Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2026 Jan 7;16:4795. doi: 10.1038/s41598-026-35118-z

Dual-specificity phosphatase 6 interferes with the repressive activity of forkhead box O1 towards CYP4A11 that mediates lipid accumulation in the liver

Masanobu Kimura 1, Yuriko Saiki 1,✉, Kosei Iwata 1, Keigo Murakami 1, Toru Furukawa 1,✉
PMCID: PMC12873249  PMID: 41501522

Abstract

Dual-specificity phosphatase 6 (DUSP6) is a phosphatase specific for extracellular signal-regulated kinase (ERK). Dusp6-knockout mice are resistant to diet-induced hepatic steatosis, which appears to be linked to the downregulation of cytochrome P450 4 A (CYP4A); however, its mechanism remains unclear. This study aimed to elucidate how DUSP6 regulates CYP4A11 in human hepatocyte-lineage cells by focusing on forkhead box O1 (FOXO1). HepG2 and HuH-7 cells were challenged with palmitic acid and oleic acid to induce lipid accumulation while manipulating the expression of DUSP6, FOXO1, CYP4A11, ERK, and/or AKT. Lipid accumulation was reduced by DUSP6 knockdown, resulting in decreased CYP4A11 expression despite elevated phosphorylated ERK, AKT, and FOXO1. Inhibition of ERK increased lipid accumulation, while simultaneous inhibition of ERK and AKT decreased it. Knockdown of FOXO1 or induced expression of DUSP6 increased CYP4A11 expression and lipid accumulation, whereas induced expression of FOXO1 decreased them. Chromatin-immunoprecipitation showed that FOXO1 bound to CYP4A11 promoter. Immunoprecipitations revealed that DUSP6 bound to and anchored FOXO1 in the cytoplasm. These results indicate that DUSP6 interferes with FOXO1’s repressive activity towards CYP4A11 by sequestering it in the cytoplasm and preventing its nuclear translocation, which ultimately unleashes CYP4A11 and promotes lipid accumulation.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-35118-z.

Subject terms: Cell biology, Diseases, Molecular biology

Introduction

The Dual Specificity Phosphatase (DUSP) family proteins are known for their ability to dephosphorylate serine/threonine residues on substrates1. DUSP6, a member of this family, specifically targets the phosphorylated extracellular signal-regulated kinase (ERK) and inhibits the mitogen-activated protein kinase (MAPK)/ERK signaling pathway2,3. Dysfunction of DUSP6 has been linked to the development and progression of various cancers, such as pancreatic, lung, ovarian, and colorectal cancer4–8. Additionally, studies have shown that DUSP6 plays a role in regulating metabolic homeostasis9–11. Our previous research demonstrated that DUSP6 is involved in the development of metabolic dysfunction-associated steatotic liver disease (MASLD) through its interaction with CYP4A12. We found that lipid accumulation in the liver was remarkably reduced in Dusp6 knockout (KO) mice even when fed a high-fat diet. To gain mechanistic insights, transcriptome sequencing was conducted to identify differentially expressed genes between murine wild-type hepatocytes and Dusp6-KO hepatocytes after palmitic acid and oleic acid (PA/OA) challenge (The Gene Expression Omnibus accession number GSE216881). We hypothesized that upregulated genes in wild type hepatocytes compared to Dusp6-KO hepatocytes would play a crucial role in lipid accumulation. We found that Cysp4a genes, including Cyp4a10 and Cyp4a14, were particularly upregulated in wild-type hepatocytes. On the other hand, Srebf1, a hypothetical candidate known as a principal regulator of genes involved in lipid biogenesis and homeostasis, was downregulated. Therefore, we have focused on CYP4A1113,14, a homologue of murine Cyp4a10, to understand the mechanism of lipid accumulation involving DUSP6 in human-hepatocyte lineage cells.

The forkhead family transcription factors are known to function through conserved DNA binding domains15. Forkhead box O1 (FOXO1), a member of this family, is expressed in various tissues, including the liver, pancreas, skeletal muscle, and adipose tissue16. FOXO1 has been identified as a direct transcriptional regulator of genes involved in glucolipid metabolism17. It has been shown to regulate several members of the CYP family: repressing Cyp7a1gene expression in high-fat diet-fed mice18, regulating CYP1B1to suppress breast cancer cell proliferation19, and inhibiting the expression of CYP19A1 and CYP2E1 in response to estradiol and tamoxifen, respectively20,21.

Building on our previous research and existing studies, we formulated two hypotheses. First, we proposed that FOXO1 may downregulate CYP4A gene expression similar to other CYP family members. Second, we hypothesized that DUSP6 might interfere with FOXO1’s ability to downregulate CYP4A. This study revealed that DUSP6 sequesters FOXO1 in the cytoplasm, preventing its transcriptional repression of CYP4A11 and leading to increased lipid accumulation.

Results

PA/OA challenge human hepatocyte lineage cells induce lipid accumulation with increased DUSP6 and CYP4A11

Initially, we examined changes in signaling molecules associated with lipid accumulation in human hepatocyte lineage cells derived from hepatocellular carcinoma, HepG2 and HuH-7, when challenged with a PA/OA mixture in vitro. Lipid accumulation increased in a dose-dependent manner following the PA/OA challenge (Fig. 1A-B). Through immunoblotting, we observed an increase in DUSP6, phosphorylated AKT (p-AKT), phosphorylated FOXO1 (p-FOXO1), and CYP4A11 due to the PA/OA challenge (Fig. 1C-D). Interestingly, the duration of the PA/OA challenge did not impact lipid accumulation in these cells (Fig. 1E-H).

Fig. 1.

Fig. 1

Open in a new tab

Lipid accumulations and the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA in different concentrations or exposure times. Images of Oil red O staining (A), quantitative evaluations of the Oil red O staining measured by absorbance (B), and immunoblots for signaling molecules (C) of HepG2 and HuH-7 challenged with PA/OA mixture at different concentrations. Scale bars in panel A indicate 100 μm. (D) Quantitative evaluation of immunoblots shown in panel C as a ratio to GADPH. In the horizontal axis, 1 and 6, 2 and 7, 3 and 8, 4 and 9, and 5 and 10 indicate relative signal intensities in 0/0 mM, 0.125/0.25 mM, 0.25/0.5 mM, 0.5/1 mM, and 1/2 mM of PA/OA challenging, respectively, for HepG2 (1–5) and HuH-7 (6–10). Images of Oil red O staining (E), quantitative evaluations of the Oil red O staining measured by absorbance (F), and immunoblots for signaling molecules (G) of HepG2 and HuH-7 challenged with PA/OA mixture at different exposure times. Scale bars in panel E indicate 100 μm. (H) Quantitative evaluation of immunoblots shown in panel G as a ratio to GADPH. In the horizontal axis, 1 and 4, 2 and 5, and 3 and 6 indicate relative signal intensities in 24 h, 48 h and 72 h of PA 0.25mM/OA 0.5mM challenging, respectively, for HepG2 (1–3) and HuH-7 (4–7). * and ** indicate p < 0.05 and < 0.01, respectively. Graphs show means and standard deviations in triplicate experiments.

DUSP6 knockdown inhibits lipid accumulation by downregulating CYP4A11 and upregulating phosphorylated ERK, AKT, and FOXO1

Previous research indicated that primary hepatocytes from Dusp6 knockout mice and HepG2 cells with DUSP6 knockdown reduced lipid accumulation12. By analyzing the effect of DUSP6 knockdown on lipid accumulation in HepG2 and HuH-7, we confirmed that DUSP6 knockdown decreased lipid accumulation in these cells, consistent with previous findings (Fig. 2A-C). Immunoblots revealed a decrease in CYP4A11 due to DUSP6 knockdown, accompanied by an increase in phosphorylated ERK (p-ERK). Interestingly, we found an unexpected significant increase in both p-AKT and p-FOXO1 (Fig. 2D-E).

Fig. 2.

Fig. 2

Open in a new tab

Lipid accumulations and the expression of signaling molecules in HepG2 and HuH-7 with or without DUSP6 knockdown. (A) An experimental outline to observe the effects of DUSP6 knockdown in lipid accumulations and alterations in the expression of signaling molecules in HepG2 and HuH-7. Images of Oil red O staining (B), quantitative evaluations of the Oil red O staining measured by absorbance (C), and immunoblots for signaling molecules (D) of HepG2 and HuH-7 with or without challenging of PA/OA after knockdown of DUSP6 (siDUSP6) or control (siGL2). Scale bars in panel B indicate 100 μm. (E) Quantitative evaluation of immunoblots shown in panel D as a ratio to GADPH. In the horizontal axis, 1 and 5, 2 and 6, 3 and 7, and 4 and 8 indicate relative signal intensities in PA/OA(-) after siGL2, PA/OA(-) after siDUSP6, PA/OA(+) after siGL2, and PA/OA(+) after siDUSP6, respectively, for HepG2 (1–4) and HuH-7 (5–8). * and ** indicate p < 0.05 and < 0.01, respectively. Graphs show means and standard deviations in triplicate experiments.

ERK Inhibition restores lipid accumulation inhibited by DUSP6 knockdown

To investigate the role of active MAPK/ERK in this process, we treated DUSP6-knockdowned HepG2 and HuH-7 cells with U0126, a mitogen-activated protein kinase kinase (MEK) inhibitor (Fig. 3A). The U0126 treatment blocked ERK phosphorylation and increased lipid accumulation in both HepG2 and HuH-7 with DUSP6 knockdown (Fig. 3B-C). Interestingly, while p-ERK expression decreased, the expression of p-AKT, p-FOXO1, and CYP4A11 increased. Furthermore, the expression of p-AKT and p-FOXO1 was enhanced by U0126 treatment in the condition of DUSP6 knockdown compared to the condition without DUSP6 knockdown (Fig. 3D-E).

Fig. 3.

Fig. 3

Open in a new tab

Lipid accumulations and the expression of signaling molecules in HepG2 and HuH-7 with attenuation of ERK by U0126 treatment after DUSP6 knockdown. (A) An experimental outline to observe the effects of ERK attenuation on lipid accumulations and alterations in the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA after treatment with or without DUSP6 knockdown. Images of Oil red O staining (B), quantitative evaluations of the Oil red O staining measured by absorbance (C), and immunoblots for signaling molecules (D) of HepG2 and HuH-7 challenged with PA/OA after knockdown of DUSP6 (siDUSP6) or control (siGL2) and subsequent treatment with or without U0126. Scale bars in panel B indicate 100 μm. (E) Quantitative evaluation of immunoblots shown in panel D as a ratio to GADPH. In the horizontal axis, 1 and 5, 2 and 6, 3 and 7, and 4 and 8 indicate relative signal intensities in U0126 (-) after siGL2, U0126 (+) after siGL2, U0126 (-) after siDUSP6, and U0126 (+) after siDUSP6, respectively, for HepG2 (1–4) and HuH-7 (5–8). * and ** indicate p < 0.05 and < 0.01, respectively. Graphs show means and standard deviations in triplicate experiments.

Simultaneous downregulation of ERK and AKT reduces lipid accumulation

The MAPK/ERK pathway and PI3K/AKT pathway are known to crosstalk22–24. Therefore, we examined how these pathways interact in the context of lipid accumulation (Fig. 4A). Treating HepG2 and HuH-7 with U0126 and/or MK2206, an AKT inhibitor, revealed that U0126 increased lipid accumulation, while MK2206 decreased it (Fig. 4B-C). Notably, simultaneous treatment with both U0126 and MK2206 decreased lipid accumulation in these cells. In these changes, p-ERK decreased with U0126 treatment and increased with MK2206 treatment (Fig. 4D-E). Conversely, p-AKT, p-FOXO1, and CYP4A11 increased with U0126 treatment and decreased with MK2206 treatment. Additionally, the simultaneous treatment with U0126 and MK2206 decreased p-ERK, p-AKT, p-FOXO1, and CYP4A11 compared to no treatment. Interestingly, phosphorylated RAF, an upstream molecule of MEK, and mTOR, a downstream molecule of AKT, were upregulated by the simultaneous treatment with U0126 and MK2206 in these cells, possibly due to diminished negative feedback loop of these pathways (Fig. 4F-G)25.

Fig. 4.

Fig. 4

Open in a new tab

Lipid accumulations and the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA after attenuation of ERK and/or AKT by treatment with U0126 and/or MK2206, respectively. (A) An experimental outline to observe the effects of attenuation of ERK and/or AKT in lipid accumulations and alterations of the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA after treatment with or without U0126 or/and MK2206. Images of Oil red O staining (B), quantitative evaluations of the Oil red O staining measured by absorbance (C), and immunoblots for signaling molecules (D and F) of HepG2 and HuH-7 challenged with PA/OA after treatment with U0126, MK2206, or both. Scale bars in panel B indicate 100 μm. (E and G) Quantitative evaluation of immunoblots shown in panel D and F as a ratio to GADPH. In the horizontal axis, 1 and 5, 2 and 6, 3 and 7, and 4 and 8 indicate relative signal intensities in U0126 (-) and MK2206 (-), U0126 (+) and MK2206 (-), U0126 (-) and MK2206 (+), and U0126 (+) and MK2206 (+), respectively, for HepG2 (1–4) and HuH-7 (5–8). * and ** indicate p < 0.05 and < 0.01, respectively. Graphs show means and standard deviations in triplicate experiments.

FOXO1 knockdown enhances lipid accumulation along with increased CYP4A11 expression

FOXO1 is a known repressor of several molecules, including CYP-family molecules18–21. We hypothesized that FOXO1 might regulate CYP4A11 expression. Knocking down FOXO1 in HepG2 and HuH-7 resulted in increased lipid accumulation (Fig. 5A-C). Interestingly, the expression of CYP4A11 increased while FOXO1 expression decreased in these cells (Fig. 5D-E).

Fig. 5.

Fig. 5

Open in a new tab

Lipid accumulations and the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA after FOXO1 knockdown. (A) An experimental outline to observe the effect of FOXO1 knockdown on lipid accumulations and alterations in the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA. Images of Oil red O staining (B), quantitative evaluations of the Oil red O staining measured by absorbance (C), and immunoblots for signaling molecules (D) of HepG2 and HuH-7 challenged with PA/OA after treatment with siGL2 or siFOXO1. Scale bars in panel B indicate 100 μm. (E) Quantitative evaluation of immunoblots shown in the panel D as a ratio to GADPH. In the horizontal axis, 1 and 5, 2 and 6, 3 and 7, and 4 and 8 indicate relative signal intensities in PA/OA (-) after siGL2, PA/OA (+) after siGL2, PA/OA (-) after siFOXO1, and PA/OA (+) after siFOXO1, respectively, for HepG2 (1–4) and HuH-7 (5–8). * and ** indicate p < 0.05 and < 0.01, respectively. Graphs show means and standard deviations in triplicate experiments.

CYP4A11 inhibitor reverses the increased lipid accumulation caused by FOXO1 knockdown

To determine if CYP4A11 directly influences lipid accumulation, we treated HepG2 and HuH-7 with HET0016, a 20-HETE synthetase/CYP4A inhibitor, under the FOXO1 knockdown condition (Fig. 6A). The elevated lipid accumulation induced by FOXO1 knockdown was significantly reduced by HET0016 treatment (Fig. 6B-C). This inhibition was not solely dependent on CYP4A expression levels, suggesting it may be due to the suppression of CYP4A functional activity (Fig. 6D-E). To assess CYP4A activity under HET0016 treatment, we measured the amount of 20-HETE synthesized by 20-HETE synthetase catalyzed by CYP4A11 using 20-HETE ELISA. We found that the amount of 20-HETE decreased with HET0016 treatment, indicating suppression of CYP4A11 functional activity (Fig. 6F).

Fig. 6.

Fig. 6

Open in a new tab

Lipid accumulations and the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA after FOXO1 knockdown and subsequent HET0016 administration for functional inhibition of CYP4A11. (A) An experimental outline to observe the effect of functional inhibition of CYP4A11 by HET0016 on lipid accumulations and alterations in the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA after FOXO1 knockdown. Images of Oil red O staining (B), quantitative evaluations of the Oil red O staining measured by absorbance (C), and immunoblots for signaling molecules (D) of HepG2 and HuH-7 challenged with PA/OA after treatment with siGL2 or siFOXO1 and subsequent treatment with HET0016. Scale bars in panel B indicate 100 μm. (E) Quantitative evaluation of immunoblots shown in panel D as a ratio to GADPH. In the horizontal axis, 1 and 5, 2 and 6, 3 and 7, and 4 and 8 indicate relative signal intensities in HET0016 (-) after siGL2, HET0016 (+) after siGL2, HET0016 (-) after siFOXO1, and HET0016 (+) after siFOXO1, respectively, for HepG2 (1–4) and HuH-7 (5–8). (F) Quantitative evaluation of 20-HETE by ELISA. In the horizontal axis, 1, 2, 3, and 4 indicate cells treated with siGL2 and HET0016 (-), siGL2 and HET0016 (+), siFOXO1 and HET0016 (-), and siFOXO1 and HET0016 (+), respectively. * and ** indicate p < 0.05 and < 0.01, respectively. Graphs show means and standard deviations in triplicate experiments.

Induced DUSP6 and/or CYP4A11 increases while induced FOXO1 decreases lipid accumulation

Our experiments suggested that DUSP6 and CYP4A11 promote lipid accumulation, whereas FOXO1 inhibits it. To further explore this, we overexpressed DUSP6, FOXO1, and CYP4A11 in HepG2 and HuH-7 using a tetracycline-inducible system (Fig. 7A). DUSP6 or CYP4A11 overexpression significantly increased lipid accumulation, while FOXO1 overexpression decreased it (Fig. 7B-C). Interestingly, DUSP6 overexpression led to increased endogenous CYP4A11 expression, whereas FOXO1 overexpression decreased it (Fig. 7D-E). In exploration of interactions of these proteins, co-immunoprecipitation results indicated that DUSP6 bound to FOXO1, but not apparently to p-FOXO1, while CYP4A11 did not bind to either of these proteins (Fig. 7F).

Fig. 7.

Fig. 7

Open in a new tab

Lipid accumulations, the expression of signaling molecules, and immunoprecipitation in HepG2 and HuH-7 challenged with PA/OA after induced expression of DUSP6, FOXO1, or CYP4A11. (A) An experimental outline to observe the effect of induced expression of DUSP6, FOXO1, or CYP4A11 in lipid accumulations and alterations of the expression of signaling molecules in HepG2 and HuH-7 challenged with PA/OA. Images of Oil red O staining (B), quantitative evaluations of the Oil red O staining measured by absorbance (C), and immunoblots for signaling molecules (D) of HepG2 and HuH-7 challenged with PA/OA after transfection of FLAG-DUSP6, FLAG-FOXO1, or FLAG-CYP4A11 and subsequent treatment with or without tetracycline (TET) for induction. Scale bars in panel B indicate 100 μm. (E) Quantitative evaluation of immunoblots shown in panel D as a ratio to GADPH. In the horizontal axis, 1 and 4, 2 and 5, 3 and 6, 7 and 10, 8 and 11, 9 and 12 indicate relative signal intensities in TET (-) of FLAG-DUSP6 transfection, TET (-) of FLAG-FOXO1 transfection, TET (-) of FLAG-CYP4A11 transfection, TET (+) of FLAG-DUSP6 transfection, TET (+) of FLAG-FOXO1 transfection, and TET (+) of FLAG-CYP4A11 transfection, respectively, for HepG2 (1–3, 7–9) and HuH-7 (4–6, 10–12). * and ** indicate p < 0.05 and < 0.01, respectively. (F) Immunoprecipitation assay using anti-FLAG antibody in HepG2 and HuH-7 with tetracycline-mediated induced expression of FLAG-DUSP6, FLAG-FOXO1, or FLAG-CYP4A11. Blots were probed with antibodies against native proteins of DUSP6, p-FOXO1, FOXO1 or CYP4A11. Graphs show means and standard deviations in triplicate experiments.

DUSP6 anchors FOXO1 in the cytoplasm and prevents FOXO1’s nuclear translocation and binding with the CYP4A11 promoter

We demonstrated an inverse association between CYP4A11 expression and FOXO1 expression (Fig. 5). Based on this, we hypothesized that CYP4A11 might be transcriptionally repressed by FOXO1, similar to other CYP proteins18–21. To investigate this hypothesis, we conducted a ChIP Assay to explore the binding of FOXO1 with the CYP4A11 promoter in HepG2 and HuH-7 cells. Initially, we identified two closed consensus binding sites for FOXO1, 5’-GTAAACAGGCT-3’and 5’-CT AAACAGAGT-3’, in the CYP4A11 promoter region using JASPER (https://jasper.elixir.no) (Fig. 8A). We performed PCR amplification of this region, including both binding sites, after co-immunoprecipitation with antibodies against either FOXO1 or p-FOXO1. The results showed that this genomic region was only precipitated with the anti-FOXO1 antibody (Fig. 8B), indicating that FOXO1, not p-FOXO1, translocates into the nucleus and represses CYP4A11 expression by binding to its promoter.

Fig. 8.

Fig. 8

Open in a new tab

Assays for binding of FOXO1 with the promoter of CYP4A11 and shuttling of DUSP6 and FOXO1 between the nucleus and the cytoplasm. (A) Human genomic sequence of CYP4A11 promoter region (antisense of chr1: 46,941,427 − 46,942,476 of GRCh38/hg38). Underlines indicate estimated FOXO1 binding regions by using JASPER (https://jasper.elixir.no), with bold letters indicating a primary estimated region, and plain letters indicating a secondary estimated region. Primers for chromatin immunoprecipitation (ChIP) assay are gray boxed. (B) ChIP assay for the estimated FOXO1 binding site in the CYP4A11 promoter region. Electrophoresis showed PCR products of an input control (lane 1) and immunoprecipitants with anti-FOXO1 (lane 2), anti-p-FOXO1 (lane 3) and nonspecific immunoglobulin (lane 4); and negative control (distilled water; DW) (lane 5). (C) Immunoblots of HepG2 and HuH-7 treated with DUSP6 knockdown (siDUSP6) or negative control (siGL2) separated into cytoplasmic or nuclear fractions. (D) Quantitative evaluation of immunoblots shown in panel C as a ratio to GADPH. In the horizontal axis, 1, 3, 5 and 7, and 2, 4, 6 and 8 indicate relative signal intensities in siGL2 and siDUSP6, respectively, for the cytoplasmic fraction of HepG2 (1and 2) and HuH-7 (3and 4) and the nuclear fraction of HepG2 (5 and 6) and HuH-7 (7 and 8). (E) Florescent immunocytochemistry of HepG2 and HuH-7 probed with anti-FOXO1 labeled with a FITC-conjugated secondary antibody after treatment with siGL2 or siDUSP6. Nuclei were counter stained with DAPI. (F) Quantitative evaluation of immunocytochemistry shown in panel E as a ratio of luminance in cytoplasm/nucleus. In the horizontal axis, 1 and 3, and 2 and 4 indicate relative signal intensities of cytoplasm/nucleus in siGL2-treated cells and siDUSP6-treated cells, respectively, for HepG2 (1 and 2) and HuH-7 (3 and 4). Graphs show means and standard deviations from triplicate (D) or duplicate (F) experiments. * and ** indicate p < 0.05 and < 0.01, respectively.

We then investigated whether DUSP6 could anchor FOXO1 to prevent its translocation into the nucleus, as DUSP6 is primarily expressed in the cytoplasm2. To test this, we prepared cytoplasmic and nuclear fractions to examine the expression of DUSP6 and FOXO1 in HepG2 and HuH-7 cells with or without DUSP6 knockdown. As anticipated, DUSP6 expression was only detected in the cytoplasmic fraction, while FOXO1 was present in both fractions. Importantly, the expression of FOXO1 increased in the nuclear fraction when DUSP6 was knocked down (Fig. 8C-D). Additionally, we observed an increase in the nuclear expression of FOXO1 following DUSP6 knockdown using immunofluorescent cytochemistry (Fig. 8E, F). These findings suggest that DUSP6 anchors FOXO1 in the cytoplasm, preventing its translocation into the nucleus.

Overall, our study delineates that DUSP6 interferes with FOXO1’s repressive activity towards CYP4A11 by anchoring it in the cytoplasm, thereby preventing its translocation into the nucleus. This interference leads to the induction of CYP4A11 expression, promoting lipid accumulation in human hepatocyte-lineage cells (Fig. 9).

Fig. 9.

Fig. 9

Open in a new tab

The mechanism of control of CYP4A11 expression by DUSP6 via FOXO1 along with AKT in lipid accumulation in human hepatocyte-linage cells. (A) Lipid accumulation is downregulated by activation of RAS-MAPK/ERK pathway while upregulated by activation PI3K-AKT pathway. DUSP6 controls CYP4A11 expression by interfering with the repressing activity of FOXO1 toward CYP4A11. (B) DUSP6 anchors FOXO1 in the cytoplasm and prevents its translocation into the nucleus, unleashing CYP4A11 expression that mediates lipid accumulation.

Discussion

We previously demonstrated that lipid accumulation in the liver was significantly reduced in Dusp6-knockout mice fed a high-fat diet compared to wild-type mice12. This was due to the absence of Dusp6’s promotion of Cyp4a activity, which is crucial for lipid metabolism. However, the mechanism by which DUSP6 regulates CYP4A expression remained unclear. In this study, we showed that DUSP6 plays a key role in lipid accumulation in human hepatocyte-lineage cells by inhibiting FOXO1’s repression of CYP4A11, leading to increased CYP4A11 expression and subsequent lipid accumulation.

Initially, we observed a decrease in lipid accumulation with DUSP6 knockdown and reduced CYP4A11 levels in human hepatocyte-lineage cells, despite an increase in p-ERK. DUSP6 knockdown led to increased expression of p-AKT and p-FOXO1. While the crosstalk between the MAPK/ERK and PI3K/AKT pathways is known22–24, the specific roles of these signals in lipid accumulation were unclear. Our experiments showed that downregulating ERK increased lipid accumulation, while downregulating AKT decreased it. Simultaneous downregulation of ERK and AKT resulted in decreased lipid accumulation. Interestingly, downregulating ERK activated AKT, and vice versa. This suggests that AKT activation is more directly associated with lipid accumulation than ERK under physiological conditions. DUSP6 knockdown, which led to simultaneous upregulation of ERK and AKT, did not increase lipid accumulation. This suggests that AKT activation mediated through DUSP6 is crucial for lipid accumulation, while lipid accumulation in the absence of DUSP6 may depend on ERK activation. Therefore, DUSP6 appears to be a key regulator determining whether lipid accumulation is dependent on the ERK or AKT pathway.

Crucially, lipid accumulation was tightly associated with CYP4A11 expression. This suggests that CYP4A11 may be a direct effector for lipid accumulation, and DUSP6 could potentially control CYP4A11. Previous reports have shown that several CYP family molecules are regulated by the transcriptional repressive function of FOXO118–21. Therefore, we hypothesized that CYP4A11 might be repressed by FOXO1, and DUSP6 could interfere with its repressive activity. Our experiments demonstrated that FOXO1 knockdown increased the expression of CYP4A11 and, subsequently, lipid accumulation. Interestingly, the expression of DUSP6, ERK, and AKT did not change in this condition, indicating that these molecules were not directly regulated by FOXO1. Further experiments showed that induced expression of DUSP6 and CYP4A11 led to increased lipid accumulation, while induced expression of FOXO1 decreased CYP4A11 expression and lipid accumulation. Additionally, we found that FOXO1 bound to the promoter of CYP4A11, suggesting that FOXO1 represses the transcriptional expression of CYP4A11, and DUSP6 may interfere with this repression.

Wu et al.26 reported that Mkp-3, a synonym of DUSP6, may dephosphorylate Foxo1, promote its nuclear translocation, and induce the expression of genes related to gluconeogenesis in experiments conducted in mouse liver and rodent-derived cells. Our experiments revealed that the knockdown of DUSP6 led to increased expression of p-FOXO1, while the overexpression of DUSP6 did not significantly decrease p-FOXO1 levels. Immunoprecipitation showed binding of DUSP6 with FOXO-1 and apparent unbinding between DUSP6 and p-FOXO1, which may indicate immediate dephosphorylation of p-FOXO1 by DUSP6. Therefore, our findings may not contradict those of Wu et al., supporting the idea that FOXO1 is a substrate of DUSP6. On the other hand, Wu et al. suggested that the dephosphorylation of Foxo1 by Mkp-3 facilitates its nuclear translocation and functions as a transcriptional activator of genes related to gluconeogenesis. They demonstrated that Mkp-3 knockdown led to a decrease in nuclear Foxo1 expression and an increase in cytoplasmic p-FOXO1. Our experiment showed that DUSP6 knockdown increased nuclear expression of FOXO1 in HepG2 and HuH-7 human cells. It is known that FOXO1 shuttles between the nucleus and cytoplasm, with phosphorylated FOXO1 being exported and dephosphorylated FOXO1 being imported27–29. While AKT is known to phosphorylate FOXO1, the identity of the phosphatase responsible for its dephosphorylation remains unknown, although DUSP6 is a potential candidate. Our experiments indicated that AKT phosphorylation was closely linked to FOXO1 phosphorylation and the upregulation of CYP4A11 expression. This implies that AKT-mediated phosphorylation of FOXO1 facilitates nuclear exclusion of FOXO1, voiding its repressive function towards CYP4A11. Wu et al.26 conducted an experiment to observe the shuttling of Foxo1 in mouse liver, where AKT might be more active in immediately phosphorylating FOXO1 and facilitating its export compared to our experimental system using HepG2 and HuH-7 cells. Therefore, the difference in experimental systems, specifically in models (in vitro cell culture versus in vivo liver tissue) and strains (human versus mouse), may contribute to these apparent inconsistent results. This apparent inconsistency should be addressed in a separate comparative study using a phosphatase-dead mutant of DUSP6 and detailed tracing of molecules.

It has been revealed that MASLD is associated with hepatic oxidative stress30–32. Kohjima et al.33 studied gene expression in liver tissues with MASLD and reported elevated expression of fatty acid oxidation-related genes in the mitochondria, peroxisomes, and microsomes, including CYP4A11. This indicates that β-oxidation in mitochondria and peroxisomes, and ω-oxidation in microsomes are upregulated. Additionally, superoxide dismutase and catalase levels are increased, suggesting that neutralization of reactive oxygen species (ROS) produced during mitochondrial, peroxisomal, and microsomal oxidation of fatty acids is necessary. Gao et al.34 demonstrated that plasma levels of CYP4A11 and lipid peroxidation products are elevated in plasma of MASLD patients compared to normal subjects. They experimentally showed that CYP4A11 expression and ROS are increased in HepG2 cells challenged with free fatty acids (FFA). Moreover, treatment with HET0016, a CYP4A11 inhibitor, significantly reduced intracellular ROS production and mitigated apoptosis in FFA-challenged HepG2 cells.

We showed that HET0016 reduced lipid accumulation. This suggests that the level of 20-HETE is crucial for lipid accumulation. 20-HETE has various activities, including inflammation progression35, vasospasm36, hematopoiesis37, and elevation of mitochondrial β-oxidation38. Increased 20-HETE may enhance mitochondrial β-oxidation, leading to the generation of ROS that contribute to oxidative damage associated with lipid accumulation and inflammation39. It should be clarified how the generation of ROS would be altered by the activity of CYP4A11 or 20-HETE, and whether this alteration would impact lipid accumulation. Downstream targets or pathways should also be examined to establish a mechanistic link between CYP4A11 and lipid accumulation in hepatocytes. These are important issues to be investigated in the next step.

There are several limitations to our study. We used HepG2 and HuH-7 cell lines to study lipid accumulation in human hepatocyte lineage cells. HepG2 and HuH-7 cells are commonly used in liver research in vitro due to their ease of culture, reproducibility, and ability to conduct mechanistic studies18,28,39. However, their metabolic gene expression profiles differ significantly from those of primary human hepatocytes (PHH)40–43. Transcriptomic comparisons have shown that while HepG2 and HuH-7 share some baseline hepatic gene expression patterns, they cluster separately from PHH and have distinct expression levels across many metabolic pathways, reflecting their tumor-derived nature and altered differentiation status. Although there is limited information on CYP4A11 expression in HuH-7 cells, it has been shown that HepG2 cells express CYP4A11 when exposed to FFA, leading to an increase in ROS34. HepG2 cells are also utilized as an in vitro model for MASLD by exposing them to OA to investigate the involvement of CYP4A11 in the disease setting44. Similarly, FOXO1 expression and regulation have been observed in HepG2 and related hepatoma cell lines, with phosphorylation-dependent modulation of FOXO1 activity reported in HepG2 models of intracellular signaling, including fatty acid metabolism39,45. Independent analyses have shown detectable levels of FOXO1 protein and transcript in HepG2 and HuH-7 cells relative to PHH, but the absolute levels and activity states are influenced by oncogenic signaling pathways. In contrast, PHH exhibit robust regulation of FOXO1 in response to hormones and nutrients, driving metabolic programs with physiological fidelity that is not fully replicated in tumor-derived cell lines46. It is important to note that both HepG2 and HuH-7 cells have limited metabolic competence compared to PHH. Key drug-metabolizing enzymes and nuclear receptors are expressed at lower levels, and their responses to metabolic cues, such as lipid and carbohydrate stimuli, differ quantitatively and qualitatively from PHH. These differences may impact the observed expression and regulatory dynamics of CYP4A11/FOXO1, potentially underestimating or misrepresenting regulation that would occur in non-transformed hepatocytes. Therefore, while these cell lines offer valuable mechanistic insights, caution should be exercised when interpreting their translational relevance to human liver physiology, and key findings should ideally be validated in PHH or more metabolically competent models when possible.

While we demonstrated the binding of FOXO1 to the CYP4A11 promoter, suggesting transcriptional repression by FOXO1, we did not directly assess FOXO1’s repressive activity on CYP4A11 expression through a promoter-reporter assay, which could be addressed in future experiments.

We performed knockdown experiments using siRNA and overexpression experiments using TET-inducible system. However, direct rescue experiments may be needed to ensure the effect of gene knockdown and overexpression.

Materials and methods

Cell lines

Human liver cancer cell lines HepG2 and HuH-7 were used in this study as human hepatocyte lineage cells. HepG2 (TKG 0205) was obtained from The Cell Resource Center for Biomedical Research of the Institute of Development, Aging, and Cancer of Tohoku University (Sendai, Japan), and HuH-7 (https://cellbank.brc.riken.jp/cell_bank/CellInfo/?cellNo=RCB1366&lang=Ja) was obtained from RIKEN BRC CELL BANK. Both HepG2 and HuH-7 were cultured with Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum and 1% penicillin/streptomycin.

Primary antibodies

Anti-phospho-p44/42 MAPK (Erk1/2) (1:1000, Thr202/Tyr204; p-ERK) (D13.14.4E, #4370S), anti-ERK (1:1000, 137F5, #4695S), anti-phospho-AKT (1:1000, Ser473; p-AKT) (D9E, #4060S), anti-AKT (1:1000, C67E7, #4691S), anti-FOXO1 (1:1000, C29H4, #2880S), anti-phospho-FOXO1 (Ser256) (1:1000, #9461S), anti-GAPDH (1:1000, D16H11, #5174S), anti-MTOR (1:1000, 7C10, #2983S), anti-phospho-c-RAF (Ser259; p-RAF) (1:1000,#9421S), and anti-RAF (1:1000, D5 × 6R, #12552S) were purchased from Cell Signaling Technology (Danvers, MA, USA). Recombinant anti-DUSP6 (1:1000, EPR129Y, ab76310), recombinant anti-Cytochrome P450 4 A/CYP4A11 (1:1000, EPR8276, ab140635), and anti-FLAG (1:1000, DDDDK, EPR20018-251, ab205606) were purchased from Abcam (Cambridge, UK). Anti-acetyl-Histone H3 (1:1000, 06–599) was purchased from Sigma-Aldrich (St. Louis, MO, USA).

Oil red O staining

Palmitic acid (PA; Sigma-Aldrich) and oleic acid (OA; Sigma-Aldrich) were dissolved in 0.01 M sodium hydroxide, diluted in PBS with 10% bovine serum albumin (Nacalai Tesque Inc., Kyoto, Japan), and added to the medium to achieve a final concentration of 0.25 mM PA, 0.5 mM OA. After incubation for 24 h, cells were fixed with 10% formalin solution for 2 h and stained with 60% oil red O (MUTO PURE CHEMICALS Co, Ltd., Tokyo, Japan) for 30 min to visualize lipid accumulation. In quantitative evaluation of oil red O staining, incorporated oil red O was eluted in 100% isopropanol, then the absorbance with a wavelength of 492 nm was measured by VersaMax Microplate Reader (Molecular Devices, LLC., San Jose, CA, USA).

Short interference RNA

To knockdown DUSP6 or FOXO1 expression, HepG2 cells and HuH-7 cells were transfected with 10 µM of siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. The sequences of DUSP6 siRNA (Integrated DNA Technologies, Inc., Coralville, WI, USA), FOXO1-siRNA (Integrated DNA Technologies, Inc.), and luciferase (GL2)-siRNA (Integrated DNA Technologies, Inc.) were shown in Table 1. siRNAs in three different sequences (#1-#3) were prepared, and a siRNA that achieved the most efficient knockdown of target proteins revealed by immunoblotting was used for subsequent assays (siDUSP6 #2, siFoxO1 #1).

Table 1.

SiRNAs for DUSP6, FOXO1 and GL2.

DUSP6 siRNA #1 sense 5’ – AUGCUUGACUUUACCAAU – 3’
#1 antisense 5’ – CAUCAGAAUUGGUAAAGU – 3’
#2 sense 5’ – AGAACUGUGGUGUCUUG – 3’
#2 antisense 5’ – CAAUGUACCAAGACACCA – 3’
#3 sense 5’ – CUCUCUGCAAUCUACGUG − 3’
#3 antisense 5’ – GGUCUUUCACGUAGAUUG – 3’
FOXO1 siRNA #1 sense 5’ – GAUGUUUCUGACUAAUCU – 3’
#1 antisense 5’ – UGAUUUAAGAUUAGUCAG – 3’
#2 sense 5’ – GGAUAAUCUCAACCUUCU – 3’
#2 antisense 5’ – UGAUGAGAGAAGGUUGA – 3’
#3 sense 5’ – UCCAUGGACAACAACAGU − 3’
#3 antisense 5’ – CAAAUUUACUGUUGUUGU – 3’
GL2 siRNA sense 5’ - CGUACGCGGAAUACUUCGAAAUGTC- 3’
antisense 5’ – GACAUUUCGAAGUAUUCCGCGUACGUG − 3’
Open in a new tab

Inhibitor treatment

For attenuation of ERK or/and AKT, 10 µM of MEK inhibitor U0126 (Sigma-Aldrich) or/and 10 µM of AKT inhibitor MK2206 (WAKO, Osaka, Japan) were administered in the final concentrations of 10 µM for each to cultured cells and incubated for 12 h. Then, 0.25 mM of PA and 0.5 mM of OA mixture was added and incubated for 24 h. Cells were stained with oil red O or lysed for immunoblots.

For functional inhibition of CYP4A11, HET0016 (Sigma-Aldrich) was administered in the final concentration of 10 µM to cultured cells and incubated for 3 h. Then, 0.25 mM of PA and 0.5 mM of OA mixture was added and incubated for 24 h. Cells were stained with oil red O or lysed for immunoblots.

Immunoblot analysis and Immunoprecipitation

Cells were lysed in RIPA buffer (Sigma-Aldrich) with proteinase inhibitor (Complete Mini, Roche Diagnostics, Rotkreuz, Switzerland) and PhosSTOP, phosphatase inhibitor (PHPSS-RO) (Roche Diagnostics). The collected cells were sonicated by Bioruptor (Cosmobio, Tokyo, Japan). The supernatant was collected as a cell lysate sample after centrifugation (12,000 rpm, 30 min, 4 °C). The concentration of lysed protein was evaluated with DC Protein Assay (BioRad, Berkeley, USA) according to the manufacturer’s instruction.

To separate a cytoplasmic fraction and a nuclear fraction, trypsinized culture cells were lysed with Tris-based lysis buffer (20mM Tris-HCl, pH 7.4, 200 mM Sodium Chloride, 2.5 mM Magnesium Chloride, 0.05% NP-40 substitute) for 30 min on ice, the lysed cells were centrifuged at 20,000 rpm for 30 min at 4 °C, and then the supernatant was collected as a cytoplasmic fraction. Then, the pellet containing nuclei was washed with PBS, lysed in RIPA buffer, and collected as a nuclear fraction.

For immunoprecipitation, Pierce™ Classic Magnetic IP/Co-IP Kit (Thermo Fisher Scientific) was used with anti-FOXO1 antibody or anti-p-FOXO1 antibody according to the manufacturer’s instructions. MG132 (proteasome inhibitor, Abcam) was added in the concentration of 10µM to prevent degradation of p-FOXO1 for 9 h. No cytotoxicity of MG132 in this concentration for these cell lines was verified (Supplemental Fig. 1).

The cell lysates containing 20 µg of protein were electrophoresed on a 5–20% SuperSep™ Ace gel (WAKO) and transferred to Clear Blot Membrane-p (ATTO, Tokyo, Japan). The blot was blocked using PBS with 0.1% Tween-20 containing 2.5% Skim milk (Morinaga, Tokyo, Japan). After using appropriate primary antibodies (identified above), secondary antibodies used were a horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin (1:10,000; Cell Signaling Technology). The primary antibody reactions were performed for overnight. Signals were visualized by reaction with Chemi-Lumi One Super (Nacalai Tesque) and digitally processed using LAS 4000 mini-CCD camera system (Fujifilm, Tokyo, Japan). To quantify the protein bands, the density of each band was measured using ImageJ. Initially, the densities of the bands for each protein were normalized to the leftmost band in each cell line on a blot. In the next step, the normalized values were divided by their corresponding normalized GAPDH values to correct for variations in loading amounts. Uncropped images were provided in Supplemental Fig. 2.

20-HETE ELISA

Cultured cells were lysed in RIPA buffer added with 0.1 mM triphenylphosphine and then adjusted to pH 3.0–4.0 using acetic acid. The equal volume of ethyl acetate was added to adjusted cell lysates and dried up completely. Dried samples were eluted into 100% ethanol, and these samples were analyzed by 20 HETE ELISA kit (Abcam) according to the manufacturer’s instructions.

Induced expression

The vector containing cDNA encoding human FLAG-FOXO1 was obtained from Addgene (Watertown, MA, USA; https://www.addgene.org/153141/). FOXO1 cDNA was amplified by PCR using paired primers for FLAG-FOXO1 (Table 2) and the purchased vector as a template in 40 cycles of 94 °C for 30 s, 81 °C for 30 s, and 72 °C for 2 min. DUSP6 cDNA was amplified by PCR using paired primers for DUSP6 (Table 2) and a vector previously prepared as a template4. CYP4A11 cDNA was amplified by PCR using paired primers for CYP4A11 (Table 2) and a pooled cDNA prepared from a human liver cDNA library (Stratagene, La Jolla, CA) as a template. PCR conditions for DUSP6 and CYP4A11 were 40 cycles of 94 °C for 30 s, 62 °C for 30 s, and 72 °C for 1 min. pTet-One was amplified by PCR using paired primers for pTetOne (Table 2) and pTetOne vector (TAKARA Bio, Tokyo, Japan) in 40 cycles of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 5 min. All PCR reactions were performed in the GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA, USA). Amplified products were gel-electrophoresed, cut from the gel, purified with the PureLink Quick Gel Extraction Kit (Thermo Fisher), and cloned into a pTetOne vector using the in-fusion cloning method as described by the manufacturer (TAKARA Bio). Prepared plasmid vectors were used for transformation of Stellar competent cells (TAKARA Bio), spread on an agar plate with ampicillin, and incubated at 37 °C overnight. The correct inserted colony was verified by PCR using FLAG-FOXO1 (the same conditions as mentioned above) and picked into a large-scale culture. Plasmid DNA was obtained as pTet-One (FLAG-FOXO1) using NucleoBond Xtra Maxi (TAKARA Bio). Xfect Transfection Reagent (TAKARA Bio) was used for transient transfection of HepG2 cells and HuH-7 cells grown in a 6-well plate. For induced expression of cloned genes in the pTetOne vectors, 1 µM/mL tetracycline was added to the supernatant in cultured wells (dimethyl sulfoxide (DMSO) was used as a negative control).

Table 2.

Primers for preparation of plasmid vectors.

pTet-One Forward 5’ – TGCGGCCGCGAATTCTTTAC – 3’
Reverse 5’ – GGTGGATCCAGATCTCTGCAGC – 3’
FLAG-FOXO1 Forward 5’ – AGATCTGGATCCACCGAGCTCGATCGGACTGTGGG – 3’
Reverse 5’ – GAATTCGCGGCCGCATACCTAATGTTCCTGCTGCTGC – 3’
CYP4A11 Forward 5’ – ATGCTGCAGAGATCTAGTTTCGACCAGGAACAGAAG − 3’
Reverse 5’ – CTGCTGCTGCTATTCTCACAGAGACACGACTCG – 3’
DUSP6 Forward 5’ – ATGCTGCAGAGATCTAGTGCATCTAACGTCTCTCAG – 3’
Reverse 5’ – CTGCTGCTGCTATTCTATCTATGCGAGTCTGGG – 3’
pTet-One FLAG Forward 5’ – GAATAGCAGCAGCAGGAACATTAG – 3’
Reverse 5’ – AGATCTCTGCAGCATATGTCTAGAGG – 3’
Open in a new tab

ChIP assay

Cells of HepG2 and HuH-7 were seeded at 7 × 106 cells per dish in 10-cm culture dishes. 24 hours after seeding, cells were fixed with a 1% formaldehyde solution and collected. The collected cells were sonicated in a Biorupter and immunoprecipitated with monoclonal anti-FOXO1 antibody (1:100) or Normal Rabbit IgG (1:100), a nonspecific immunoglobulin (1:100, Cell Signaling Technology) using the ChIP-IT Express kit (Active Motif, Carlsbad, CA, USA). Paired primers of 5’-ACAGATTGTCCTTGGTCAGG-3’ and 5’-GGTATGACTTTTTCCCCTATTG-3’ were used to amplify a 198 bp region centered on the CYP4A11 promoter region, and Taq DNA Polymerase with Standard Taq Buffer (NEW ENGLAND Biolabs Inc., Ipswich, MA, USA) was used for the PCR reaction.

Fluorescent immunocytochemistry

Cells of HepG2 and HuH-7 transfected with the siRNA (siGL2 or siDUSP6) were seeded at 5,000 cells per well in a 4-well chamber-slide 24 h after transfection. After 24 h from seeding into the chamber-slide, MG132 10µM was added for 24 h. Then, cells were fixed with 4% formaldehyde and blocked using a blocking buffer (10% normal serum and 0.3% Triton-X-100). The fixed cells were incubated with the anti-FOXO1 antibody, 1:50 dilution, overnight at 4 °C as a primary antibody reaction, washed with PBS, and then incubated with Goat anti-Rabbit IgG (H + L) Cross-Adsorbed secondary antibody, Alexa Fluor 488 (Invitrogen), 1:100 dilution, for 2 h at room temperature as a secondary antibody reaction. Finally, cells were observed with an LSM 800 Confocal Laser Scanning Microscope (ZEISS, Oberkochen, Germany). The fluorescent levels in the cytoplasmic fraction or nucleus fraction were quantified by densitometry using ImageJ software.

Statistical analysis

Statistical significance was assessed with Student’s t-test with two-sided distributions. A P-value of less than 0.05 was considered significant.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (2.1MB, docx)

Author contributions

Masanobu Kimura: Investigation, Formal analysis, Writing-Original draft preparation. Yuriko Saiki: Conceptualization, Methodology, Investigation, Visualization, Funding acquisition, Writing - Review & Editing. Kosei Iwata: Investigation. Keigo Murakami: Investigation. Toru Furukawa: Conceptualization, Methodology, Visualization, Supervision, Writing - Review & Editing. All authors read and approved the final manuscript.

Funding

This work was supported by JSPS KAKENHI Grant Number JP23K06477 to YS.

Data availability

The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval

All experiments were performed in accordance with relevant guidelines and regulations.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Yuriko Saiki, Email: yuriko.saiki.e4@tohoku.ac.jp.

Toru Furukawa, Email: toru.furukawa.e2@tohoku.ac.jp.

References

  • 1.Lang, R., Hammer, M. & Mages, J. DUSP Meet immunology: dual specificity MAPK phosphatases in control of the inflammatory response. J. Immunol.177, 7497–7504. 10.4049/jimmunol.177.11.7497 (2006). [DOI] [PubMed] [Google Scholar]
  • 2.Muda, M. et al. MKP-3, a novel cytosolic protein-tyrosine phosphatase that exemplifies a new class of mitogen-activated protein kinase phosphatase. J. Biol. Chem.271, 4319–4326 (1996). [DOI] [PubMed] [Google Scholar]
  • 3.Furukawa, T., Tanji, E., Xu, S. & Horii, A. Feedback regulation of DUSP6 transcription responding to MAPK1 via ETS2 in human cells. Biochem. Biophys. Res. Commun.377, 317–320. 10.1016/j.bbrc.2008.10.003 (2008). [DOI] [PubMed] [Google Scholar]
  • 4.Furukawa, T., Sunamura, M., Motoi, F., Matsuno, S. & Horii, A. Potential tumor suppressive pathway involving DUSP6/MKP-3 in pancreatic cancer. Am. J. Pathol.162, 1807–1815. 10.1016/S0002-9440(10)64315-5 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chan, D. W. et al. Loss of MKP3 mediated by oxidative stress enhances tumorigenicity and chemoresistance of ovarian cancer cells. Carcinogenesis29, 1742–1750. 10.1093/carcin/bgn167 (2008). [DOI] [PubMed] [Google Scholar]
  • 6.Okudela, K. et al. Down-regulation of DUSP6 expression in lung cancer: its mechanism and potential role in carcinogenesis. Am. J. Pathol.175, 867–881. 10.2353/ajpath.2009.080489 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang, X. et al. Utility of patient-derived xenografts to evaluate drug sensitivity and select optimal treatments for individual non-small-cell lung cancer patients. Mol. Med.30, 209. 10.1186/s10020-024-00934-4 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Png, C. W. et al. DUSP6 regulates Notch1 signalling in colorectal cancer. Nat. Commun.15, 10087. 10.1038/s41467-024-54383-y (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Feng, B. et al. Mitogen-activated protein kinase phosphatase 3 (MKP-3)-deficient mice are resistant to diet-induced obesity. Diabetes63, 2924–2934. 10.2337/db14-0066 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu, R. et al. Mice lacking DUSP6/8 have enhanced ERK1/2 activity and resistance to diet-induced obesity. Biochem. Biophys. Res. Commun.533, 17–22. 10.1016/j.bbrc.2020.08.106 (2020). [DOI] [PubMed] [Google Scholar]
  • 11.Pfuhlmann, K. et al. Dual specificity phosphatase 6 deficiency is associated with impaired systemic glucose tolerance and reversible weight retardation in mice. PLoS One. 12, e0183488. 10.1371/journal.pone.0183488 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jiang, C. et al. Ablation of Dual-Specificity phosphatase 6 protects against nonalcoholic fatty liver disease via cytochrome P450 4A and Mitogen-Activated protein kinase. Am. J. Pathol.193, 1988–2000. 10.1016/j.ajpath.2023.09.003 (2023). [DOI] [PubMed] [Google Scholar]
  • 13.Powell, P. K., Wolf, I. & Lasker, J. M. Identification of CYP4A11 as the major lauric acid omega-hydroxylase in human liver microsomes. Arch. Biochem. Biophys.335, 219–226. 10.1006/abbi.1996.0501 (1996). [DOI] [PubMed] [Google Scholar]
  • 14.Johnson, A. L., Edson, K. Z., Totah, R. A. & Rettie, A. E. Cytochrome P450 omega-Hydroxylases in inflammation and cancer. Adv. Pharmacol.74, 223–262. 10.1016/bs.apha.2015.05.002 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Galili, N. et al. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat. Genet.5, 230–235. 10.1038/ng1193-230 (1993). [DOI] [PubMed] [Google Scholar]
  • 16.Xing, Y. Q. et al. The regulation of FOXO1 and its role in disease progression. Life Sci.193, 124–131. 10.1016/j.lfs.2017.11.030 (2018). [DOI] [PubMed] [Google Scholar]
  • 17.Behl, T. et al. Exploring the genetic conception of obesity via the dual role of FoxO. Int. J. Mol. Sci.2210.3390/ijms22063179 (2021). [DOI] [PMC free article] [PubMed]
  • 18.Li, T. et al. Forkhead box transcription factor O1 inhibits cholesterol 7alpha-hydroxylase in human hepatocytes and in high fat diet-fed mice. Biochim. Biophys. Acta. 1791, 991–996. 10.1016/j.bbalip.2009.05.004 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tang, L. et al. FOXO1-regulated LncRNA CYP1B1-AS1 suppresses breast cancer cell proliferation by inhibiting neddylation. Breast Cancer Res. Treat.202, 397–408. 10.1007/s10549-023-07090-z (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhu, J. et al. Eicosatrienoic acid inhibits estradiol synthesis through the CD36/FOXO1/CYP19A1 signaling pathway to improve PCOS in mice. Biochem. Pharmacol.229, 116517. 10.1016/j.bcp.2024.116517 (2024). [DOI] [PubMed] [Google Scholar]
  • 21.Konstandi, M., Cheng, J. & Gonzalez, F. J. Sex steroid hormones regulate constitutive expression of Cyp2e1 in female mouse liver. Am. J. Physiol. Endocrinol. Metab.304, E1118–1128. 10.1152/ajpendo.00585.2012 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Duan, S. et al. Loss of FBXO31-mediated degradation of DUSP6 dysregulates ERK and PI3K-AKT signaling and promotes prostate tumorigenesis. Cell. Rep.37, 109870. 10.1016/j.celrep.2021.109870 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Stulpinas, A. et al. Crosstalk between protein kinases AKT and ERK1/2 in human lung tumor-derived cell models. Front. Oncol.12, 1045521. 10.3389/fonc.2022.1045521 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dent, P. Crosstalk between ERK, AKT, and cell survival. Cancer Biol. Ther.15, 245–246. 10.4161/cbt.27541 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dumaz, N. & Marais, R. Raf phosphorylation: one step forward and two steps back. Mol. Cell.17, 164–166. 10.1016/j.molcel.2005.01.001 (2005). [DOI] [PubMed] [Google Scholar]
  • 26.Wu, Z. et al. MAPK phosphatase-3 promotes hepatic gluconeogenesis through dephosphorylation of forkhead box O1 in mice. J. Clin. Invest.120, 3901–3911. 10.1172/JCI43250 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Matsuzaki, H., Daitoku, H., Hatta, M., Tanaka, K. & Fukamizu, A. Insulin-induced phosphorylation of FKHR (Foxo1) targets to proteasomal degradation. Proc. Natl. Acad. Sci. U S A. 100, 11285–11290. 10.1073/pnas.1934283100 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Huang, H. et al. Skp2 inhibits FOXO1 in tumor suppression through ubiquitin-mediated degradation. Proc. Natl. Acad. Sci. U S A. 102, 1649–1654. 10.1073/pnas.0406789102 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Guo, S. et al. Phosphorylation of Serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence. J. Biol. Chem.274, 17184–17192. 10.1074/jbc.274.24.17184 (1999). [DOI] [PubMed] [Google Scholar]
  • 30.Basaranoglu, M., Basaranoglu, G. & Senturk, H. From fatty liver to fibrosis: a Tale of second hit. World J. Gastroenterol.19, 1158–1165. 10.3748/wjg.v19.i8.1158 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Robertson, G., Leclercq, I. & Farrell, G. C. Nonalcoholic steatosis and steatohepatitis. II. Cytochrome P-450 enzymes and oxidative stress. Am. J. Physiol. Gastrointest. Liver Physiol.281, G1135–1139. 10.1152/ajpgi.2001.281.5.G1135 (2001). [DOI] [PubMed] [Google Scholar]
  • 32.Arif Asghar, M. et al. NRF2 pathway activation as a molecular toxicology mechanism in oxidative stress and lipid metabolic disorders. J. Biochem. Mol. Toxicol.39, e70633. 10.1002/jbt.70633 (2025). [DOI] [PubMed] [Google Scholar]
  • 33.Kohjima, M. et al. Re-evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease. Int. J. Mol. Med.20, 351–358 (2007). [PubMed] [Google Scholar]
  • 34.Gao, H., Cao, Y., Xia, H., Zhu, X. & Jin, Y. CYP4A11 is involved in the development of nonalcoholic fatty liver disease via ROS–induced lipid peroxidation and inflammation. Int. J. Mol. Med.45, 1121–1129. 10.3892/ijmm.2020.4479 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ni, K. D. & Liu, J. Y. The functions of cytochrome P450 omega-hydroxylases and the associated eicosanoids in Inflammation-Related diseases. Front. Pharmacol.12, 716801. 10.3389/fphar.2021.716801 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hoopes, S. L., Garcia, V., Edin, M. L., Schwartzman, M. L. & Zeldin, D. C. Vascular actions of 20-HETE. Prostaglandins Other Lipid Mediat. 120, 9–16. 10.1016/j.prostaglandins.2015.03.002 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tsai, I. J., Croft, K. D., Puddey, I. B., Beilin, L. J. & Barden, A. 20-Hydroxyeicosatetraenoic acid synthesis is increased in human neutrophils and platelets by angiotensin II and endothelin-1. Am. J. Physiol. Heart Circ. Physiol.300, H1194–1200. 10.1152/ajpheart.00733.2010 (2011). [DOI] [PubMed] [Google Scholar]
  • 38.Hardwick, J. P. Cytochrome P450 Omega hydroxylase (CYP4) function in fatty acid metabolism and metabolic diseases. Biochem. Pharmacol.75, 2263–2275. 10.1016/j.bcp.2008.03.004 (2008). [DOI] [PubMed] [Google Scholar]
  • 39.Cheng, J. et al. FOXO1 induced fatty acid oxidation in hepatic cells by targeting ALDH1L2. J. Gastroenterol. Hepatol.39, 2197–2207. 10.1111/jgh.16662 (2024). [DOI] [PubMed] [Google Scholar]
  • 40.Guo, L. et al. Similarities and differences in the expression of drug-metabolizing enzymes between human hepatic cell lines and primary human hepatocytes. Drug Metab. Dispos.39, 528–538. 10.1124/dmd.110.035873 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Arzumanian, V., Pyatnitskiy, M. & Poverennaya, E. Comparative transcriptomic analysis of three common liver cell lines. Int. J. Mol. Sci.2410.3390/ijms24108791 (2023). [DOI] [PMC free article] [PubMed]
  • 42.Huggett, Z. J. et al. A comparison of primary human hepatocytes and hepatoma cell lines to model the effects of fatty Acids, Fructose and glucose on liver cell lipid accumulation. Nutrients1510.3390/nu15010040 (2022). [DOI] [PMC free article] [PubMed]
  • 43.Arzumanian, V. A., Timofeeva, E. V., Kiseleva, O. I. & Poverennaya, E. V. Drug-Metabolizing gene expression identity: comparison across liver tissues and model cell lines. Biomedicines1310.3390/biomedicines13112722 (2025). [DOI] [PMC free article] [PubMed]
  • 44.Yang, L. et al. RING finger protein 4 (RNF4) reduces nonalcoholic fatty liver disease accumulation by promoting the sumoylation of HIF-2alpha and regulating the PPARalpha signaling pathway. IUBMB Life. 77, e70047. 10.1002/iub.70047 (2025). [DOI] [PubMed] [Google Scholar]
  • 45.Wang, Y. et al. The ErChen Decoction and its active compounds ameliorate Non-Alcoholic fatty liver disease through activation of the AMPK signaling pathway. Pharmaceuticals (Basel). 1810.3390/ph18111707 (2025). [DOI] [PMC free article] [PubMed]
  • 46.Schicht, G., Seidemann, L., Haensel, R., Seehofer, D. & Damm, G. Critical investigation of the usability of hepatoma cell lines HepG2 and Huh7 as models for the metabolic representation of resectable hepatocellular carcinoma. Cancers (Basel). 14. 10.3390/cancers14174227 (2022). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (2.1MB, docx)

Data Availability Statement

The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES