Transcriptomics identified crucial candidate genes and pathways regulating early testicular development of drakes in the hypothalamic-pituitary-gonadal/thyroid axes

Abstract

Background

The crosstalk between the hypothalamic-pituitary-gonadal (HPG) and hypothalamic-pituitary-thyroid (HPT) axes plays an important role in gonadal development. However, the mechanism by which these 2 axes regulate early testicular development in drakes remains largely unknown. Therefore, the aim of the present study was to compare the morphology, histology, and transcriptomics between the precocious puberty (PP) and delayed puberty (DP) Longyan Shan-ma drakes (Anas platyrhynchos) to preliminarily reveal the mechanisms regulating early testicular development.

Result

The histomorphological results showed that the colloid area and integrated optical density (IOD) of thyroid in PP group were significantly lower than those in DP group (P < 0.05), and the testis weight, testis index, seminiferous tubule diameter, and number of spermatogonia in PP group were significantly higher than those in DP group (P < 0.05). The transcriptomic results showed that between PP and DP groups, a total of 232, 574, 572, and 4,129 differentially expressed genes (DEGs) were identified in the hypothalamus, pituitary, thyroid, and testis, respectively. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that DEGs in hypothalamus, pituitary, thyroid, and testis were significantly enriched in 3, 14, 16, and 27 KEGG pathways (P < 0.05), respectively, with the neuroactive ligand-receptor interaction pathway being the only one commonly enriched in all 4 tissues. Further, 11 key genes (GNRH1, AGT, AGTR1, COL1A1, ITGB6, PIK3CB, PLCB4, CALML4, ADCY1, PDE1C, and BUB1) were identified through screening based on enrichment in core reproductive pathways (including neuroactive ligand-receptor interaction and progesterone-mediated oocyte maturation) and functional links to testicular development. Their expression trends were validated by qRT-PCR (R²=0.89), confirming reliability. These genes may serve as critical nodes in HPG/HPT axis crosstalk to regulate early testicular development.

Conclusion

This study is the first systematically comparing the transcriptomes of the HPG and HPT axes between DP and PP drakes. These results will provide novel insights into the mechanisms of crosstalk regulation of the HPG and HPT axes on early testicular development in drakes.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12864-025-12505-w.

Background

In poultry, sexual maturity is a key factor in the formation and development of reproductive ability, and the development of testes is a prerequisite for sexual maturity in males [1, 2]. In domestic ducks, rapid testicular growth does not occur until 7 weeks of age, and the percentage of seminiferous tubules containing spermatozoa increases gradually with age [3]. Diverse studies have pointed out that small-sized and egg-laying breeds often reach sexual maturity earlier [4, 5]. Longyan Shan-ma duck is a native Chinese laying duck breed, which has a younger sexual maturity age compared to other laying duck breeds such as Brown Tsaiya duck [6]. Breeders often judge the sexual maturity process of poultry by secondary sexual characteristics [7], and the most common of these is the sexual dimorphism of the tail feathers [8, 9]. In production practice, the researchers of the present study found that the sexual feathers (curled tail feathers) of Longyan Shan-ma drakes began to form at 30 days of age (Fig. 1A). However, the actual anatomical results showed that there were no obvious or expected differences in the development of testes between Longyan Shan-ma drakes with early vs. late onset of sexual feathers. In other words, the degree of testicular development of drakes with early-onset sexual feathers was similar to that of drakes with late-onset sexual feathers, which suggested that the development of sexual feathers of Longyan Shan-ma drakes do not represent the stage of testes development (Fig. 1B).

Fig. 1.

Comparative analysis of the presentation states of sexual feathers and testicular indicators in drakes. A Three types of the presentation states of sexual feathers. The red arrows point to the sexual feathers; B T-test of testis weight and testis index for individuals with no appearance of sexual feathers and those with curled sexual feathers. Scatter points represent individual data, the middle vertical line represents mean, the vertical lines on both sides of the middle vertical line represent standard error, and “ns” indicates that there is no significant difference in t-test results

Studies have shown that early testicular development is mainly regulated by the activation of the hypothalamic-pituitary-gonadal (HPG) axis [10] and the increased secretion of gonadotropin-releasing hormone (GnRH) [11]. For example, after resection of a non-functional pituitary adenoma, the hypothalamic-pituitary communication is unobstructed, thereby restoring gonadal function [12]; GnRH immune-castration targeting the HPG axis has become an animal-friendly alternative to surgical castration [13]. In addition, timely and appropriate levels of thyroid hormones (THs) are essential for normal testicular development [14]. The changes in THs status can significantly affect testicular development and size [15, 16], and thyroid dysfunction can also affect early testicular cell proliferation and spermatogenesis in rats [17]. Studies have also identified that the hypothalamic-pituitary-thyroid (HPT) axis in poultry can crosstalk with the HPG axis to coordinate reproduction and metabolism [18]. Based on these observations, we hypothesized that early testicular development of Longyan Shan-ma drakes may be regulated by crosstalk between the HPG and HPT axes. In addition to the regulation of the HPG and the HPT axes mentioned above, the sexual development of drakes is also influenced by a variety of other factors. Genetic factors play a fundamental role in sexual development [19]. Differences in the genetic backgrounds of different duck breeds can lead to variations in the timing and progression of their sexual development [20]. In terms of physiological factors, apart from the hormones related to the HPG the HPT axes in the endocrine system, other hormones such as insulin-like growth factors may also be involved in the regulation of sexual development [21, 22]. Meanwhile, age is also an important factor affecting sexual development [19]. As drakes grow, their body organs gradually mature, and sexual development will proceed accordingly. Moreover, environmental factors, including the duration of light, temperature, and rearing system, can also have an impact on the sexual development of drakes [23–25]. For example, an appropriate duration of light and temperature is conducive to promoting sexual development, while an unfavorable breeding environment may delay the process of sexual development.

With the advancement of sequencing technologies and bioinformatics analysis methods, transcriptomics has become an important tool for studying testicular development. In animals such as cattle [26], goats [27], pigs [28], and chickens [7], RNA-seq technology has revealed some key pathways and genes regulating early testicular development. These studies are significant for discovering heritable variation, developing molecular markers, breeding varieties with sexual maturity advantages, and shortening the time required for sexual maturity to improve production efficiency. However, there are no similar studies reported on ducks to date. Therefore, the present study aimed to compare histomorphological differences in testes and thyroid tissue and bulk mRNA expression profiles in hypothalamus, pituitary, thyroid, and testes between precocious puberty (PP) and delayed puberty (DP) Longyan Shan-ma drakes. The broader goal of the study is to shed light on the transcriptional regulatory mechanisms underlying the early testicular development of Longyan Shan-ma drakes, and provide a scientific basis for the breeding, selection, and utilization of breeding drakes.

Results

Grouping observation on sexual feather traits and their relationship with puberty groups in Drakes

Precocious puberty (PP) and delayed puberty (DP) groups were defined based on histological examination of testes: the PP group (n = 4) consisted of individuals with histologically confirmed presence of spermatozoa in the testes, while the DP group (n = 8) included those with absence of spermatozoa. According to the characteristics of the sexual feathers’ appearance (Fig. 1A), individuals with curled sexual feathers and those with absence of sexual feathers were selected and sampled. We then carried out statistical analyses on the sampled data (Fig. 1B), focusing not only on the sexual feather traits but also on the associated reproductive indicators. The results showed that there were no significant differences in testis weight and testis index between the group of individuals with curled sexual feathers and the group of individuals without the emergence of sexual feathers.

Additionally, to further clarify the relationship between sexual feather traits and puberty status, we delved deeper into the distribution of sexual feather phenotypes within the PP and DP groups (n = 12). In the PP group of 4 individuals, 2 (50%) exhibited curled sexual feathers, 1 (25%) had no sexual feathers, and 1 (25%) presented tilting sexual feathers. In the DP group of 8 individuals, 3 (37.5%) showed curled sexual feathers, 3 (37.5%) had no sexual feathers, and 2 (25%) had tilting sexual feathers (Table 1). We employed Fisher’s exact test to explore the relationship between the curling status of sexual feathers and the PP and DP groups. The statistical analysis results indicated that there was no significant association between the curling states of the tail feathers (at 53 days of age) and precocious or delayed puberty (P = 0.610). These findings suggest that curled sexual feathers are not a definitive marker for PP. However, considering the relatively higher proportion of curled feathers in PP individuals (50% in PP vs. 37.5% in DP), curled sexual feathers might serve as a preliminary phenotypic indicator for PP. Nevertheless, final confirmation still necessitates histological examination of testicular sperm presence to avoid misclassification.

Table 1.

Fisher’s exact test results: association between sexual feather States (no tail feathers, tilting, curling) and PP/DP groups at the ages of 53 days

Group	Sexual feather states			Exact Sig. (2 side)
	No tail feathers	Tilting	Curling
PP (n = 4)	1	1	2	0.610
DP (n = 8)	3	2	3
total	4	3	5

Phenotypic and histological differences between the PP and DP groups

The results of the differential analysis were presented in Table 2 as the mean ± standard error. The results shown that although there were no significant differences in thyroid weight and thyroid organ index between the two groups, the differences in thyroid colloid area and integrated optical density (IOD) of the colloid were significant (P < 0.05). There were significant differences in testis weight, testis organ index, diameter of seminiferous tubules, and the number of spermatogonia between the PP and DP groups (P < 0.05). Morphological observation revealed that the color of thyroid colloid staining in the PP group was lighter than that in the DP group (Fig. 2A). Morphologically, the seminiferous tubules in the PP group were tightly arranged, containing sperm at various developmental stages; in contrast, the testes with undifferentiated spermatogonia embedded in small “cords” of supporting cells existed in the DP group, and these testes lacked clear tubular layers or lumens, even no sperm were apparent (Fig. 2B).

Table 2.

Phenotypic and histological results of the PP and DP groups

Tissue	Indicators	PP group (n = 4)	DP group (n = 8)
Thyroid	Paired weight (g)	0.0964 ± 0.0125	0.1171 ± 0.0094
	Organ index (%)	0.0104 ± 0.0006	0.0126 ± 0.0010
	Colloid area (µm2)	1167.94 ± 111.74a	1471.59 ± 71.71b
	Colloid IOD1	67.10 ± 3.88	82.85 ± 4.15
Testis	Paired weight (g)	8.5958 ± 1.7070a	0.9359 ± 0.2106b
	Organ index (%)	0.9243 ± 0.1836a	0.1006 ± 0.0226b
	Seminiferous tubule diameter (µm)	306.41 ± 60.72a	64.59 ± 12.01b
	Number of spermatogonia	116.75 ± 26.04a	16.39 ± 4.07b

Data was displayed as “mean ± standard error” in table

Different superscripts indicated that the result of t-test was significant (P < 0.05)

¹ Abbreviation: IOD integrated optical density

Fig. 2.

Comparison of HE staining images of thyroid and testis in drakes between PP and DP groups. A Representative image of the thyroid stained with HE, with PP group at the top and DP group at the bottom. Thyroid follicles are composed of a single layer of arranged follicular epithelial cells, which are filled with colloid. B Representative images of the testis stained with HE, with PP group above and DP group below. The left side is under low magnification (with a scale of 1 nm) and the right side is under high magnification (with a scale of 50 μm). Abbreviations: LC, Leydig cells; SC, Sertoli cells; SG, spermatogonia; rSD, round spermatids; eSD, elongated spermatids; SP, sperm

Quality analysis of sequencing data and identification of DEGs

A total of 1,158,951,738 raw reads were obtained from 24 samples (Supplementary Table 1). Following data cleaning, an average of 47,781,460 reads were retained. A total of 1,158,951,738 raw reads were obtained from 24 samples (Supplementary Table 1). After data cleaning, an average of 47,781,460 reads were obtained. The Base Quality Score of 20 (Q20) values for all samples ranged from 97.05% to 98.14%, the Base Quality Score of 30 (Q30) values for all samples ranged from 91.98% to 94.36%, and the mapping rates for all samples ranged from 87.77% to 94.09%. Using a threshold |log₂FoldChange| > 1.4 and P value < 0.05, when comparing the PP group with the DP group, the following numbers of differentially expressed genes (DEGs) were identified. In the hypothalamus, 232 DEGs were identified, including 58 upregulated genes and 174 downregulated genes; in the pituitary, 574 DEGs were identified, including 99 upregulated genes and 475 downregulated genes; in the thyroid, 572 DEGs were identified, including 365 upregulated genes and 207 downregulated genes; in the testes, 4,129 DEGs were identified, including 3,051 upregulated genes and 1,078 downregulated genes (Fig. 3A). The Venn plot of DEGs showed that 5 genes were differentially expressed in all 4 tissues, including DLD and 4 unannotated genes (Fig. 3B). The heatmap of DEGs visualizes the gene expression patterns in the hypothalamus, pituitary, thyroid, and testis between the PP and DP groups. The color bar indicates Z-score normalized expression levels (blue for low expression, red for high expression), and sample clustering is fully consistent with experimental grouping (Ward.D2 algorithm with Pearson correlation distance) (Fig. 3C and F).

Fig. 3.

Transcriptome variation characteristics of various tissues between the PP and DP groups. A DEGs identified in 4 organizations. B A Venn diagram of the number of DEGs. Heatmap diagram of DEGs in the hypothalamus (C), pituitary (D), thyroid (E), and testis (F)

Functional enrichment analysis of the identified DEGs

KEGG enrichment analysis showed that DEGs in the hypothalamus, pituitary, thyroid, and testis were significantly enriched in 3, 14, 16, and 27 KEGG pathways, respectively (Fig. 4A and D, P < 0.05). The main pathways included neuroactive ligand-receptor interaction, ECM-receptor interaction, calcium signaling pathway, vascular smooth muscle contraction, TGF-β signaling pathway, Wnt signaling pathway, and MAPK signaling pathway. It is worth noting that through the intersection analysis of the pathways enriched by the DEGs in the hypothalamus, pituitary, thyroid, and testis, it was found that the neuroactive ligand-receptor interaction pathway is the only common enriched pathway among all the 4 tissues (Fig. 4E), indicating that it may play a key role in regulating early testicular development in ducks through the HPG and HPT axes. To further explore this finding, we constructed a PPI network of genes enriched in the neuroactive ligand-receptor interaction pathway across these 4 tissues (Fig. 4F). It was found that the node number of AGT was the highest, and it was differentially expressed in the pituitary.

Fig. 4.

The significantly enriched KEGG pathways and identification of key pathways. A − D The bubble plots showed that the KEGG pathways significantly enriched in 4 tissues (P < 0.05). E Venn diagram screened for the only signaling pathway common to all 4 tissues. F The PPI of DEGs on the neuroactive ligand-receptor interaction pathway. The size of the circle represents the degree of connectivity, and the color filled in the circle represents the tissue

Network analysis of HPG and HPT axis crosstalk in regulating early testicular development in drakes, and qRT-PCR validation

Functional enrichment analysis identified the neuroactive ligand-receptor interaction pathway as the upstream core (enriched in all four tissues), which regulates a cluster of downstream pathways through tissue-specific DEGs. These downstream pathways include: calcium signaling pathway, vascular smooth muscle contraction pathway, AGE-RAGE signaling pathway in diabetic complications, gap junction pathway, progesterone-mediated oocyte maturation pathway, phosphatidylinositol signaling system, inositol phosphate metabolism, and focal adhesion pathway.Notably, these pathways are interconnected through shared DEGs: e.g., ADCY1 participates in calcium signaling, vascular smooth muscle contraction, gap junction, and progesterone-mediated pathways; PLCB4 links calcium signaling, vascular smooth muscle contraction, gap junction, and phosphatidylinositol signaling. This cross-talk reflects a coordinated regulatory network downstream of the neuroactive ligand-receptor pathway. A regulatory network of 11 key DEGs (enriched in the above pathways) was constructed to visualize these associations (Fig. 5A), with connections based on KEGG cascades, shared genes, and literature. These genes include hypothalamic GNRH1, pituitary AGT, thyroid AGTR1 and COL1A1, and testis-derived ITGB6, PIK3CB, PLCB4, CALML4, ADCY1, PDE1C, and BUB1. qRT-PCR validation confirmed the expression trends of these 11 genes (Fig. 5B), consistent with RNA-seq results.

Fig. 5.

Regulatory network and validation of RNA-seq results. A Possible molecular mechanisms by which the HPG axis and HPT axis regulate early testicular development. The log2FoldChange of the genes represent the expression change of PP group relative to DP group, with red indicating upregulation and blue indicating downregulation. All gene symbols in the figure are spelled out as follows: GNRH1 (Gonadotropin-Releasing Hormone 1), AGT (Angiotensinogen), AGTR1 (Angiotensin II Receptor Type 1), COL1A1 (Collagen Type I Alpha 1 Chain), ITGB6 (Integrin Subunit Beta 6), PLCB4 (Phospholipase C Beta 4), PIK3CB (Phosphatidylinositol-4,5-Bisphosphate 3-Kinase Catalytic Subunit Beta), CALML4 (Calmodulin Like 4), PDE1C (Phosphodiesterase 1 C), PDE3B (Phosphodiesterase 3B), ADCY1 (Adenylate Cyclase 1), BUB1 (BUB1 Mitotic Checkpoint Serine/Threonine Kinase). Abbreviation: ER, Endoplasmic reticulum. B Comparison of gene expression levels between RNA-Seq and qRT-PCR. Error bars represent standard error of the mean (SEM) across three biological replicates. C Correlation scatter plot of RNA-Seq and qRT-PCR

Discussion

In male animals, the HPG and HPT axes play a crucial role in early testicular development and spermatogenesis [12–14, 17]. The testes, whose development remains in a constantly suppressed state after birth, start their early development by reducing the inhibition on the HPG axis [29]. In addition to its well-known physiological function of promoting substance and energy metabolism [30], the thyroid also plays an important role in testicular development. Most studies have reported that the thyroid affects testicular development through THs [14, 31]. Moreover, the Hypothalamic-Pituitary-Thyroid (HPT) axis and Hypothalamic-Pituitary-Gonadal (HPG) axis exhibit intricate interactions that significantly impact testicular development. There is an interaction between the thyroid hormones secreted by the HPT axis and the gonadotropins (FSH) secreted by the HPG axis. For example, in the presence of FSH, the thyroid hormone (T3) enhances the gonadotropin-stimulated androgen release and the expression of related genes, jointly influencing the function of the testis. The specific mechanism is that T3 acts on the receptors on Sertoli cells and Leydig cells to enhance the stimulation of androgen release by FSH, and mediates the proliferative effect on Sertoli cells and undifferentiated spermatogonia of type A through insulin-like growth factor 3 (Igf3), thereby affecting the development of the testis and spermatogenesis [32]. In addition, in the developing testis, the thyroid hormone receptor α (Thra), monocarboxylate transporter 8 (Mct8), and type 3 deiodinase (Dio3) are some key determinants of thyroid hormone signaling [33–35]. Inactivating mutations in these genes can lead to testicular abnormalities, such as augmented (Thra and Mct8 mutations) or reduced (Dio3 mutation) testis size [36–40].

While there is a certain understanding of the general mechanisms of male animal reproductive development involving the HPG and HPT axes as described above, for specific species like Longyan Shan-ma Ducks, there are still many aspects to be explored. Longyan Shan-ma Ducks reach sexual maturity relatively early [6], and there are considerable differences in the formation of sexual feathers among different individuals. One might have anticipated a closer correlation between sexual feather traits and reproductive indicators. However, the analysis results showed that there were no significant differences in testis weight and testis index between the group of individuals with curled sexual feathers and the group without the emergence of sexual feathers. This indicates that, despite the early onset of sexual maturity and the variation in sexual feather formation, the presence or absence of curled sexual feathers does not seem to be a reliable predictor of testicular development in Longyan Shan-ma Ducks. Furthermore, the results of Fisher’s exact test, which examined the relationship between the curling status of tail feathers at 53 days of age and precocious or delayed puberty, revealed no significant association. Although the sample size might affect the statistical power to some extent, the lack of significant results still challenges the assumption that sexual feather curling can be used as an indicator of reproductive maturity.

As described above, the HPG and HPT axes play a vital role in the early testicular development and spermatogenesis of male animals, and their intricate interactions and molecular mechanisms have been partially elucidated in previous studies. However, although these molecular mechanisms have been documented, most of the findings are derived from other species or limited to certain specific aspects. When it comes to drakes, there is still a lack of a comprehensive and systematic understanding that is unique to them. Despite the reported interactions and regulatory trends between the HPG and HPT axes in general male animals, the molecular regulatory network in drakes remains largely uncharted territory, especially in aspects related to the histological and transcriptomic characteristics of the HPG and HPT axes. This knowledge gap underscores the significance of conducting in-depth research on drakes. Based on this, the present study aimed to investigate the histological and transcriptomic changes of the HPG and HPT axes in drakes of the PP and DP groups. By doing so, we hoped to gain new insights into the regulatory mechanisms underlying the development of drakes and bridge the existing knowledge gap in this specific area. Histological analysis of the thyroid showed that the colloid contents in PP group drakes were relatively low (Fig. 2A), which may reflect increased utilization of stored thyroid hormones (THs) in colloid, as THs are critical for early testicular development [41]. Consistent with this, thyroid transcriptome data revealed differential expression of T3-related genes: ADIPOQ (log₂FC = 2.89), a gene involved in TH-mediated metabolic regulation, was upregulated, while CRABP1 (log₂FC=−4.79) and ALDH1A1 (log₂FC=−2.80), which participate in TH metabolism, were downregulated. These findings collectively suggest potential adjustments in TH signaling or metabolism in PP group drakes, which may be linked to their advanced testicular development. The histological analysis of the testes showed that compared with the DP group drakes, the diameter of the seminiferous tubules in PP group drakes increased, and the number of spermatogonia also significantly increased, indicating the increase of seminiferous tubules and various testicular cells (interstitial cells, germ cells, and Sertoli cells) during early testicular development [7, 42]. Then, comparative transcriptomics was used to detect the mRNA expression profiles of the hypothalamus, pituitary, thyroid, and testis in drakes of the PP and DP groups, and 232, 574, 572, and 4,129 DEGs were identified, respectively. Among the DEGs in the hypothalamus and pituitary, the PP group showed distinct regulatory trends: key inhibitory factors were down-regulated, while activating factors were up-regulated. Specifically, in the pituitary, somatostatin (SST) and its receptors (SSTR1, SSTR3)—which inhibit gonadotropin secretion—were significantly down-regulated (log₂FC=−6.97, −1.72, −2.79, respectively), indicating weakened inhibitory signals on the pituitary. Conversely, hypothalamic GNRH1—the core activator of the HPG axis that stimulates gonadotropin release—was up-regulated (log₂FC = 2.36). These changes collectively support that the inhibitory effect of the hypothalamus and pituitary on the testis is weakened, while the activating pathway of HPG axis is enhanced, thereby promoting early testicular development. To further reveal key genes and their potential regulatory mechanisms, we conducted KEGG enrichment analysis and found that the neuroactive ligand-receptor interaction pathway was the only common pathway among all 4 tissues. Many studies have shown the role of this pathway in reproduction [43], and the neuroactive ligand-receptor interaction pathway is considered a key signaling pathway for the HPG axis to regulate testicular development [44], external genital development [45], semen quality, and sexual response [46]. Therefore, the neuroactive ligand-receptor interaction pathway—being the only pathway commonly enriched in all 4 tissues (hypothalamus, pituitary, thyroid, and testis; Fig. 4E)—can be considered a potential molecular pathway for regulating early testicular development through the HPG and HPT axes. This pathway showed an overall activating trend in the PP group, supported by the upregulation of key functional genes (e.g., hypothalamic GNRH1).

In this neuroactive ligand-receptor interaction pathway, it is crucial to note the specific roles of key ligands and receptors. Specifically, in our study context related to drakes’ HPG and HPT axes, GNRH1 encodes gonadotropin-releasing hormone (GnRH), which acts as a ligand. GnRH is secreted by the hypothalamus and specifically binds to the gonadotropin-releasing hormone receptors on pituitary cells. This binding activates a series of intracellular signaling cascades, mainly involving the activation of G proteins, which in turn leads to the phosphorylation of downstream signaling molecules [47]. This activation ultimately promotes the synthesis and release of gonadotropins, playing a vital role in initiating and regulating testicular development [48]. As for AGT, it serves as a precursor to generate angiotensin peptides. Once angiotensin is formed, it binds to its corresponding receptors, such as angiotensin II receptor type 1 (AGTR1) and angiotensin II receptor type 2 (AGTR2), which are distributed in various tissues including the pituitary, thyroid, and testis [49]. Through these receptor-ligand interactions, AGT-derived angiotensin participates in regulating multiple physiological processes related to the HPT axis and testicular local microenvironment, such as regulating blood vessel contraction and dilation, cell proliferation, and differentiation [50]. Moreover, PPI network analysis of DEGs enriched in this pathway identified AGT and GNRH1 as potential candidate genes. Specifically, hypothalamic GNRH1 (a core ligand in HPG axis activation) was upregulated in the PP group (log₂FC = 2.36), while pituitary AGT (a precursor of angiotensin peptides involved in local microenvironment regulation) was downregulated (log₂FC=−4.81). These tissue-specific expression changes highlight the coordinated roles of ligands and receptors in this pathway, further emphasizing their importance in regulating testicular development.

Furthermore, accumulating evidence supports the interaction between GNRH1 and AGT in the context of testicular development. The GnRH which was encoded by GNRH1 could affect the expression of AGT mRNA [51]. The activation of GnRH in the hypothalamus is a key event in initiating early testicular development. The HPG axis inhibits the secretion of GnRH in the hypothalamus based on negative feedback until puberty, when GnRH sensitivity decreases and hormone levels in the HPG axis increase, thus initiating early testicular development [52]. Moreover, mutations in the GNRH1 gene lead to delayed testicular development and azoospermia [53, 54]. AGT is the only precursor of angiotensin peptide (Ang) and an important component of the renin-angiotensin system (RAS), which is involved in various important aspects of male reproduction [55]. For example, elevated AGT levels are associated with an increased risk of asthenospermia and teratozoospermia [56]. Under RAS inhibition, sperm motility in rats is significantly reduced [57]. The AGT gene is associated with testicular differentiation and development in Muscovy ducks [58], sperm maturation in mice [59], and sperm function and fertility in boars [60], and may be regulated by affecting testicular steroid metabolism during puberty [61]. The above researches suggest that the hypothalamus and pituitary may regulate early testicular development through GNRH1 and AGT.

In this study, within the context of exploring the regulation of early testicular development via the neuroactive ligand-receptor interaction pathway and the HPG and HPT axes, the coding gene of thyroid AGTR1 is up-regulated. As previously discussed, AGT plays an important role in the relevant regulatory network. AGTR1, as the main effector receptor of Ang II derived from AGT, its activation is closely related to the overall regulatory process. Specifically, AGTR1 receptor activation regulates ECM synthesis [62]. COL1A1 encodes collagen type I alpha 1 chain, which is an important component of the ECM and participates in ECM remodeling [63]. It plays a crucial regulatory role in cell proliferation and differentiation. Research has shown that COL1A1 is associated with type A spermatogonia, mediating the separation and migration of germ cells during spermatogenesis [64]. Silencing COL1A1 can inhibit spermatogonium self-renewal and promote spermatogonium differentiation [65]. COL1A1 is considered an important gene regulating testicular development and spermatogenesis in animals such as chickens [66], sheep [67], and cows [68].

Integrin subunit beta 6 (ITGB6) is a member of the integrin superfamily, which mediates the interaction between cells and extracellular matrix, as well as the bidirectional transmission of transmembrane signals, and is crucial for the development of tissues and organs [69, 70]. It is speculated that integrins also provide basic functions of the reproductive system. Since the round sperm cell stage, ITGB6 dominant integrin α V has been observed to form the acrosome in developing sperm [71]. In addition, ITGB6 can activate the PI3K signaling pathway and participate in lipid metabolism [72].

Considering the roles of AGTR1 in regulating ECM synthesis and ITGB6 in lipid metabolism, as well as the importance of COL1A1 in testicular development and spermatogenesis, it can be speculated that AGTR1 and COL1A1 may respond to AGT and play a role in early testicular development by affecting ECM synthesis and lipid metabolism. Moreover, ITGB6 may also contribute to the overall process of early testicular development through its functions related to cell-matrix interaction and lipid metabolism regulation, all within the complex regulatory network involving the neuroactive ligand-receptor interaction pathway and the HPG and HPT axes.

Building on the previous findings regarding key genes and pathways in testicular development, we further explored regulatory mechanisms through KEGG pathway analysis, which identified the progesterone-mediated oocyte maturation pathway in the testes. Key genes in this pathway—including PIK3CB, BUB1, and ADCY1 (as highlighted in the regulatory network)—may contribute to early testicular development. Progesterone, long regarded as a female reproductive hormone, is increasingly recognized as a key regulator of male reproductive function, including testicular development and spermatogenesis [73, 74]. Progesterone signaling modulates male reproductive processes through calcium signaling and tyrosine phosphorylation cascades, which are critical for spermatogenesis and sperm function [73]. Additionally, disruptions in steroidogenesis—including altered progesterone levels—are associated with impaired testicular maturation in prepubertal tissues, linking progesterone metabolism to testicular developmental pathways [74]. These findings support the relevance of the progesterone-mediated oocyte maturation pathway in our study, where PIK3CB and other key genes may act as nodes linking progesterone signaling to early testicular development. For instance, PIK3CB (a core gene in this pathway) encodes phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta, which generates phosphatidylinositol 3,4,5-triphosphate (PIP3) [75]. PIP3 recruits PH domain-containing proteins to the membrane, activating signaling cascades involved in cell growth, survival, proliferation, and motility—processes critical for spermatogonia proliferation and seminiferous tubule development [76, 77]. Notably, PIK3CB may regulate phosphodiesterase 3B (PDE3B) via PIP3, thereby reducing cAMP levels [78], which could fine-tune progesterone-mediated signaling in testicular cells. These findings, combined with the regulatory network showing PIK3CB as a cross-talk node between progesterone pathway and phosphatidylinositol signaling, support its role in coordinating upstream neuroactive ligand-receptor signals with downstream reproductive processes.

The AGTR1 receptor, which was mentioned in the context of other regulatory mechanisms previously, is most commonly paired with the heterotrimeric Gg/11 protein. In the testis, activated Gg/11 transduces the PLC-β-dependent signaling pathway, resulting in the activation of the second messenger IP3 and downstream signal transduction dependent on DAG and PKC [79]. PLCB4 protein is one of the subtypes of phospholipase C (PLC), which generates DAG stimulation required to activate PKC and IP3 required to release Ca2 + from the endoplasmic reticulum [80]. It controls cellular processes, including neural signaling, cell growth, and synaptic plasticity, through calcium signaling [81]. In addition, the PLCB4 gene is associated with poor sperm formation ability in hybrid triploid loaches [82]. Calmodulin CALML4 acts as an intermediate calcium sensor, responding to a wide range of Ca2 + concentrations and transmitting signals downstream. Its biological functions include regulating cell proliferation, promoting DNA synthesis, participating in the regulation of target enzyme activity, and regulating microtubule depolymerization. In addition, it also includes spermatogenesis and physiological activities of sperm (motility and responsiveness) [83]. The CALML4 gene and calcium signaling pathway have been found to be the key gene and signaling pathway causing genetic infertility in mulard [84].

Calcium and cyclic nucleotides are the second messengers that regulate sperm development and functional activity. Continuing the exploration of the regulatory factors related to calcium and cyclic nucleotides, calcium/calmodulin dependent phosphodiesterase 1 C (PDE1C) is regulated by development in germ cells [85, 86]. It is abundant in testicular cells and mature sperm, serving as a means of regulating cyclic nucleotide content in calcium regulated cells [87]. Inhibition of PDE1C activity increases serum testosterone levels and steroidogenic ability of stromal cells by coordinating the stimulation of cAMP [88]. The PDE1C gene is lowly expressed in the gonads of patients with azoospermia and highly expressed in the gonads of normal males undergoing spermatogenesis. It has been confirmed that the PDE1C gene is involved in cell cycle, proliferation, and differentiation [89].

Moreover, the regulation of intracellular cAMP levels is a complex process. Intracellular cAMP levels are finely regulated by Ca2+- sensitive adenylate cyclase 1 (ADCY1) [90]. PKA senses a decrease in intracellular cAMP levels and activates the mitotic checkpoint serine/threonine kinase (BUB1), which plays a central role in mitosis [91]. Research has found that compared to other tissues, the levels of BUB1 mRNA in the testis are significantly higher. The accumulation of BUB1 mRNA is related to the proliferation status of cells [92] and is a positive regulatory factor for cell proliferation [93]. In this study, BUB1 was also enriched in the cell cycle pathway, and the normal operation of the cell cycle is essential for the proliferation and differentiation of spermatogonia [94–96] and spermatogenesis [97] during puberty.

In summary, considering all the pathways and genes discussed above, their interaction mechanisms might explain the differences in early testicular development between PP and DP group drakes at the same age, under the same feeding conditions, and with similar body weight. Importantly, the findings of our study provide valuable theoretical insights that may lay the groundwork for future practical applications in breeding programs. We have identified key genes, such as GNRH1, AGT, AGTR1, COL1A1, ITGB6, PIK3CB, PLCB4, CALML4, ADCY1, PDE1C, and BUB1, and crucial signaling pathways, including the neuroactive ligand-receptor interaction pathway, the calcium signaling pathway, the vascular smooth muscle contraction pathway, the AGE-RAGE signaling pathway in diabetic complications, and the gap junction, which are closely associated with early testicular development. Breeders can leverage this valuable information by employing molecular marker-assisted selection techniques. Through this approach, they can screen for poultry breeds that possess greater potential for optimal testicular development. By doing so, breeders can enhance reproductive efficiency and the overall quality of breeding programs. With this knowledge, breeders can formulate more scientific breeding strategies, which will ultimately enable them to cultivate offspring with superior genetic traits.

A key limitation of this study lies in two aspects relevant to practical application and result interpretation. First, the relatively small sample size (n = 12) for analyzing the relationship between sexual feather traits and puberty status restricts statistical power to detect potential associations. Although our data show a higher proportion of curled sexual feathers in precocious (PP) individuals, the lack of significance highlights the need for larger-scale validation in future studies; notably, this also indicates that sexual feather characteristics do not reliably reflect testicular development and thus cannot serve as a robust phenotypic marker for breeding. Second, the identification of PP/pubertal (DP) development relies on testicular histology, an invasive sampling method that is not feasible for practical breeding programs. To address these limitations, future work will focus on two directions: (1) Expanding sample sizes to further validate the utility of sexual feather traits, while clarifying their limited reliability for early screening; (2) Developing non-invasive tools by leveraging the regulatory cascade of “gene variation-mRNA expression-metabolite level”—existing studies have shown that mRNA expression differences (like core DEGs identified here) may be driven by upstream gene variations and further affect downstream metabolite accumulation [98]. Based on our findings that reproductive-related DEGs (e.g., GNRH1) are differentially expressed between PP and DP groups, we propose integrating genomic (screening functional gene variations), metabolomic (detecting serum metabolites), and serum biochemical analyses (e.g., reproductive hormone levels) to screen non-invasive molecular markers. This aims to enable high-throughput, non-invasive selection of individuals with favorable testicular development in breeding, while acknowledging current reliance on histological confirmation for accurate PP/DP classification. This integrated approach aims to enable non-invasive, high-throughput selection of individuals with favorable testicular development traits in breeding practice, while acknowledging the current need for histological confirmation to ensure accuracy in PP/DP classification.

Overall, our research not only deepens the understanding of the molecular mechanisms underlying early testicular development in drakes but also offers guidance for the breeding industry. Future research could further explore the detailed regulatory mechanisms of these genes and pathways, as well as validate the relationship between sexual feather traits and puberty status in larger cohorts, to provide more comprehensive support for breeding practices.

Conclusions

In conclusion, morphological analysis revealed significant differences in the development of the thyroid and testis between the PP and DP group drakes. In addition, bioinformatics analysis indicated that the neuroactive ligand-receptor interaction pathway (the only pathway commonly enriched in all 4 tissues), together with pathways such as progesterone-mediated oocyte maturation, is crucial in regulating early testicular development in drakes through the crosstalk of HPG and HPT axes. 11 key DEGs (GNRH1, AGT, AGTR1, COL1A1, ITGB6, PIK3CB, PLCB4, CALML4, ADCY1, PDE1C, and BUB1) were identified through strict screening: consistent enrichment in these core reproductive pathways and functional relevance to testicular development (e.g., regulating cell cycle, spermatogonia proliferation and differentiation). Their expression trends were further validated by qRT-PCR (R²=0.89), confirming reproducibility. These genes may act as nodes linking HPG/HPT axis crosstalk to spermatogenesis, thereby modulating early testicular development in drakes. These results provide new insights into the molecular mechanisms by which the HPG/HPT axes regulate early testicular development of drakes.

Materials and methods

Management of experimental drakes

This experiment used 151 healthy Longyan Shan-ma drakes (Anas platyrhynchos) from the same batch, raised under the same management conditions, provided by the Longyan Shan-ma Duck Original Breeding Farm (Fujian, China). Before reaching 30 days of age, animals were raised in suspended nets with a male to female ratio about 1:10. Every 5 or 6 of these 151 drakes were grouped with another 50 female ducks in one pen, and there were 30 pens. They were provided with 24 h lighting, at a light intensity of 100–150 lx. All ducks were raised at natural temperature and had free access to feed and water. At 30 days of age, drakes were raised on the ground and separated from the female ducks.

Sexual feather trait observation

Between 30 and 60 days of age, continuous observation was conducted on the 151 drakes to record the development of sexual feathers. Based on the presence and morphological characteristics of sexual feathers, individuals were categorized into three types: (1) no tail feathers appearing; (2) tail feathers tilting; (3) tail feathers curling. This phenotypic observation aimed to preliminarily screen individuals with distinct sexual feather traits for subsequent sampling.

Sample collection, histological observation, and grouping

At 53 days of age, 12 drakes with similar body weight were selected for sacrifice based on sexual feather phenotypes (6 with curled sexual feathers and 6 without sexual feathers) to minimize confounding effects of body weight. To reduce stress, the drakes were first anesthetized with carbon dioxide. The rate and duration of carbon dioxide insufflation were adjusted according to the animals’ responses to ensure deep anesthesia. After the drakes were anesthetized and unconscious, euthanasia was carried out by carotid artery bloodletting. The thyroid and testis were collected to weigh and calculate organ index. The left thyroid and the right testis were fixed with 4% paraformaldehyde solution (Labgic, Beijing, China) for histological observation. The hypothalamus, pituitary, left thyroid, and right testis were selected and frozen in liquid nitrogen, then stored at − 80 ℃ for RNA extraction.

After fixing the left testis and right thyroid with 4% paraformaldehyde solution (Labgic) for more than 24 h, dehydrated them in gradient alcohol (75, 85, 95%, and anhydrous ethanol), embed them in paraffin, and cut the paraffin specimens into 4 μm thick sections using a rotary microtome (Leica, Shanghai, China). After hematoxylin-eosin (HE) staining, those sections were imaged by a mathematical pathological scanner (3DHISTECH, Budapest, Hungary). Refer to the measurement method of Bestetti et al. [99], the area and integrated optical density (IOD) of thyroid follicles were measured using Image-Pro Plus 6.0 analysis software for each field of view, and 5 fields of view were selected from each thyroid section. The same method was used to measure the diameter of seminiferous tubule in the testis sections, and the number of spermatogonia was counted using the Adobe Photoshop CC 2018 software. According to the presence or absence of sperm in the testes, 12 individuals were divided into a precocious puberty (PP) group (n = 4) and a delayed puberty (DP) group (n = 8). Three individuals from each of the PP and DP groups were selected for subsequent experiments.

RNA-seq and bioinformatics analysis

Total RNA from the hypothalamus, pituitary, thyroid, and testis was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA concentration was measured by using a NanoDrop 2000 Microultraviolet Spectrophotometer (Thermo Fisher Scientific, Wilmington, NC, USA), and RNA integrity was detected by using an Agilent 5300 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Qualified RNA samples were sent to Majorbio Co., Ltd. to produce cDNA libraries and sequence by using Nova-PE150 (Illumina, San Diego, CA, USA) system. The quality control of transcriptomic sequencing data was performed by using both FastQC (version 0.11.9) and fastp (version 0.22.0) software to obtain the clean reads [100]. Clean reads were mapped to the reference genome of duck (GCA_047663525.1) by HISAT2 (version 2.2.1) software to obtain sequencing alignment/mapping (SAM) files [101]. SAMtools (version 1.6.0) software was used to convert and sort the SAM files to Binary Alignment/Mapping (BAM) files [102]. The FeatureCounts (version 2.0.3) software was used to obtain the expression levels of each transcript [103]. Subsequently, the count of each transcript was standardized to transcripts per million (TPM) using the GenomicFeatures (version 1.56.0) R package. Differential expression genes (DEGs) were identified using the DESeq2 (version 1.44.0) package, with screening criteria of |log₂FoldChange| > 1.4 and P value < 0.05 [104]. The DEGs were selected for heatmap visualization using the pheatmap package (version 1.0.12) in R, with hierarchical clustering performed on a transposed normalized expression matrix (samples as rows, genes as columns) using the Ward.D2 algorithm and Euclidean distance [105]. Gene expression levels were normalized by row-wise Z-scoring, and the color bar spanned a range of − 2 to 2 (Z-score), visualized with a three-color gradient (blue → white → red) representing low, medium, and high expression, respectively. Used KOBAS (version 3.0) online software to perform Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analysis [106]. The KEGG database was used to determine the relationships between KEGG pathways. Protein-protein interaction (PPI) analysis of DEGs in the neuroactive ligand-receptor interaction pathway was performed using STRING 12.0 database (confidence score ≥ 0.7). The network was visualized with Cytoscape 3.9.1, with nodes representing proteins and edges indicating predicted physical interactions.

Real-time quantitative PCR validation experiments

Candidate genes were selected for qRT-PCR to validate the RNA-Seq results. Total RNA extracted from the hypothalamus, pituitary, thyroid, and testis was reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR (+ gDNA wiper) (Vazyme, Jiangsu, China), and the Primer Premier software (PREMIER Biosoft, San Francisco, CA, USA) was used to design primers (Table 3), and the NCBI online website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) was used to determine the specificity of the primers. qRT-PCR was performed using the BioRad CFX96 real-time PCR detection system (BioRad, Hercules, CA, USA), and 3 replicates were done for each sample. β-actin and GAPDH were selected as reference genes. The qRT-PCR reaction system was as follows: 2×FastSYBR Green Mixture (Cofitt, Hong Kong, China) 10 µL, upstream and downstream primers 0.4 µL each, cDNA 2 µL, ddH₂O 7.2 µL. qRT-PCR amplification conditions were as follows: 95 ℃ for 3 min; 95 ℃ for 5 s, 60 ℃ for 30 s, 40 cycles. The results were normalized using the 2^−ΔΔCT [107] method and statistical analysis was performed using the normalized data.

Table 3.

Primer sequences used in this study

Organ		Gene_symbol	Sequence (5’ − 3’)	Product length (bp)
Hypothalamus		GNRH1	F: TGAAAGGTTTGGTGTTGGGGT	71
			R: TTGGAAAATGTCCTGCGAGTT
Pituitary		AGT	F: GGTCTATGTCCATCCTTTCAG	141
			R: AGGTCATCTTCATAAGCAGGT
Thyroid		AGTR1	F: ATCCGGCGTACCATGTTTGT	175
			R: CTAGCCCAACCCGAAGTGTT
Thyroid		COL1A1	F: GCTTTGTGGATTCTCGGTTACTG	245
			R: GCACTCTCCGAAGGGGATCT
Testis		ITGB6	F: CTCAAACTGCGACCAGGACAT	296
			R: CCAAAGGTGGGTAAGCACTCAT
Testis		PLCB4	F: GAGCTTCGACCAAGTACCACAG	200
			R: CAGTGCAACTTCTGCATAGCG
Testis		PIK3CB	F: TTCAGTCACTCGTGGGTCTTT	91
			R: TCTTGGAAGTTCTCTGGGATA
Testis		CALML4	F: GAGCGAAATGCTGAACTGGAT	85
			R: AGATTTCCTTCTCGGGCTCCT
Testis		PDE1C	F: CCTCACTCAACTGCTCCATAC	289
			R: GTCCCATTTACACAATTCTCG
Testis		ADCY1	F: GAGTAAACAGATACATCAGCCGT	233
			R: CAGGAGGACAAGGACTATGGT
Testis		BUB1	F: CCCTGTCGTGCCTATGTTTTC	81
			R: GACTTCTTTTTACGCTGTGGG
All samples	β-ACTIN		F: TGACAATGGCTCCGGTATGT	105
			R: ACCATCACACCCTGATGTCTG
All samples	GAPDH		F: AGCAACATCAAGTGGGCAGA	157
			R: CACCCATCACGAACATGGGA

Statistical analysis

SPSS 27.0 (IBM, Chicago, IL, USA) software was used for statistical analysis. The significance of thyroid weight/index, testicular weight/index, thyroid follicular colloid area, thyroid follicular colloid IOD, seminiferous tubule diameter, and number of spermatogonia in PP and DP group drakes was analyzed by t-test. Graph Pad Prism 9.5 software was used to generate graphs. The graph results were expressed as mean ± standard error. A significant difference in mean was considered to exist when P < 0.05.

Authors’ contributions

YYC, XYH, and JWW were responsible for the experiment design, experimental performance, and manuscript drafting. In addition, XLC, YFL, RLL, HPC, KXC, and FLC, XLY, QYOY, JL, and LPZ participated in the sample collection and preparation. XPL performed upstream analysis of transcriptome sequencing data. JWW, HHL, LL, and JWH participated in the writing instruction and manuscript revision. All listed authors have made substantial contributions to the research and publication. Thank you to all the authors for their contributions to the study.

Funding

This research was supported by China Agriculture Research System of MOF and MARA (CARS-42-4), Key Technology Support Program of Sichuan Province (2021YFYZ0014), and Establishment and Demonstration Extension of Breeding Ability Selection System of Nonghua Drakes (22ZDYFZF0005) for the financial support.

Data availability

The reference genome data was available in NCBI’s database (IASCAAS_PekinDuck_T2T, https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_047663525.1/). The raw transcriptome sequencing data is available in NCBI’s SRA database (https://www.ncbi.nlm.nih.gov/sra/; Accession number: PRJNA1219377).

Declarations

Ethics approval and consent to participate

All methods were carried out following relevant guidelines and regulations. All experimental procedures involving animal handling were approved by the Institutional Animal Care and Use Committee (IACUC) of Sichuan Agricultural University (Chengdu Campus, Sichuan, China) under Approval No. DKY20170913.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.