Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2002 Nov;46(11):3540–3548. doi: 10.1128/AAC.46.11.3540-3548.2002

An Elevated Mutation Frequency Favors Development of Vancomycin Resistance in Staphylococcus aureus

Franziska Schaaff 1,*, Andrea Reipert 1, Gabriele Bierbaum 1
PMCID: PMC128741  PMID: 12384362

Abstract

The emergence of intermediate vancomycin resistance, mainly in methicillin-resistant Staphylococcus aureus strains, has become a great concern. Thorough characterization of clinical and laboratory vancomycin-intermediately resistant S. aureus (VISA) strains identified multiple, resistance-associated changes most probably due to stepwise mutations. We hypothesized that an elevated mutation frequency as found, e.g., in mutator strains defective in DNA mismatch repair could allow rapid acquisition of adaptive mutations in the presence of vancomycin. We therefore subjected S. aureus RN4220 and its isogenic mutator strain, the mutS-knockout mutant RN4220ΔmutS, to a stepwise vancomycin selection procedure. Vancomycin resistance evolved much more quickly in the mutator background than in the wild type (5 versus 19 passages, respectively). In addition, a higher resistance level could be reached (MIC, 32 versus 4 μg/ml, respectively). The susceptibility to other antibiotics with the exception of teicoplanin remained unchanged. Concomitantly with increasing vancomycin resistance, a loss of phage typeability and differences in growth behavior as well as an improved ability to regrow at high vancomycin concentrations were observed. In conclusion, an elevated mutation rate in S. aureus led to the rapid development of vancomycin resistance, indicating that a high mutation frequency could be one of the factors that favor the emergence of vancomycin resistance in S. aureus.


Staphylococcus aureus causes severe community-acquired and nosocomial disease. The glycopeptide antibiotic vancomycin has long been reserved for treatment of infections with methicillin-resistant S. aureus (MRSA). However, over the last 10 years, vancomycin-intermediately resistant S. aureus strains, mainly MRSA strains, have emerged in many countries (5, 11, 14, 15, 25, 35). According to the National Committee for Clinical Laboratory Standards (NCCLS), strains for which the MIC of vancomycin is ≤4 μg/ml in Mueller-Hinton (MH) medium are considered susceptible whereas strains for which the MIC is >16 μg/ml are considered resistant to vancomycin. For most clinical isolates that have been reported so far, MICs of vancomycin are 8 μg/ml, and thus these isolates are considered intermediately resistant. Nevertheless, these strains are of clinical importance since treatment failure has been reported elsewhere (24, 35, 43). Many strains display a heterogeneous phenotype, i.e., although the overall MICs for them are ≤4 μg/ml, subpopulations resistant to higher vancomycin concentrations are present at a frequency of at least 10−6 (24). Higher MICs up to 100 μg/ml have been obtained for strains that were selected by stepwise passage on vancomycin agar in the laboratory (7, 13, 40).

The low-level resistance of clinical S. aureus isolates is not associated with one of the van gene clusters which mediate the high-level resistance in enterococci (21, 46). Up to now, the mechanism leading to vancomycin resistance in staphylococci has not been fully understood. The thorough characterization of the clinical isolates as well as of laboratory mutants revealed numerous changes which affect the S. aureus cell wall structure or cell wall metabolism and lead to an increased number of false binding sites for vancomycin (9, 12, 13, 21, 22, 39, 40, 42). However, not every vancomycin-resistant S. aureus strain is characterized by the same features (9). This observation leads to the hypothesis that multiple mutations may give rise to diverse changes which then together mediate vancomycin resistance (23, 39, 42). The restriction of the emergence of vancomycin-intermediately resistant S. aureus (VISA) to only one epidemic strain in Germany (5, 17), the identical clonal origin of the Japanese isolates Mu3 and Mu50 (23), and the close relationship of the American VISA isolates (36), as well as the fact that vancomycin resistance does not evolve in every strain subjected to vancomycin selection (22, 33), suggest the presence of factors in the chromosomal background of some strains that favor development of vancomycin resistance.

The mutation frequency of bacteria is essentially controlled by the DNA repair systems. The dam-directed mismatch repair system which is encoded by mutH, mutL, mutS, and uvrD in Escherichia coli (26) is one of the most important systems. It plays a central role in repairing base mismatch insertions and deletions which arise during replication, as well as in controlling uptake of foreign DNA (30). When mutS has been inactivated, the respective clone displays a high mutation frequency due to its inability to repair mismatches.

We hypothesized that an elevated mutation frequency as, for example, found in mutator strains could favor the development of vancomycin resistance in S. aureus and therefore subjected an S. aureus mutator strain defective in mutS to stepwise selection in the presence of increasing concentrations of vancomycin. The results reported here demonstrate that vancomycin resistance developed much faster in a mutator background than in the wild type; in addition, a fourfold-higher MIC could be reached for the mutator strain than for the wild-type control. Hereby, the importance of a high mutation frequency in the development of vancomycin resistance is confirmed.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Strains used in this study are listed in Table 1. S. aureus RN4220 (27) and Staphylococcus carnosus TM300 (38) were used as cloning hosts. Strains were kept as glycerol stock cultures. If not stated otherwise, the cells were incubated in 7 ml of brain heart infusion (BHI) at 37°C with continuous shaking (140 rpm) to an optical density of 1.0 at 600 nm (OD600). S. aureus RN4220ΔmutS and its vancomycin-resistant mutants were cultured in the presence of chloramphenicol unless indicated otherwise.

TABLE 1.

Description of S. aureus strains employed in this study

Strain Description Reference
NCTC8325 Control strain, partial deletion of rsbU
RN4220 Restriction-negative derivative of NCTC8325, parent strain of RN4220ΔmutS 27
RN4220ΔmutS mutS-knockout mutant of RN4220, mutator phenotype F. Schaaff, G. Bierbaum, N. Baumert, P. Bartmann, and H.-G. Sahl, submitted for publication
RN4220-V6 Mutant of RN4220, resistant to a vancomycin concentration of 6 μg/ml This study
RN4220-V10 Mutant of RN4220, resistant to a vancomycin concentration of 10 μg/ml This study
RN4220ΔmutS-VC10 Mutant of RN4220ΔmutS, resistant to a vancomycin concentration of 10 μg/ml This study
RN4220ΔmutS-VC20 Mutant of RN4220ΔmutS, resistant to a vancomycin concentration of 20 μg/ml This study
RN4220ΔmutS-VC30 Mutant of RN4220ΔmutS, resistant to a vancomycin concentration of 30 μg/ml This study
RN4220ΔmutS-VC40 Mutant of RN4220ΔmutS, resistant to a vancomycin concentration of 40 μg/ml This study

Molecular biology techniques.

The temperature-sensitive vector pTV0MCS, mediating chloramphenicol resistance, was constructed by insertion of the multiple cloning site of the vector pUC19 (28) into the PvuII site of the vector pTV0 (1). The erythromycin resistance-mediating E. coli-Staphylococcus shuttle vector pRB573 is a derivative of plasmid pRB373 (10), in which the pUB110 kanamycin resistance gene is replaced by an erythromycin cassette. Chromosomal DNA was purified by using Genomic Tips 500/G in accordance with the instructions of the manufacturer, plasmid DNA was purified by employing the QIAprep Miniprep kit, and PCR products for sequencing were purified with the help of the QIAquick PCR purification kit (all from Qiagen, Hilden, Germany). Protoplast transformation in S. carnosus was performed as described by Götz and Schumacher (20), and electroporation into S. aureus RN4220 was performed as described by Schenk and Laddaga (37).

Identification of mutS in S. aureus.

S. aureus mutS was identified by comparing MutS of Bacillus subtilis with the sequences available from two of the ongoing S. aureus sequencing projects (University of Oklahoma's Advanced Center for Genome Technology, Norman, and The Institute for Genomic Research, Rockville, Md.) by using Blast and FASTA software (2). Fragments encoding proteins with high homology to the N-terminal, C-terminal, and central parts of B. subtilis MutS were identified. Primers MutS-1 and MutS-4 (Table 2) were constructed encompassing the hypothetical 5′ and 3′ ends of S. aureus mutS. The complete DNA sequence was determined from strain S. aureus NCTC8325 by sequencing of the PCR product with primers MutS-1, MutS-2, MutS-3, MutS-4, and MutS-6 (Sequiserve, Vaterstetten, Germany) (Table 2).

TABLE 2.

Primers used in this study

Primer Gene Sequence, 5′-3′
MutS-1 mutS AGATGCTTCGTGATTATATGGT
MutS-2 mutS TCAAGATATTCATCTAATTGCG
MutS-3 mutS CAGTTAAAGATGGCGGACTA
MutS-4 mutS GCTAATGAGGTTTGGAGTTC
MutS-6 mutS GATGATTTTTTACCAGCAGACGC
MutS-8 mutS GAATTCATTATCTAATCGACAATTATTAGGCA
MutS-9 mutS TCTAGAAATCTATAGTGTGAATCAAACTGAAC
MutS-10 mutS CCTTGGAATTCAAGACTTCTTCATTAAACCGTTAATG
MutS-13 mutS ATGAGGATCCGAGTTCTTTAATTTTCCCCATTTTGC
pTV0MCSIns-1 PTV0MCS GATTTACATATGAGTTATGCAG

Construction and complementation of a mutS-knockout mutant.

Primers MutS-9 and -8 (Table 2) were constructed to encompass an internal 1,168-bp mutS fragment which was amplified in S. aureus NCTC8325. The EcoRI-XbaI fragment was cloned into the temperature-sensitive vector pTV0MCS and was transferred into S. carnosus TM300. The resulting recombinant plasmid, pTV0MCSmutS, was transferred into S. aureus RN4220 at 30°C. Selection of clones that had integrated the plasmid into the chromosome was performed by a temperature shift to 42°C in the presence of chloramphenicol. Integration of the plasmid pTV0MCSmutS into mutS was confirmed by PCR with the mutS-specific primer MutS-2 and the plasmid-specific primer pTV0MCSIns-1 (Fig. 1). Primers MutS-10 and MutS-13 (Table 2) were constructed to encompass the complete mutS gene as well as its putative ribosomal binding site and promoter and were used to amplify a 3,104-bp fragment of S. aureus NCTC8325. The EcoRI-BamHI fragment was ligated into the vector pRB573 and transferred into S. carnosus TM300. The recombinant plasmid pRB573mutS+ was consecutively transferred into S. aureus RN4220ΔmutS, producing strain RN4220ΔmutSmutS+.

FIG. 1.

FIG. 1.

Schematic drawing of the inactivation of mutS in S. aureus RN4220. An internal mutS fragment was cloned into the plasmid pTV0MCS, which mediates chloramphenicol resistance. The resulting recombinant plasmid, pTV0MCSmutS, was then integrated into the mutS gene by crossover.

Determination of the frequency of rifampin-resistant mutants.

For each strain two or three aliquots (100 μl) of a culture were plated onto Trypticase soy agar plates containing 100 mg of rifampin/liter. After 48 h of growth at 37°C, colonies were counted. Experiments were performed in triplicate for each strain, and mean values were calculated.

Isolation of vancomycin-resistant mutants.

For the selection of vancomycin-resistant mutants, the parent strains S. aureus RN4220 and RN4220ΔmutS were subjected to a stepwise selection in the presence of vancomycin (40). Strains were plated on agar plates which contained vancomycin at a higher concentration (1 μg/ml) than the MIC in BHI medium (0.5 μg/ml). Subclones that were able to grow on these plates were picked and subsequently cultured in BHI liquid medium containing the same drug concentration as present in the agar plate. Aliquots of this culture were again plated onto BHI agar with a vancomycin concentration that was 1 to 4 μg/ml higher than that of the liquid culture. This procedure was repeated until no further clones could be isolated that were able to grow on agar plates as well as in liquid culture containing higher vancomycin concentrations. To exclude the possibility that the selection of vancomycin-resistant mutants was affected by the presence of chloramphenicol in the medium of the mutator strain, the experiment was repeated with a slightly different setup. S. aureus RN4220 and RN4220ΔmutS as well as the reconstituted strain S. aureus RN4220ΔmutSmutS+ were subjected to a step selection procedure in the presence of vancomycin only for S. aureus RN4220 and RN4220ΔmutS and of vancomycin-erythromycin for RN4220ΔmutSmutS+. This experiment was possible since earlier attempts to remove the knockout mutation by growth in the absence of chloramphenicol, which allows excision of the plasmid by homologous recombination, had failed completely. Additionally, the chloramphenicol resistance of selected colonies was checked regularly by picking colonies on agar containing chloramphenicol. Besides, the step selection procedure was performed in liquid medium only and a sufficiently high inoculum (1 ml) was employed.

PFGE, phage typing, and antibiotic susceptibility testing.

Chromosomal DNA was purified and digested with SmaI as described previously (19). Pulsed-field gel electrophoresis (PFGE) was performed on the CHEF DRIII System (Bio-Rad Laboratories, Munich, Germany) employing 1% pulsed-field certified agarose (Bio-Rad), 6 V/cm, a field angle of 120°, and switch times of 5 to 15 s for 7 h and 15 to 60 s for a further 19 h. A chromosomal DNA digest of S. aureus NCTC8325 served as mass standard.

Phage typing was performed with the international set for phage typing at routine test dilution and 100× routine test dilution according to the standard rules agreed on by the International Union of Microbiological Societies Subcommittee on Phage Typing of Staphylococci.

Determinations of the MICs of vancomycin and teicoplanin were performed by microdilution in BHI medium and cation-adjusted MH broth with an inoculum concentration of 5 × 106 CFU/ml, and growth was read after 16, 24, and 72 h of incubation at 37°C. Antibiotic susceptibility testing for cefazolin, chloramphenicol, ciprofloxacin, erythromycin, fosfomycin, fusidic acid, gentamicin, imipenem, methicillin, netilmicin, oxacillin, penicillin, tetracycline, and vancomycin was performed by disk diffusion tests on MH agar plates. For population analysis, strains were grown to an OD600 of 1.0 in BHI. One hundred microliters of the culture and serial dilutions were plated onto BHI agar plates containing vancomycin in increasing concentrations. After 48 h of growth at 37°C, colonies were counted. The detection limit was 1 CFU/100 μl.

Time-to-regrowth assay.

For each strain 250 ml of BHI in a 500-ml culture flask was inoculated with 2.5 ml of an overnight culture. When the cultures had reached an OD600 of 0.4, vancomycin was added to a final concentration of 30 μg/ml for the strains S. aureus RN4220, RN4220-V6, and RN4220-V10 as well as for S. aureus RN4220ΔmutS and RN4220ΔmutS-VC10. For S. aureus RN4220ΔmutS-VC20, -VC30, and -VC40, final concentrations of 40, 50, and 60 μg/ml, respectively, were chosen. Samples were collected at various times and used for the determination of OD600 and the concentration of vancomycin in the supernatant. Additionally, an aliquot of 100 μl of each sample was serially diluted and plated onto Columbia agar in order to monitor viability of the cells.

For the vancomycin bioassay, a culture of Micrococcus luteus ATCC 4698 was grown to an OD600 of 0.3 and used to inoculate 1,000 ml of 0.6% Luria-Bertani agar at 45°C. Thin agar plates with seven wells per plate were prepared. Culture samples were centrifuged, and the supernatant was pasteurized at 80°C for 10 min. From each sample, three 50-μl aliquots were pipetted into the wells. As standards, 23 vancomycin concentrations ranging from 1 to 60 μg/ml in BHI were used. Additionally, one well per plate was filled with BHI containing 20 μg of vancomycin/ml in order to adjust for plate thickness. After overnight incubation at 37°C the diameters of the inhibition zones were read. The doubling time was calculated as the time needed for doubling the OD during the exponential growth phase.

Nucleotide sequence accession number.

The sequence of mutS has been submitted to the EMBL database (accession no. AJ296342).

RESULTS AND DISCUSSION

Construction of the mutator strain RN4220ΔmutS.

To construct a mutator strain, we disrupted mutS in S. aureus RN4220, a restriction-negative derivative of S. aureus NCTC8325, by a single-crossover event with a plasmid that carried an internal fragment of mutS (Fig. 1). To assess whether the mutS-knockout strain was characterized by a mutator phenotype, we had to obtain an estimation of its mutation frequency. Therefore, the rate at which the specific strain generated rifampin-resistant mutants was determined. Rifampin resistance arises from single point mutations in rpoB (3); however, it should be noted that silent mutations and mutations leading to low-level resistance cannot be detected by the method employed, and thus, the method underestimates rather than overestimates the mutation frequency of a given strain and identifies only strong mutator strains.

The mutS-knockout mutant S. aureus RN4220ΔmutS showed a 50-fold-higher frequency of spontaneous rifampin-resistant mutants than did the parent strain, S. aureus RN4220, which confirmed the expected mutator phenotype (50 versus 1 rifampin-resistant mutant per 109 plated bacteria, respectively). RN4220ΔmutS was complemented with pRB573mutS+, which carries an intact copy of mutS and its putative promoter sequence, resulting in strain RN4220ΔmutSmutS+. RN4220ΔmutSmutS+ formed rifampin-resistant mutants at a frequency comparable to that of strain RN4220 (1.3 rifampin-resistant mutants per 109 plated bacteria).

Isolation of vancomycin-resistant mutants.

We subjected S. aureus RN4220 and its isogenic mutS-knockout mutant RN4220ΔmutS to a stepwise vancomycin selection procedure. The MICs of vancomycin for both strains in BHI before the procedure were 0.5 μg/ml. The experiment was performed twice, and in the second experiment the reconstituted strain RN4220ΔmutSmutS+ was included and RN4220ΔmutS was grown in the absence of chloramphenicol in order to exclude any effects of the antibiotic on the selection. In both experiments the mutS-knockout mutant yielded clones that were able to grow on agar plates containing a maximum concentration of 40 μg of vancomycin/ml. However, this applied to only two of a total of three lineages. It must be kept in mind that mutation is a random process. If one of the mutations that occurs at low vancomycin concentrations is incompatible with resistance to high vancomycin concentrations, this could result in a premature ending of the development of resistance. As to the controls, five of six lineages originating from the wild-type S. aureus RN4220 and the reconstituted strain grew on agar plates containing a maximum of 10 μg of vancomycin/ml, and only one descendant of S. aureus RN4220 produced colonies that grew on 20 μg of vancomycin/ml. In addition, the number of passages needed to select a clone resistant to 10 μg of vancomycin/ml was lower with RN4220ΔmutS than with strain RN4220 or the reconstituted strain (a minimum of 5 versus 19 passages in the first experiment). During the selection process, intermediate step mutants of RN4220 and the mutS-knockout mutant were isolated for further characterization and were designated S. aureus RN4220-V6 and S. aureus RN4220-V10 as well as RN4220ΔmutS-VC10, -VC20, -VC30, and -VC40, corresponding to their growth on BHI agar containing 6, 10, 20, 30, and 40 μg of vancomycin/ml. The resistance levels of the strains were confirmed by microdilution in BHI and cation-adjusted MH broth and population analyses (Table 3). Figure 2 shows that the parent strains RN4220 and RN4220ΔmutS displayed the features of strains fully susceptible to vancomycin, indicating the absence of resistant subpopulations. In contrast, the vancomycin-resistant mutants were characterized by subpopulations that exhibited higher resistance to vancomycin than did the majority of the cells, which is typical for vancomycin resistance in S. aureus (23) and was especially pronounced in S. aureus RN4220-V10, which, since it was characterized by a MIC of 4 μg/ml in MH medium, represents a heterogenously resistant VISA strain. It has been recently shown that many clinical VISA isolates are agr negative. This applies also to S. aureus RN4220 (36) and could facilitate the acquisition of vancomycin resistance in this strain. In conclusion, these results underline the fact that the higher resistance achieved in the mutator strain RN4220ΔmutS is due to the inactivation of mutS and thus due to a higher mutation rate.

TABLE 3.

MICs of vancomycin and teicoplanin as well as doubling times of strain RN4220, the mutS-knockout mutant, and their vancomycin-resistant isolatesa

Strain Origin MIC (μg/ml)
Doubling time (min)
Vancomycin in:
Teicoplanin in MH medium
BHI MH medium
RN4220ΔmutS 0.5 1 0.5 35
RN4220ΔmutS-VC10 RN4220ΔmutS 16 8 8 44
RN4220ΔmutS-VC20 RN4220ΔmutS 32 16 8 62
RN4220ΔmutS-VC30 RN4220ΔmutS 32 16 8 90
RN4220ΔmutS-VC40 RN4220ΔmutS 64 32 (64) 8 (32) 120
RN4220 0.5 0.5 0.25 28
RN4220-V6 RN4220 8 2 8 33
RN4220-V10 RN4220 16 4 16 65
a

Growth was read after 18 to 24 h of incubation; however, the values in parentheses are for growth after 72 h of incubation for the slow-growing S. aureus RN4220ΔmutS-VC40.

FIG. 2.

FIG. 2.

Population analyses of the parent strains and the vancomycin-resistant mutants employed in this study. (A) Parent strain S. aureus RN4220 (•) and its descendants RN4220-V6 (○) and RN4220-V10 (▵). (B) Parent strain S. aureus RN4220ΔmutS (•); its vancomycin-intermediately resistant mutants RN4220ΔmutS-VC10 (○), -VC20 (▵), and -VC30 (□); and its vancomycin-resistant mutant RN4220ΔmutS-VC40 (⋄).

Growth behavior.

Growth properties of the strains varied significantly. In contrast to the parent strains, the vancomycin-resistant isolates RN4220ΔmutS-VC20, -VC30, and -VC40 and RN4220-V10 displayed slow growth in liquid culture medium, and the generation times increased with the level of vancomycin resistance (Table 3). On Columbia agar plates, alterations of the colony morphology could be observed. While the parent strains showed growth characteristics typical for S. aureus, an increasing number of small, white colonies without or with reduced beta-hemolysis was observed with S. aureus strains RN4220ΔmutS-VC20, -VC30, and -VC40. The size of the colonies was not stable; both colony types formed small and big colonies upon inoculation of a new agar plate. When exposed to high vancomycin concentrations in the time-to-regrowth assay, all strains displayed a decreased growth rate and an increase in small colonies on the control agar plates. The slow growth of S. aureus RN4220ΔmutS-VC20, -VC30, and -VC40 became even more marked: e.g., RN4220ΔmutS-VC20 had a generation time of 4 h, whereas RN4220ΔmutS-VC40 doubled within 9 h when growing exponentially.

Slow growth and small colony morphology have been reported elsewhere for clinical VISA isolates as well as for the earliest laboratory strains (7, 13, 31, 35, 41, 42), but it is not clear whether the small colony phenotype contributes to the vancomycin resistance. However, since Tenover et al. found for the Michigan VISA strain that the MICs of vancomycin were the same for the small and the normal colony types (45), the emergence of small colonies may just be an epiphenomenon accompanying the development of vancomycin resistance.

PFGE and phage typing.

The parent strains and their vancomycin-resistant descendants were subjected to PFGE and phage typing. While no changes in the PFGE profiles could be observed, the strains differed considerably concerning their phage pattern. Both parent strains were typeable by all or almost all phages employed; however, the number of positive reactions decreased concomitantly with the increase in vancomycin resistance, and the most resistant isolate, S. aureus RN4220ΔmutS-VC40, was nontypeable by any of the phages employed (Table 4).

TABLE 4.

Phage typing of S. aureus RN4220 and RN4220ΔmutS and their vancomycin-resistant mutants with the international phage seta

Strain Reaction with phage:
I
II
III
V
M
29 52 52A 79 80 3A 3C 55 71 6 42E 47 53 54 75 77 83A 84 85 94 96 81 95
RN4220 ++ C C C C C C C ++ ++ ++ C C C C ++ C − ++ ++ ++ C ++
RN4220-V6 ++ C C C ++ C C ++ 0 C C C C C C ++ ++ − − C ++ C C
RN4220-V10 − − − 0 − − − − − ++ ++ C − ++ C − − − − − − 0 −
RN4220ΔmutS ++ C C C C C C C +/− C C C C C C ++ C ++ C C ++ C ++
RN4220ΔmutS-VC10 − C C C ++ ++ 0 C 0 C C C C C C +/− ++ − − ++ ++ C C
RN4220ΔmutS-VC20 − − 0 0 − − − − − ++ C C ++ C C − − − − 0 0 C −
RN4220ΔmutS-VC30 − − 0 0 − − − − − ++ − ++ − − ++ − − − − − 0 − −
RN4220ΔmutS-VC40 − − − − − − − − − − − − − − − − − − − − − − −
a

A 100-fold routine test solution was employed. Phage reactions were graded on the following scale: confluent lysis (C), strong (++, >49 plaques), weak (+, 20 to 49 plaques), very weak (+/−, 1 to 19 plaques), no lysis reaction (−), and inhibition (0).

A complete loss of typeability in a vancomycin-resistant laboratory mutant also has been reported by Daum et al. (13) and is consistent with profound changes in the phage receptors or with preventing access to the receptor sites. Since the level of vancomycin resistance was inversely related to the number of positive phage reactions, this might be a direct clue to the resistance mechanism in these strains.

Antibiotic susceptibility testing.

All strains were subjected to antibiotic susceptibility testing by disk diffusion tests. The parent strains S. aureus RN4220 and RN4220ΔmutS were fully susceptible to all antibiotics tested. Except for vancomycin and teicoplanin, the resistant descendants of both strains retained their susceptibility to all antibiotics tested including oxacillin and methicillin. Most clinical VISA isolates and laboratory mutants described so far are methicillin resistant. Though vancomycin resistance is rather easily achieved in MRSA strains when they are subjected to high vancomycin concentrations (33), methicillin resistance is not a prerequisite to the development of vancomycin resistance in S. aureus (7, 13). Even though VISA strains have been described which remained teicoplanin susceptible despite their vancomycin resistance (group B glycopeptide-intermediate S. aureus strains according to the work of Boyle-Vavra et al. [9]), in most clinical VISA strains resistance to teicoplanin increased in parallel with vancomycin resistance (46), as was seen for our strains (MICs shown in Table 3). S. aureus NCTC8325 as well as its descendant RN4220 carries a partial deletion in rsbU and thus is unable to activate σB, which leads to a strongly decreased σB activity (18). Bischoff and Berger-Bächi found a positive correlation between a high σB activity, which is easily visible by the bright orange color of the colonies, and teicoplanin resistance in step selection mutants, whereas the effect of the elevated σB activity was marginal on vancomycin resistance (6). A higher resistance to teicoplanin, which was accompanied by the formation of brightly orange colonies, was also perceived in the second experiment (data not shown).

Time-to-regrowth assay.

It has been demonstrated elsewhere that vancomycin-resistant strains are characterized by their ability to quickly decrease the vancomycin concentration in liquid culture medium and to resume growth only when the concentration has dropped below 7 μg/ml (12, 40). In order to compare the isolates with other VISA strains, their ability to regrow in BHI medium containing high vancomycin concentrations was examined (12, 40). Therefore, concentrations were applied that were at least 20 μg/ml higher than those of the agar plates which had been employed for selection of the respective isolates. The parent strains as well as S. aureus RN4220-V6 were not able to resume growth under these conditions. Here, the OD600 dropped gradually to values of about 0.1, and no further growth was observed although the culture was continued for 7 to 10 days. The numbers of CFU were monitored for 96 h, and they dropped from 108 to 103 after 24 h, remained stable at this level for another 48 h, and decreased to 101 to 102 after 96 h.

All other vancomycin-resistant mutants were able to regrow at the chosen vancomycin concentrations (Fig. 3). The OD600 values of RN4220ΔmutS-VC30 oscillated between 1 and 2 over a period of 60 h, accompanied by oscillations in the vancomycin concentrations, and only then started to rise to >2.0 (data not shown). This phenomenon might be due to appearance and disappearance of variants, and thus the final strain may be different from the original strain. The other strains showed different growth patterns. After an initial duplication of the OD values, the OD600 remained stable or even decreased over 16 to 24 h before exponential growth was resumed (Fig. 3). Following an initial, immediate drop, the vancomycin concentrations fell continuously during this time, until values of 12 to 15 μg/ml were reached. Growth was resumed significantly earlier (8 h) and at the highest vancomycin concentration (22 μg/ml) by RN4220ΔmutS-VC40 (Fig. 3).

FIG. 3.

FIG. 3.

Time-to-regrowth assays for S. aureus strains RN4220-V10 (A), RN4220ΔmutS-VC10 (B), RN4220ΔmutS-VC20 (C), and RN4220ΔmutS-VC40 (D). The OD600 values (•) are depicted on an exponential scale, and the concentration of vancomycin in the supernatant (▴) is given linearly.

In the experimental setup of Cui et al. (12), all strains, including the vancomycin-susceptible S. aureus FDA209P, were able to regrow in the presence of 30 μg of vancomycin/ml after a maximum incubation of about 3 days, whereas the vancomycin-susceptible strains reported here as well as the intermediately resistant strain RN4220-V6 were not able to regrow under these conditions. Additionally, the most resistant strain, Mu50, started to regrow after 12 h when the vancomycin concentration had reached 5 to 7 μg/ml; less resistant strains resumed growth between 25 and 85 h of cultivation (12), and also the vancomycin-resistant mutant VM resumed growth only when the vancomycin concentration had been lowered to about 1 μg/ml (40). In contrast, our strains were able to regrow at significantly higher concentrations (12 to 22 μg/ml), and the vancomycin concentrations as well as the time at which the strains started to regrow were correlated to the level of resistance: strains with higher resistance resumed growth earlier and at higher vancomycin concentrations. As a control, we included S. aureus Mu50 in this experiment. In our setting, Mu50 resumed growth after 93 h at a vancomycin concentration of 5.4 μg/ml. The fact that the strains examined in this study, in particular strain RN4220ΔmutS-VC40, were able to regrow at vancomycin concentrations much higher than described before may indicate a new mechanism involved in vancomycin resistance in this strain.

When growth was resumed in the presence of vancomycin, the resistant strains RN4220ΔmutS-VC20, -VC30, and -VC40 formed clumps which persisted during the growth phase and dissolved only after several hours of stationary phase. Clumpy growth in the presence of vancomycin has been described previously (31), and the growth behavior could indicate a mechanism involved in the vancomycin resistance in these strains, such as accumulation of secreted cell wall material that traps free vancomycin as observed before (40). To examine whether the increase in OD originated from an increase in the viable count, the numbers of CFU were monitored for the first 96 h. In fact, with increasing OD600, an adequate rise in the number of CFU was observed, which implies that the increase in OD600 resulted from cell division rather than from accumulation of cell wall material (data not shown).

Elevated mutation frequency and development of vancomycin resistance.

So far, nothing is known about the role of mutator strains in S. aureus pathogenicity. However, it is conceivable that a defective mismatch repair system resulting in the rapid acquisition of adaptive mutations as well as alleviating the uptake of foreign DNA could be of major importance to the genotypic variety in S. aureus. One of the strongest mutator phenotypes is generated by a defective mismatch repair system, especially by inactivation of mutS, which is responsible for the repair of base mismatches and frameshift mutations generated during replication. Mutator strains defective in mismatch repair have been found previously to occur frequently among pathogenic bacteria such as enterohemolytic E. coli O157:H7 and Salmonella enterica serovar Typhimurium (29). While bacterial strains with an elevated mutation rate have a growth disadvantage when grown without selective pressure (16), the situation may be different under strong selective pressure, e.g., in the presence of antibiotics (34). Here, a high mutation rate resulting in the rapid acquisition of adaptive mutations may be of advantage, and the mutator alleles may be selected along with the favorable mutations (44). Mutator strains may thus be present at an elevated frequency in patients multiply treated with antibiotics and despite an intermediate virulence level of the mutator strains (34). In fact, in patients with cystic fibrosis, mutator strains account for 20% of the isolated Pseudomonas aeruginosa strains (32). Patients in intensive care units, who often are critically ill, are frequently treated with diverse antibiotics and, at the same time, are particularly prone to nosocomial infections with MRSA strains. Therefore, it seems conceivable that mutator clones are also present in MRSA isolates at a high frequency, and their disposition to generate vancomycin-resistant clones (33) might be due to an elevated mutation frequency. This hypothesis is underlined by the fact that recently the first clinical VISA isolate, the Japanese strain Mu50, has also been shown to be a mutator strain since it carries a frameshift in mutS (4).

In our experiments, vancomycin resistance evolved much faster in a mutator background than in the wild type (a few days versus several weeks). Moreover, the level of resistance that could be obtained was about four times higher than in the wild type, allowing growth in the presence of 40 μg of vancomycin/ml. The MICs for clinical VISA isolates were much lower (mainly 4 to 8 μg/ml) than those for the strains reported here. However, it should be noted that the clinical isolates are not exposed to such high vancomycin concentrations in vivo, due to the toxicity of vancomycin for the patient. However, in many clinical VISA isolates vancomycin resistance according to the definition of the NCCLS could be achieved when the strains were subjected to high vancomycin concentrations (13, 31, 40). In addition, the time needed for a VISA strain to emerge in a nonmutator background is longer than the time usually employed for vancomycin therapy, whereas VISA evolved in a mutator background within a few days.

It has been reported elsewhere that the vancomycin resistance level decreases when the strains are cultured in the absence of vancomycin (8, 47). The rapid reversion of the vancomycin resistance has been suggested previously to be due to stepwise mutations (8), a fact that is also consistent with the presence of an elevated mutation rate.

It was recently shown that a mutator phenotype favors the emergence of staphylococcal small colony variants (F. Schaaff, G. Bierbaum, N. Baumert, P. Bartmann, and H.-G. Sahl, submitted for publication). The facts presented here could indicate that strains from which small colony variants and VISA emerge may have one feature in common, i.e., an elevated mutation frequency, in particular since both occur mainly in patients undergoing multiple antibiotic treatment.

In conclusion, we are able to show that vancomycin resistance emerges much more quickly in a mutator than in a nonmutator background. Here, the duration of antibiotic treatment allows the development of vancomycin resistance in vivo. The vancomycin-resistant strains described here share some features of vancomycin resistance reported before, indicating that an elevated mutation frequency could be one of the factors in the chromosomal background of S. aureus that favor emergence of vancomycin resistance.

Acknowledgments

This work was supported by grant O-119.0003 from BONFOR to F.S. and by grants Bi 504/4-1 and Bi 504/4-2 from the Deutsche Forschungsgemeinschaft to G.B.

We thank Keiichi Hiramatsu for kindly providing strain Mu50, Reinhold Brückner for making pRB573 available, Armgard Viehbahn for expert technical assistance with phage typing, and Hans-Georg Sahl and Peter Bartmann for continuous support and helpful discussions.

REFERENCES

  • 1.Altena, K., A. Guder, C. Cramer, and G. Bierbaum. 2000. Biosynthesis of the lantibiotic mersacidin: organization of a type B lantibiotic gene cluster. Appl. Environ. Microbiol. 66:2565-2571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Aubry-Damon, H., C. J. Soussy, and P. Courvalin. 1998. Characterization of mutations in the rpoB gene that confer rifampin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 42:2590-2594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Avison, M. B., P. M. Bennett, R. A. Howe, and T. R. Walsh. 2002. Preliminary analysis of the genetic basis for vancomycin resistance in Staphylococcus aureus strain Mu50. J. Antimicrob. Chemother. 49:255-260. [DOI] [PubMed] [Google Scholar]
  • 5.Bierbaum, G., K. Fuchs, W. Lenz, C. Szekat, and H. G. Sahl. 1999. Presence of Staphylococcus aureus with reduced susceptibility to vancomycin in Germany. Eur. J. Clin. Microbiol. Infect. Dis. 18:691-696. [DOI] [PubMed] [Google Scholar]
  • 6.Bischoff, M., and B. Berger-Bächi. 2001. Teicoplanin stress-selected mutations increasing σB activity in Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1714-1720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bobin-Dubreux, S., M. E. Reverdy, C. Nervi, M. Rougier, A. Bolmstrom, F. Vandenesch, and J. Etienne. 2001. Clinical isolate of vancomycin-heterointermediate Staphylococcus aureus susceptible to methicillin and in vitro selection of a vancomycin-resistant derivative. Antimicrob. Agents Chemother. 45:349-352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Boyle-Vavra, S., S. K. Berke, J. C. Lee, and R. S. Daum. 2000. Reversion of the glycopeptide resistance phenotype in Staphylococcus aureus clinical isolates. Antimicrob. Agents Chemother. 44:272-277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Boyle-Vavra, S., H. Labischinski, C. C. Ebert, K. Ehlert, and R. S. Daum. 2001. A spectrum of changes occurs in peptidoglycan composition of glycopeptide-intermediate clinical Staphylococcus aureus isolates. Antimicrob. Agents Chemother. 45:280-287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Brückner, R. 1992. A series of shuttle vectors for Bacillus subtilis and Escherichia coli. Gene 122:187-192. [DOI] [PubMed] [Google Scholar]
  • 11.Centers for Disease Control and Prevention. 1997. Staphylococcus aureus with reduced susceptibility to vancomycin—United States, 1997. Morb. Mortal. Wkly. Rep. 46:765-766. [PubMed] [Google Scholar]
  • 12.Cui, L., H. Murakami, K. Kuwahara-Arai, H. Hanaki, and K. Hiramatsu. 2000. Contribution of a thickened cell wall and its glutamine nonamidated component to the vancomycin resistance expressed by Staphylococcus aureus Mu50. Antimicrob. Agents Chemother. 44:2276-2285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Daum, R. S., S. Gupta, R. Sabbagh, and W. M. Milewski. 1992. Characterization of Staphylococcus aureus isolates with decreased susceptibility to vancomycin and teicoplanin: isolation and purification of a constitutively produced protein associated with decreased susceptibility. J. Infect. Dis. 166:1066-1072. [DOI] [PubMed] [Google Scholar]
  • 14.dos Santos Soares, M. J., M. C. da Silva-Carvalho, B. T. Ferreira-Carvalho, and A. M. Figueiredo. 2000. Spread of methicillin-resistant Staphylococcus aureus belonging to the Brazilian epidemic clone in a general hospital and emergence of heterogenous resistance to glycopeptide antibiotics among these isolates. J. Hosp. Infect. 44:301-308. [PubMed] [Google Scholar]
  • 15.Ferraz, V., A. G. Duse, M. Kassel, A. D. Black, T. Ito, and K. Hiramatsu. 2000. Vancomycin-resistant Staphylococcus aureus occurs in South Africa. S. Afr. Med. J. 90:1113.. [PubMed] [Google Scholar]
  • 16.Funchain, P., A. Yeung, J. L. Stewart, R. Lin, M. M. Slupska, and J. H. Miller. 2000. The consequences of growth of a mutator strain of Escherichia coli as measured by loss of function among multiple gene targets and loss of fitness. Genetics 154:959-970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Geisel, R., F. J. Schmitz, L. Thomas, G. Berns, O. Zetsche, B. Ulrich, A. C. Fluit, H. Labischinsky, and W. Witte. 1999. Emergence of heterogeneous intermediate vancomycin resistance in Staphylococcus aureus isolates in the Dusseldorf area. J. Antimicrob. Chemother. 43:846-848. [DOI] [PubMed] [Google Scholar]
  • 18.Giachino, P., S. Engelmann, and M. Bischoff. 2001. σB activity depends on RsbU in Staphylococcus aureus. J. Bacteriol. 183:1843-1852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Goering, R. V., and T. D. Duensing. 1990. Rapid field inversion gel electrophoresis in combination with an rRNA gene probe in the epidemiological evaluation of staphylococci. J. Clin. Microbiol. 28:426-429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Götz, F., and B. Schumacher. 1987. Improvements of protoplast transformation in Staphylococcus carnosus. FEMS Microbiol. Lett. 40:285-288. [Google Scholar]
  • 21.Hanaki, H., K. Kuwahara-Arai, S. Boyle-Vavra, R. S. Daum, H. Labischinski, and K. Hiramatsu. 1998. Activated cell-wall synthesis is associated with vancomycin resistance in methicillin-resistant Staphylococcus aureus clinical strains Mu3 and Mu50. J. Antimicrob. Chemother. 42:199-209. [DOI] [PubMed] [Google Scholar]
  • 22.Hanaki, H., H. Labischinski, Y. Inaba, N. Kondo, H. Murakami, and K. Hiramatsu. 1998. Increase in glutamine-non-amidated muropeptides in the peptidoglycan of vancomycin-resistant Staphylococcus aureus strain Mu50. J. Antimicrob. Chemother. 42:315-320. [DOI] [PubMed] [Google Scholar]
  • 23.Hiramatsu, K. 1998. Vancomycin resistance in staphylococci. Drug Resist. Updates 1:135-150. [DOI] [PubMed] [Google Scholar]
  • 24.Hiramatsu, K., N. Aritaka, H. Hanaki, S. Kawasaki, Y. Hosoda, S. Hori, Y. Fukuchi, and I. Kobayashi. 1997. Dissemination in Japanese hospitals of strains of Staphylococcus aureus heterogeneously resistant to vancomycin. Lancet 350:1670-1673. [DOI] [PubMed] [Google Scholar]
  • 25.Hiramatsu, K., H. Hanaki, T. Ino, K. Yabuta, T. Oguri, and F. C. Tenover. 1997. Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J. Antimicrob. Chemother. 40:135-136. [DOI] [PubMed] [Google Scholar]
  • 26.Horst, J. P., T. H. Wu, and M. G. Marinus. 1999. Escherichia coli mutator genes. Trends Microbiol 7:29-36. [DOI] [PubMed] [Google Scholar]
  • 27.Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O'Reilly, P. M. Schlievert, M. S. Bergdoll, and R. P. Novick. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305:709-712. [DOI] [PubMed] [Google Scholar]
  • 28.Kuipers, O. P., M. M. Beerthuyzen, R. J. Siezen, and W. M. De Vos. 1993. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for development of immunity. Eur. J. Biochem. 216:281-291. [DOI] [PubMed] [Google Scholar]
  • 29.LeClerc, J. E., B. Li, W. L. Payne, and T. A. Cebula. 1996. High mutation frequencies among Escherichia coli and Salmonella pathogens. Science 274:1208-1211. [DOI] [PubMed] [Google Scholar]
  • 30.Modrich, P., and R. Lahue. 1996. Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65:101-133. [DOI] [PubMed] [Google Scholar]
  • 31.Moreira, B., S. Boyle-Vavra, B. L. deJonge, and R. S. Daum. 1997. Increased production of penicillin-binding protein 2, increased detection of other penicillin-binding proteins, and decreased coagulase activity associated with glycopeptide resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 41:1788-1793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Oliver, A., R. Canton, P. Campo, F. Baquero, and J. Blazquez. 2000. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 288:1251-1254. [DOI] [PubMed] [Google Scholar]
  • 33.Pfeltz, R. F., V. K. Singh, J. L. Schmidt, M. A. Batten, C. S. Baranyk, M. J. Nadakavukaren, R. K. Jayaswal, and B. J. Wilkinson. 2000. Characterization of passage-selected vancomycin-resistant Staphylococcus aureus strains of diverse parental backgrounds. Antimicrob. Agents Chemother. 44:294-303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Picard, B., P. Duriez, S. Gouriou, I. Matic, E. Denamur, and F. Taddei. 2001. Mutator natural Escherichia coli isolates have an unusual virulence phenotype. Infect. Immun. 69:9-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rotun, S. S., V. McMath, D. J. Schoonmaker, P. S. Maupin, F. C. Tenover, B. C. Hill, and D. M. Ackman. 1999. Staphylococcus aureus with reduced susceptibility to vancomycin isolated from a patient with fatal bacteremia. Emerg. Infect. Dis. 5:147-149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sakoulas, G., G. M. Eliopoulos, R. C. Moellering, Jr., C. Wennersten, L. Venkataraman, R. P. Novick, and H. S. Gold. 2002. Accessory gene regulator (agr) locus in geographically diverse Staphylococcus aureus isolates with reduced susceptibility to vancomycin. Antimicrob. Agents Chemother. 46:1492-1502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 73:133-138. [DOI] [PubMed] [Google Scholar]
  • 38.Schleifer, K. H., and U. Fischer. 1982. Description of a new species of the genus Staphylococcus: Staphylococcus carnosus. Int. J. Syst. Bacteriol. 32:153-156. [Google Scholar]
  • 39.Sieradzki, K., M. G. Pinho, and A. Tomasz. 1999. Inactivated pbp4 in highly glycopeptide-resistant laboratory mutants of Staphylococcus aureus. J. Biol. Chem. 274:18942-18946. [DOI] [PubMed] [Google Scholar]
  • 40.Sieradzki, K., and A. Tomasz. 1996. A highly vancomycin-resistant laboratory mutant of Staphylococcus aureus. FEMS Microbiol. Lett. 142:161-166. [DOI] [PubMed] [Google Scholar]
  • 41.Sieradzki, K., and A. Tomasz. 1997. Inhibition of cell wall turnover and autolysis by vancomycin in a highly vancomycin-resistant mutant of Staphylococcus aureus. J. Bacteriol. 179:2557-2566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Sieradzki, K., and A. Tomasz. 1999. Gradual alterations in cell wall structure and metabolism in vancomycin-resistant mutants of Staphylococcus aureus. J. Bacteriol. 181:7566-7570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Smith, T. L., M. L. Pearson, K. R. Wilcox, C. Cruz, M. V. Lancaster, B. Robinson-Dunn, F. C. Tenover, M. J. Zervos, J. D. Band, E. White, W. R. Jarvis, et al. 1999. Emergence of vancomycin resistance in Staphylococcus aureus. N. Engl. J. Med. 340:493-501. [DOI] [PubMed] [Google Scholar]
  • 44.Tenaillon, O., B. Toupance, H. Le Nagard, F. Taddei, and B. Godelle. 1999. Mutators, population size, adaptive landscape and the adaptation of asexual populations of bacteria. Genetics 152:485-493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tenover, F. C., J. W. Biddle, and M. V. Lancaster. 2001. Increasing resistance to vancomycin and other glycopeptides in Staphylococcus aureus. Emerg. Infect. Dis. 7:327-332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tenover, F. C., M. V. Lancaster, B. C. Hill, C. D. Steward, S. A. Stocker, G. A. Hancock, C. M. O'Hara, S. K. McAllister, N. C. Clark, and K. Hiramatsu. 1998. Characterization of staphylococci with reduced susceptibilities to vancomycin and other glycopeptides. J. Clin. Microbiol. 36:1020-1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Vaudaux, P., P. Francois, B. Berger-Bächi, and D. P. Lew. 2001. In vivo emergence of subpopulations expressing teicoplanin or vancomycin resistance phenotypes in a glycopeptide-susceptible, methicillin-resistant strain of Staphylococcus aureus. J. Antimicrob. Chemother. 47:163-170. [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES