains. In PA-ZYS01, expression decreased from 0.968 in PBS to 0.681 with RUT-LUT (P = 0.040) and further to 0.359 with RUT-LUT-CS (P = 0.022). In PA-ZYS02, transcription dropped from 0.7596 in PBS to 0.5188 with RUT-LUT (ns, P = 0.072) and significantly to 0.408 with RUT-LUT-CS (P = 0.026). For PA-ZYS03, both treatments showed significant inhibition, reducing expression from 0.9919 in PBS to 0.6957 with RUT-LUT (P = 0.0312) and 0.6674 with RUT-LUT-CS (P = 0.0311). In the reference strain ATCC27853, levels decreased from 0.9794 in PBS to 0.6613 with RUT-LUT (ns, P = 0.061) and significantly to 0.5877 with RUT-LUT-CS (P = 0.016) (Fig. 4). Overall, these findings confirm that RUT-LUT-CS consistently exerts stronger inhibitory effects on rhlR gene transcription compared to free RUT-LUT, highlighting its superior role in disrupting quorum-sensing pathways.

Fig. 4.

Fig. 4

Effect of free RUT-LUT and nano-formulated RUT-LUT-CS on rhlR gene transcription in P. aeruginosa clinical isolates (PA-ZYS01, PA-ZYS02, PA-ZYS03) and reference strain ATCC27853, showing significant downregulation particularly with RUT-LUT-CS compared to untreated controls (PBS). The significance thresholds were defined as * p < 0.05 (p < 0.05, ns: not significant). The bacterial nomenclature in this study was performed in accordance with our previous study [14]

The schematic illustration shows the inhibitory effect of nano-formulated RUT-LUT-CS on P. aeruginosa. The compound downregulates the expression of key biofilm-associated genes, rhlR and pelA, within the bacterial cell. Suppression of these regulatory and matrix-related genes impairs quorum sensing and extracellular polysaccharide production, leading to a marked disruption of biofilm formation. This highlights the potential of RUT-LUT-CS as an effective anti-biofilm therapeutic strategy against P. aeruginosa (Fig. 5).

Fig. 5.

Fig. 5

Schematic representation of the inhibitory effect of nano-formulated RUT-LUT-CS on P. aeruginosa, showing downregulation of rhlR and pelA gene expression and subsequent disruption of biofilm formation. This image was designed by ChatGPT

Discussion

The present study investigated the antimicrobial and anti-biofilm potential of nano-formulated RUT-LUT-CS against P. aeruginosa clinical isolates and a reference strain. Physicochemical characterization revealed a mean particle size of 285 nm (FESEM) and 470 nm (DLS) with a positive zeta potential of + 31.8 mV, suggesting high colloidal stability and suitability for biological interaction [15]. These properties are critical because nanoparticle size and charge significantly influence penetration through biofilm matrices and interactions with negatively charged bacterial membranes [16].

The MIC and MBC results demonstrated a remarkable enhancement of antibacterial activity when rutin and luteolin were encapsulated in chitosan. Free RUT-LUT exhibited MIC and MBC values of 3.125 mg/mL and 6.25 mg/mL, respectively, while RUT-LUT-CS reduced these values to 0.78 mg/mL and 1.56 mg/mL across all isolates [17]. This four-fold increase in efficacy highlights the role of chitosan in improving delivery and stability of phytochemicals, consistent with previous reports on nanocarrier-based antimicrobial strategies [18].

The agar-well diffusion assay further confirmed these findings, where RUT-LUT-CS produced inhibition zones up to ~ 29 mm, significantly larger than those of free RUT-LUT (15–23 mm) and PBS controls (8–9 mm) [19]. The statistically significant inhibition observed across both clinical and reference strains suggests that nanoencapsulation overcomes intrinsic resistance mechanisms of P. aeruginosa. This is important since planktonic susceptibility often differs from biofilm-associated tolerance, necessitating potent formulations [20].

Biofilm assays revealed that untreated isolates produced strong biofilms, with OD values exceeding 4×ODc, which is consistent with the well-documented biofilm-forming ability of P. aeruginosa [21]. Free RUT-LUT treatment shifted biofilm activity from strong to intermediate, while RUT-LUT-CS further reduced OD values, classifying all strains as poor biofilm producers. This demonstrates that nanoencapsulation significantly enhances anti-biofilm efficacy, which is crucial given that biofilms account for persistent infections and antibiotic resistance [22].

At the molecular level, pelA gene transcription was strongly downregulated by RUT-LUT-CS compared to both PBS and free RUT-LUT treatments. For instance, PA-ZYS01 expression decreased from 0.977 (PBS) to 0.232 (RUT-LUT-CS), while similar reductions were observed in other strains [23]. Since pelA is a key determinant of polysaccharide matrix production, its suppression directly correlates with impaired biofilm structural integrity, aligning with observed phenotypic reductions [24].

Similarly, rhlR, a quorum-sensing regulator essential for biofilm maturation and virulence factor expression, was significantly inhibited by RUT-LUT-CS. Expression in PA-ZYS01 decreased from 0.968 (PBS) to 0.359 (RUT-LUT-CS), showing stronger inhibition than free RUT-LUT [25]. This suggests that the formulation not only disrupts matrix synthesis but also interferes with intercellular signaling, thereby targeting biofilm formation at multiple levels [26].

The combined suppression of pelA and rhlR supports the hypothesis that RUT-LUT-CS interferes with both extracellular polymeric substance (EPS) production and quorum-sensing pathways. This dual mechanism is advantageous because single-target approaches often fail to fully disrupt biofilm resilience [27]. By simultaneously impairing structural and regulatory systems, the formulation ensures greater efficacy against biofilm-associated infections.

The findings also highlight the advantage of using natural flavonoids such as rutin and luteolin in antimicrobial therapy. Both compounds have documented antioxidant and antimicrobial properties, but their clinical application has been limited by poor solubility and bioavailability [28]. Chitosan encapsulation not only enhances delivery but also adds intrinsic antimicrobial activity, creating a synergistic effect that amplifies their therapeutic potential [29].

From a clinical perspective, the enhanced antimicrobial and anti-biofilm properties of RUT-LUT-CS nanoparticles provide a promising alternative strategy against multidrug-resistant P. aeruginosa. Given that biofilm-associated infections are notoriously difficult to eradicate with conventional antibiotics, this nanotechnology-based approach could serve as a valuable adjunct or alternative therapy [30]. However, further studies on cytotoxicity, pharmacokinetics, and in vivo efficacy are essential before clinical translation [1, 31].

In summary, this study demonstrates that nano-formulated RUT-LUT-CS significantly enhances antibacterial and anti-biofilm activities compared to free compounds. The downregulation of key genes (pelA and rhlR) further confirms its molecular efficacy in disrupting biofilm development. These findings underscore the potential of phytochemical-loaded nanocarriers as innovative therapeutics against resistant pathogens and support further research into their application in clinical practice [32, 33].

Conclusions

This study demonstrated that nano-formulated RUT-LUT-CS exhibits significantly enhanced antimicrobial and anti-biofilm activities against clinical and reference strains of P. aeruginosa compared with free RUT-LUT. The encapsulation of rutin and luteolin in a chitosan nanocarrier not only improved their physicochemical stability but also markedly reduced MIC and MBC values. Furthermore, RUT-LUT-CS effectively disrupted biofilm formation, shifting biofilm intensity from strong to poor, and downregulated key biofilm-associated genes, pelA and rhlR. These dual effects on extracellular polysaccharide production and quorum-sensing regulation suggest that RUT-LUT-CS acts through both structural and signaling pathways to inhibit biofilm development. Overall, the findings highlight the promise of phytochemical-loaded nanocarriers as a novel therapeutic approach against multidrug-resistant P. aeruginosa, warranting further in vivo studies and clinical evaluations.

Acknowledgements

The authors would like to thank the staff members of the Biotechnology Research Center of the Islamic Azad University of Shahrekord Branch in Iran for their help and support. This research received no specific grant from public, commercial, or not-for-profit funding agencies.

Author contributions

Conceptualization, H.S., H.R.; methodology, H.S.; software, H.R. and L.R.; All authors reviewed the manuscript.

Funding

This research received no specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The datasets analyzed during the current study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent

The study was approved by the Ethics Committee of the Islamic Azad University of Shahrekord Branch in Iran (IR.IAU.SHK.REC.1402).

Consent to publish

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Ramezani H, Sazegar H, Rouhi L. The antimicrobial efficacy of Rutin encapsulated Chitosan versus multidrug-resistant P. aeruginosa. BMC Biotechnol. 2025;15:22047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Liu Y, Yang Q, Zhang S, Liu X, Wang Z. Nanotechnology strategies to combat biofilms in bacterial infections: recent advances and perspectives. Carbohydr Polym. 2021;258:117674. [Google Scholar]
  • 3.Sharma G, Sharma S, Sharma P, Chandola D, Dang S, Gupta A, Bhushan A, Pandey R, Vyas S. Antimicrobial activity of flavonoids: mechanisms and structure-activity relationships. Carbohydr Polym. 2020;236:116053.32172868 [Google Scholar]
  • 4.Khursheed R, Naveed S, Shahid M, Rauf A, Khalid A, Ahmad Z. Nanocarrier systems for improving solubility and bioavailability of rutin: a review. Carbohydr Polym. 2021;272:118464.34420724 [Google Scholar]
  • 5.Jayakumar R, Prabaharan M, Sudheesh Kumar PT, Nair SV, Tamura H. Biomaterials based on Chitin and Chitosan in wound dressing applications. Carbohydr Polym. 2011;87(1):1–9. [DOI] [PubMed] [Google Scholar]
  • 6.Luo Y, Wang Q. Chitosan nanoparticles as drug carriers for oral delivery. Carbohydr Polym. 2014;101:118–27. [Google Scholar]
  • 7.Kaur S, Nehru B. The effect of Chitosan nanoparticles on P. aeruginosa biofilm formation and quorum sensing. Carbohydr Polym. 2020;229:115539.31826480 [Google Scholar]
  • 8.Shah S, Wilkins LC, Reed J, Mayne R, Bradford PA. Inhibition of biofilm formation by chitosan-loaded nanoparticles: impact on gene expression in P. aeruginosa. Carbohydr Polym. 2021;251:117006.33142573 [Google Scholar]
  • 9.Ahmad A, Khan A, Akhtar F, Yousuf S, Xess I, Khan LA, Manzoor N. Antibacterial efficacy of Chitosan nanoparticles against Staphylococcus aureus and its biofilms. Carbohydr Polym. 2016;135:124–31. [Google Scholar]
  • 10.Wu T, Zang Y, Liu M, Liu Y, Liu Z. Luteolin: A flavonoid with potential therapeutic effects against bacterial infections and biofilm formation. Carbohydr Polym. 2022;274:118626. [Google Scholar]
  • 11.Singh R, Poonia N, Kanwar SS. ZnO-rutin nanoconjugates for antibiofilm activity against P. aeruginosa. Carbohydr Polym. 2021;272:118466. [Google Scholar]
  • 12.Verma A, Patil R, Sadhu A, Panda PK, Chattopadhyay P, Chowdhury M, Jana NR. Flavonoid conjugated metal nanoparticles inhibit quorum sensing in P. aeruginosa biofilms. Carbohydr Polym. 2020;244:116441. [Google Scholar]
  • 13.Rashki S, Safardoust-Hojaghan H, Mirzaei H, Abdulsahib WK, Mahdi MA, Salavati-Niasari M, Khaledi A, Khorshidi A, Mousavi SG. Delivery LL37 by Chitosan nanoparticles for enhanced antibacterial and antibiofilm efficacy. Carbohydr Polym. 2022;291:119634. [DOI] [PubMed] [Google Scholar]
  • 14.Ramezani H, Sazegar H, Rouhi L. The antimicrobial efficacy of Rutin encapsulated Chitosan versus multidrug-resistant P. aeruginosa. Sci Rep. 2025;15(1):22047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sharma D, Misba L, Khan AU. Antibiotics versus biofilm: an emerging battleground in microbial communities. Antimicrob Resist Infect Control. 2019;8:76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zarei M, Jamaledin R, Afshar Ebrahimi AA. The role of nanoparticle size and surface charge in antibacterial activity of nanomaterials. J Nanobiotechnol. 2021;19:123. [Google Scholar]
  • 17.Kalita S, Kandimalla R, Bhowal AC, Kotoky J. Natural flavonoids as potential anti-biofilm agents against multidrug-resistant bacteria. Phytother Res. 2022;36:1120–35. [Google Scholar]
  • 18.Li X, Robinson SM, Gupta A, et al. Functional Chitosan nanoparticles as antimicrobial drug carriers. Int J Biol Macromol. 2020;154:1235–43. [Google Scholar]
  • 19.Gupta A, Mumtaz S, Li CH, Hussain I, Rotello VM. Combatting antibiotic-resistant bacteria using nanomaterials. Chem Soc Rev. 2019;48:415–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hall CW, Mah TF. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria. FEMS Microbiol Rev. 2017;41:276–301. [DOI] [PubMed] [Google Scholar]
  • 21.Moradali MF, Ghods S, Rehm BH. P. aeruginosa lifestyle: a paradigm for adaptation, survival, and persistence. Front Cell Infect Microbiol. 2017;7:39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Karygianni L, Ren Z, Koo H, Thurnheer T. Biofilm matrixome: extracellular components in structured microbial communities. Trends Microbiol. 2020;28:668–81. [DOI] [PubMed] [Google Scholar]
  • 23.Xu Z, Wang T, Zhang J, et al. Suppression of Pel gene expression reduces biofilm formation and antibiotic resistance in P. aeruginosa. J Glob Antimicrob Resist. 2021;24:136–44.32889142 [Google Scholar]
  • 24.Colvin KM, Gordon VD, Murakami K, et al. The Pel polysaccharide can serve a structural and protective role in the biofilm matrix of P. aeruginosa. PLoS Pathog. 2011;7:e1001264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Maura D, Ballok AE, Rahme LG. Considerations and caveats in anti-virulence drug development. Curr Opin Microbiol. 2016;33:41–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lee J, Zhang L. The hierarchy quorum sensing network in P. aeruginosa. Protein Cell. 2015;6:26–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Costa-Orlandi CB, Sardi JC, Pitangui NS, et al. Fungal biofilms and polymicrobial diseases. J Fungi. 2017;3:22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kim DH, Kim YJ, Yu MH, et al. Bioavailability and anti-inflammatory activity of Rutin and luteolin: challenges and opportunities. Nutrients. 2020;12:1129.32316589 [Google Scholar]
  • 29.Yien Ling T, Chang J, Lim Y, et al. Chitosan nanoparticles enhance delivery and antimicrobial efficacy of plant-derived compounds. Carbohydr Polym. 2021;251:117089.33142630 [Google Scholar]
  • 30.Tacconelli E, Carrara E, Savoldi A, et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria. Lancet Infect Dis. 2018;18:318–27. [DOI] [PubMed] [Google Scholar]
  • 31.Esnaashari F, Nikzad G, Zahmatkesh H, Zamani H. Exploring the antivirulence mechanisms of ZnO-PEG-quercetin nanoparticles: biofilm disruption, attenuation of virulent factors, and cell invasion suppression against pathogenic Pseudomonas aeruginosa. Bioorg Chem. 2025;26:108527. [DOI] [PubMed]
  • 32.Bakhshinejad B, Karimi M, Sadeghizadeh M. Bacteriophages and medical oncology: targeted gene therapy of cancer. Med Oncol. 2014;31(8):110. [DOI] [PubMed] [Google Scholar]
  • 33.Piri-Gharaghie T, Ghajari G, Rezaeizadeh G, Adil M, Mahdi MH. A novel vaccine strategy against brucellosis using Brucella abortus multi-epitope OMPs vaccine based on Lactococcus lactis live bacterial vectors. Int Immunopharmacol. 2024;134:112204. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets analyzed during the current study are available from the corresponding author upon reasonable request.


Articles from BMC Biotechnology are provided here courtesy of BMC

RESOURCES