Kenny mediates the recruitment of the phagophore for ubiquitin-dependent mitophagy in Drosophila neurons

Abstract

The maintenance of healthy mitochondria is essential to neuronal homeostasis. Mitophagy is a critical mechanism that degrades damaged mitochondria, and disruption of this process is associated with neurodegenerative disease. Previous work has shown that mammalian optineurin (OPTN), a gene mutated in familial forms of amyotrophic lateral sclerosis (ALS) and glaucoma, is an adaptor to recruit autophagy machinery to mitochondria for ubiquitin-dependent mitophagy in cultured cells. However, OPTN’s role in neuronal mitophagy in vivo remains largely unknown. Here, we demonstrate the Drosophila autophagy adaptor gene Kenny, a homolog of OPTN, mediates the recruitment of the phagophore to mitochondria undergoing ubiquitin-dependent mitophagy. We find that Kenny colocalizes with ubiquitinated mitochondria targeted for autophagic degradation in larval motoneurons, and is concentrated on the mitochondrial surface in areas opposed to the phagophore. Removal of Kenny in conditions of induced mitophagy eliminates the recruitment of the phagophore to ubiquitinated mitochondria and decreases mitophagic flux. In basal conditions, loss of Kenny causes accumulation of ubiquitinated mitochondria in neurons, indicative of stalled mitophagy. These phenotypes were reproduced in Kenny mutants ablating the LC3-interacting region domain. Overall, this work establishes Kenny as a functional homolog of OPTN in flies, and a mediator of neuronal mitophagy in vivo.

Introduction

Mitochondria are the essential organelles of energy production through oxidative phosphorylation (OxPhos) and central hubs of metabolic reactions that support cellular function (Monzel et al., 2023). However, reactive oxygen species (ROS), a natural byproduct of OxPhos (Muller, 2000; Guo et al., 2013), renders mitochondria prone to damage. This continuous deterioration, combined with the necessity to meet changing cellular energetic and metabolic demands, requires mitochondrial networks to dynamically undergo fission, fusion, biogenesis and degradation (Misgeld and Schwarz, 2017). Failure to degrade damaged mitochondria poses a threat due to excess ROS generated from the accumulation of these dysfunctional organelles (Onishi and Okamoto, 2021). Neurons are particularly sensitive to the build up of damaged mitochondria, as this is a pathological hallmark of numerous neurodegenerative diseases, including Parkinson’s Disease (PD), amyotrophic lateral sclerosis (ALS), Alzheimer's Disease (AD), Huntington’s Disease (HD) and ataxia (Pickrell and Youle, 2015; Misgeld and Schwarz, 2017; Doxaki and Palikaras, 2020; Sawant et al., 2021; Stanojlovic et al., 2022).

Mitophagy is a form of selective autophagy that degrades damaged mitochondria in the lysosome to neutralize the threat caused by their improper accumulation (Ganley and Simonsen, 2022; Uoselis et al., 2023). There is a strong association of mutations in genes involved in mitophagy with familial forms of neurodegenerative diseases (Menzies et al., 2015; Lou et al., 2020; Mani et al., 2021). This includes the PD-associated genes Pink1 (Valente et al., 2004) and Parkin (Lücking et al., 2000), which selectively detect and tag damaged mitochondria fated for degradation by ubiquitin (Ub)-dependent mitophagy (Narendra et al., 2008, 2010b; Jin and Youle, 2012). Downstream of the ubiquitination of mitochondrial proteins, mitophagy adaptor proteins facilitate the recruitment of a phagophore to damaged mitochondria for isolation in an autophagosome and eventual degradation in the lysosome (Yamano and Kojima, 2021). Recent work has identified the two putative mitophagy adaptor proteins in mammalian cells downstream of Pink1/Parkin activation as nuclear dot protein 52/calcium-binding and coiled-coil domain-containing protein 2 (NDP52/CALCOCO2) and optineurin (OPTN), which are functionally redundant in the context of cell lines in culture (Lazarou et al., 2015). Consistent with the importance of mitophagy for neuronal homeostasis, genetic mutations in OPTN are associated with familial forms of ALS (Maruyama and Kawakami, 2013; Toth and Atkin, 2018). Studies of OPTN-knockout mice found motor axon degeneration in aged Optn^−/− mice compared to controls (Ito et al., 2016), and Optn^−/− mice have pathological features consistent with autophagic dysfunction (Kurashige et al., 2021). However, despite the essential role of OPTN in in vitro mitophagy paradigms, an understanding of OPTN’s role in neuronal mitophagy in vivo is lacking. It is currently unclear whether disruption of OPTN-mediated mitophagy underlies the neurodegenerative phenotypes in patients and animal models.

Drosophila melanogaster is a useful model organism for investigating molecular and cellular mechanisms in an in vivo context due to the wealth of powerful genetic tools (Ugur et al., 2016). In the field of autophagy, flies have proven to be an effective tool for examining the cellular machinery mediating autophagy, and understanding their physiological relevance (Nagy et al., 2015; Bhattacharjee et al., 2019). With the expansive tools offered for studying autophagy, flies have naturally become an advantageous system for studying mitophagy. Transgenic flies have been developed that express fluorescent mitophagy reporters (Cornelissen et al., 2018; Lee et al., 2018; Kim et al., 2019), and recent research in flies has discovered novel molecular regulators of mitophagy (Anding et al., 2018; Mauri et al., 2023; Sanchez-Martinez et al., 2023; Martinez et al., 2024). Yet, the proteins that directly mediate the recruitment of the phagophore to mitochondria has not been fully elucidated in flies. Such proteins generally fall under two categories: mitophagy receptors which are outer-mitochondrial membrane (OMM) proteins containing an LC3-interacting region (LIR) domain to recruit a phagophore to mediate receptor-dependent mitophagy (Yamaguchi et al., 2016); and mitophagy adaptors, such as NDP52 and OPTN described above, which are soluble proteins that contain both an LC3-interacting region (LIR) domain and ubiquitin-binding domain to mediate ubiquitin-dependent mitophagy (Ganley and Simonsen, 2022). Recent work has identified Drosophila BNIP3 as a mitophagy receptor mediating developmentally-programed mitophagy in late larval midgut development (Wang et al., 2023). In contrast, mitophagy adaptor proteins mediating Ub-dependent mitophagy have not yet been identified in flies.

There are two potential adaptor proteins in flies. The first is the prototypic autophagy adaptor which is the homolog of mammalian sequestosome-1/ubiquitin-binding protein p62 (p62/SQSTM1), known as Ref(2)p, which is a soluble cytoplasmic protein containing both a LIR domain and ubiquitin-binding domain (Avila et al., 2002; Nezis et al., 2008). In mammalian cells, p62/SQSTM1 is not involved in the recruitment of the phagophore to mitochondria in classic paradigms inducing Pink1/Parkin-mediated mitophagy (Narendra et al., 2010a; Lazarou et al., 2015). However in flies, Ref(2)p functions downstream of Pink1 and Parkin to maintain a healthy pool of mitochondria (de Castro et al., 2013). Despite this result, it has not been directly shown that Ref(2)p mediates recruitment of the phagophore to mitochondria. While flies do not have a homolog of NDP52/CALCOCO2, the innate immune gene Kenny (Key) (Rutschmann et al., 2000) is a homolog of OPTN that functions as an adaptor to regulate the autophagic degradation of the Drosophila IKK-complex (Tusco et al., 2017). Kenny’s potential role in mitophagy has not been assessed.

Our previous work has provided an opportunity to interrogate these molecular regulators of mitophagy in flies. We found that knockdown of the ataxia-associated (Seong et al., 2018) gene Vps13D in fly neurons caused the accumulation of stalled mitophagy intermediates that initiate Ub-dependent mitophagy, but stall prior to degradation (Insolera et al., 2021). Because these mitochondria stalled in mitophagy are ubiquitinated and recruit a phagophore, this allowed us to investigate the molecular mechanisms governing these initial steps of mitophagy. Here we show that the recruitment of the phagophore to mitochondria fated for Ub-dependent mitophagy was surprisingly not mediated by Ref(2)p, but instead by Kenny. This study establishes Kenny as a functional homolog of OPTN in flies, playing an essential role as a mitophagy adaptor protein for Ub-dependent mitophagy.

Results

Ref(2)p and Kenny localize to polyubiquitinated mitochondria in conditions of stalled mitophagy

With the goal of investigating the proteins mediating the recruitment of the phagophore to mitochondria, we sought to examine the localization of our two candidate adaptor proteins, Ref(2)p and Kenny, to mitochondria fated for Ub-dependent mitophagy. In order to visualize this in tissue in vivo, we needed to inhibit the turnover of mitochondria by mitophagy that prevents visualization of intermediates in normal conditions. Common in vitro paradigms of toxin-induced mitophagy use a lysosomal inhibitor (such as bafilomycin A or chloroquine) to inhibit flux, resulting in trapped mitophagy intermediates prevented from degradation that can be used to visualize the mitochondria fated for mitophagy (Allen et al., 2013; Nguyen et al., 2016; Yamashita et al., 2016). In vivo, we utilized a mutant fly for the core autophagy gene Atg5 (Kim et al., 2016) to similarly inhibit autophagic flux and visualize the trapped mitochondria fated for degradation by autophagy in this mutant. Previous reports have demonstrated a relatively high rate of mitophagy in larval motoneurons (Lee et al., 2018; Sanchez-Martinez et al., 2023), and we have previously observed mitophagy intermediates in Atg5 mutant larval motoneurons in basal conditions (Insolera et al., 2021). We reasoned that mitochondria prevented from degradation by Ub-dependent mitophagy in these mutants will be decorated with ubiquitin (Ub+) and mitophagy adaptor proteins. Therefore, we expressed the mitochondrial marker mitoGFP (Pilling et al., 2006) in motoneurons of control and Atg5 mutant larvae, and immunostained for Ub and either Ref(2)p or Kenny. While we cannot observe Ub+ mitochondria (mitoGFP+/Ub+ staining) in control conditions, in Atg5 mutant larvae we observed that Ref(2)p and Kenny colocalize with Ub+ mitochondria (Figure 1A&B). We found that 70% of Ub+ mitochondria colocalize with Ref(2)p, and 85% co-localize with Kenny (n=5 larvae for each condition, with 15–30 individual Ub+ mitochondria per larval VNC). To visualize Ref(2)p and Kenny together (which was prevented due to antibody compatibility), we used CRISPR/Cas9 to generate a knock-in line introducing an hemagglutinin (HA)-tag to the C-terminus of the coding sequence of Kenny (Key^WT-HA) (S Fig 1). In Atg5 mutant larvae, we can observe Ref(2)p+/Kenny-HA+ mitochondria in larval motoneurons (Figure 1C). These results suggest that both Ref(2)p and Kenny localize to Ub+ mitochondria fated for ubiquitin-dependent mitophagy.

Figure 1: Ref(2)p and Kenny co-localize with Ub+ mitochondria in Atg5 mutant larval motoneurons.

Representative images of individual midline motoneuron cell bodies in the larval VNC in wildtype (WT) and Atg5 null mutant (Atg5^5cc5) animals. Each image represents a projection of 2-3 Z-planes. A,B) D42-Gal4 driven expression of UAS-mitoGFP (cyan), in tissue of indicated genotypes (left) stained for multi-ubiquitin (FK2, Ub, magenta), and Ref(2)p (A) or Kenny (B) (yellow). Arrowhead indicates an example of a Ub+ mitochondria that is labeled with Ref(2)p (A) or Kenny (B). C) Atg5 mutant larvae in the genetic background of endogenously tagged knock-in Key^WT-HA stained for HA (Kenny-HA, cyan), Ref(2)p (magenta) and mitochondrial protein ATP5A (yellow). Arrowhead indicates an example of a Kenny/Ref(2)p+ mitochondria. Scale bars=2μm.

To complement the results from the Atg5 mutant larvae, we examined the localization of Ref(2)p and Kenny in conditions of Vps13D knockdown, which we have previously observed results in the accumulation of enlarged, stalled mitophagy intermediates in larval motoneurons (Insolera et al., 2021). An added benefit of this condition is that it allows for better visualization of the localization of adaptor proteins on the mitochondria fated for Ub-dependent mitophagy, due to their morphological enlargement (Seong et al., 2018). Consistent with our previous results (Insolera et al., 2021), Ref(2)p strongly co-localizes with 76% of Ub+ mitochondria in larval motoneurons expressing Vps13D RNAi (Figure 2A) (n=5 larvae, with 15-30 individual Ub+ mitochondria per larval VNC), and uniformly decorates Ub+ mitochondria (see inset). Kenny co-localizes with 87% Ub+ mitochondria (Figure 2B) in these conditions (n=4 larvae, with 15-30 individual Ub+ mitochondria per larval VNC). Curiously, Kenny localization was often non-uniform in appearance around Ub+ mitochondria (see inset). Our previous work showed that in conditions of Vps13D loss, Ub+ mitochondria often contain incomplete phagophores (Insolera et al., 2021). Thus, we hypothesized that the asymmetric enrichment of Kenny may reflect the localization of the phagophore associated with enlarged mitophagy intermediates. Utilizing the Key^WT-HA knock-in flies (S Fig 1), we observe that endogenous Kenny localizes in direct opposition to Atg8A+ phagophores in conditions of Vps13D loss (Figure 2C). Therefore, while both Ref(2)p and Kenny localize to Ub+ mitochondria fated for Ub-dependent mitophagy, Kenny localizes tightly to the region containing a phagophore suggesting a more direct role in recruitment of autophagy machinery.

Figure 2: Ref(2)p and Kenny co-localize with enlarged Ub+ mitochondria in larval motoneurons lacking Vps13D.

Representative images of midline motoneuron cell bodies in the larval VNC which express UAS-luciferase RNAi (Control RNAi) versus UAS-Vps13D RNAi, via the D42-Gal4 driver. A,B) Tissue expressing indicated RNAi (left) was stained for Ref(2)p (A) or Kenny (B) (cyan), Ub (magenta), and mitochondrial marker ATP5A (yellow). Larger images show a group of midline motoneurons. Dashed box outlines a single Gal4-expressing neuronal cell body that is shown in high magnification in the inset in the bottom right corner, which is a projection of only 1-3 Z-planes containing the indicated Ub+ mitochondria. Arrowhead indicates an example(s) of a Ub+ mitochondria that is labeled with Ref(2)p (A) or Kenny (B). Notice the more uniform localization of Ref(2)p on Ub+ mitochondria in (A) versus the non-uniform localization of Kenny in (B). Scale bars=5, 2μm. C) Representative image of a single motoneuron cell body expressing Vps13D RNAi in the genetic background of endogenously tagged knock-in Key^WT-HA stained for HA (Kenny-HA, cyan), phagophore protein Atg8A (magenta) and mitochondrial protein ATP5A (yellow). Arrowhead indicates an example of a stalled mitophagy intermediate with a partial phagophore where kenny localizes to the site of the phagophore. Scale bars=2μm.

Loss of Kenny, but not Ref(2)p, disrupts the recruitment of the phagophore to polyubiquitinated mitochondria in conditions of Vps13D loss

To test the functional role of Ref(2)p and Kenny in recruiting a phagophore to Ub+ mitochondria, we genetically removed these proteins in conditions of Vps13D knockdown. Consistent with our previous results (Insolera et al., 2021), in larval motoneurons we observed that approximately 60% of Ub+ mitochondria in conditions of Vps13D knockdown recruit a phagophore, as visualized by staining for endogenous Atg8A (Figure 3A&C, top panels). To test the requirement of Ref(2)p for the recruitment of the phagophore, we utilized OD3 mutants of Ref(2)p (Ref(2)p^OD3) which have a truncated C-terminal ablating the ubiquitin-association (UBA) domain (de Castro et al., 2013) with a documented 99% reduction in protein expression (Wyers et al., 1995). Consistent with these previous results, with Vps13D knockdown, we could not detect Ref(2)p protein localizing to Ub+ mitochondria in Ref(2)p^OD3 homozygous mutants, or in trans heterozygous Ref(2)p mutants (Ref(2)p^OD3 over another mutant allele containing P-element within a coding intron [Ref(2)p^c03993, hereafter Ref(2)p^C]) (S Fig 2A). In Ref(2)p^OD3 mutants, we saw no reduction in the recruitment of phagophores to Ub+ mitochondria when Vps13D is knocked down (Figure 3A&B). This result suggests that Ref(2)p is not directly involved in the recruitment of the phagophore in Ub-dependent mitophagy.

Figure 3: Loss of Kenny, but not Ref(2)p, disrupts phagophore recruitment to Ub+ mitochondria.

Representative images of midline motoneuron cell bodies in the larval VNC which express UAS-Vps13D RNAi, via the D42-Gal4 driver. Larger images show a group of midline motoneurons. Dashed box outlines a single Gal4-expressing neuronal cell body that is shown in high magnification in the inset in the bottom right corner, which is a projection of only 1-3 Z-planes containing the indicated Ub+ mitochondria. A,C) Tissue of indicated genotypes (left) was stained for phagophore protein Atg8A (cyan), Ub (magenta), and mitochondrial protein ATP5A (yellow). (A) shows heterozygous and mutant larvae for Ref(2)p, and (C) shows heterozygous and mutant larvae for Kenny (Key). Closed arrowheads indicate example(s) of a Ub+ mitochondria containing a phagophore, whereas open arrowheads indicate examples of Ub+ mitochondria lacking a phagophore. Scale bars=5, 2μm. B,D) Quantification of the % of Mitophagy Intermediates (Ub+ mitochondria) with an associated phagophore (Atg8A staining), analyzed from data in (A) and (C), respectively. Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 15-30 individual Ub+ mitochondria per larval VNC). ns represents p value=0.8712, and **** represents p<0.0001 based on an unpaired, two-tailed T-test. E) Tissue of indicated genotypes (left) was stained for Ref(2)p (cyan), Ub (magenta), and mitochondrial marker ATP5A (yellow). Arrowheads indicate Ub+ mitochondria that are also positively stained for ref(2)p. Scale bars=10, 2μm. F) Comparison of the % of Ub+ mitochondria that co-localize with Ref(2)p in the indicated genotypes (bottom), analyzed from data in (E). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 10-30 individual Ub+ mitochondria per larval VNC). ns represents p value=0.7606 based on an unpaired, two-tailed T-test.

To test the potential role of Kenny, we performed a similar assessment. First, we confirmed the loss of Kenny protein associated with Ub+ mitochondria with Vps13D knockdown in a mutant allele containing a P-element within the coding region of the Kenny gene (known as Key^c02831, hereafter Key^C), and in a previously characterized mutant allele (Key¹) (Rutschmann et al., 2000) (S Fig 2B). In contrast to Ref(2)p mutants, the genetic loss of Kenny ablates the recruitment of the phagophore to Ub+ mitochondria (Figure 3C&D). When Vps13D is knocked down in Kenny mutant conditions, Ref(2)p recruitment to Ub+ mitochondria is not disrupted (Figure 3E&F), despite phagophore recruitment being ablated (Figure 3C&D). These results demonstrate that Kenny mediates the recruitment of the phagophore to Ub+ mitophagy intermediates when Vps13D is knocked down in larval motoneurons.

While our results thus far imply the direct involvement of Kenny in phagophore recruitment in Ub-dependent mitophagy in larval motoneurons, we also performed experiments in larval body wall muscles. Unlike in motoneurons, we could not detect Ub+ mitochondria in Atg5 mutants (data not shown), consistent with other reports showing low levels of basal mitophagy in larval muscles (Zirin et al., 2013; Lee et al., 2018). Therefore, we could not test the localization of Ref(2)p and Kenny to Ub+ mitochondria in these conditions in this tissue. Knockdown of Vps13D in all muscles using the Mef2-Gal4 was lethal, but we were able to examine the phenotype of Vps13D knockdown in body wall muscles by using the muscle 12-Gal4 (or M12-Gal4), which expresses in only one body wall muscle per hemisegment (muscle 12) (Ritzenthaler et al., 2000). Knockdown of Vps13D in larval muscle 12 resulted in severe enlargement of mitochondria, and the accumulation of Ub+ mitochondria (S Fig 3A), similar to the phenotype in larval motoneurons. Consistent with this, staining for endogenous protein demonstrates that Kenny localizes to Ub+ mitochondria in this condition (S Fig 3B). These results suggest that larval body wall muscles may utilize Kenny-mediated recruitment of the phagophore to Ub+ mitochondria.

Kenny mutant flies accumulate ubiquitinated mitochondria in neuronal cell bodies

In the absence of mitophagy adaptor protein, we reasoned that mitochondria fated for Ub-dependent mitophagy would be trapped prior to degradation, and distinct in that they would be decorated with Ub. Therefore, under basal conditions, we tested for the presence of Ub+ mitochondria in mutants of either Ref(2)p or Kenny. To better visualize mitochondria, we expressed the mitochondrial marker mitoGFP (Pilling et al., 2006) in motoneurons, and stained mutant tissue for Ub. In Ref(2)p^C/OD3 transheterozygous mutants, we did not observe any increase in the frequency of larval motor neuron cell bodies containing at least one Ub+ mitochondria compared to control conditions, which was a low frequency occurrence (~2-3% of neurons) (Fig 4A&B). On the contrary, Key^1/C transheterozygous mutant larvae contained Ub+ mitochondria in 26% of neuronal cell bodies (Fig 4C&D). These results suggest that the loss of Kenny, and not Ref(2)p, results in the presence of Ub+ mitochondria in motoneuron cell bodies, which is likely due to stalling of Ub-dependent mitophagy in these basal conditions.

Figure 4: Kenny, but not Ref(2)p, mutant neurons contain Ub+ mitochondria.

Representative images of individual midline motoneuron cell bodies in the larval VNC expressing mitoGFP (cyan) via the D42-Gal4 in heterozygous and mutant animals stained for Ub (magenta). Each image represents a projection of 2-3 Z-planes. A,C) Tissue from heterozygous and mutant larvae for Ref(2)p in (A) and heterozygous and mutant larvae for Kenny (Key) in (C). Arrowheads indicate a Ub+ mitochondria. Scale bar=2μm. B,C) Quantification of the % of midline motoneurons that contain at least 1 Ub+ mitochondria from indicated genotypes (bottom), analyzed from data in (A) and (C), respectively. Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 35-50 neurons per larval VNC). ns represents p value=0.0517, and **** represents p<0.0001 based on an unpaired, two-tailed T-test.

The function of Kenny in flies is well-understood for its role as a regulator in the Immune Deficiency (IMD) pathway (Ertürk-Hasdemir et al., 2009); therefore, Key mutant flies will be immunocompromised (Rutschmann et al., 2000). To rule out the possibility that stunted IMD-signaling underlies the observed mitophagy defects, we knocked down Kenny specifically in motoneurons with RNAi, therefore keeping IMD-dependent signaling intact in immune organs of the flies, such as fat bodies and circulating lymph cells. Ubiquitous expression of Kenny RNAi with a strong Gal4-line (Act5C-Gal4) caused a 46% reduction in Kenny mRNA (S Fig 4A). Cell autonomous neuronal knockdown (via nSyb-Gal4) of Kenny resulted in 72% of cell bodies containing Ub+ mitochondria, compared to only 7% of cell bodies expressing a control RNAi (S Fig 4B&C). Interestingly, the accumulation of mitophagy intermediates caused by RNAi-mediated knockdown appears more severe than in mutant animals (Figure 4 C&D), for unknown reasons. Nevertheless, these results suggest that cell autonomous loss of Kenny in larval neurons causes the accumulation of stalled Ub+ mitochondria.

If Kenny is mediating the recruitment of the phagophore to mitochondria, we reasoned that mutating essential adaptor domains will disrupt this function. Previous work has identified the LIR domain of Kenny mediating its adaptor function through its interaction with Atg8A in flies (Tusco et al., 2017). We therefore generated a knock-in mutant of Kenny ablating the LIR domain which was also tagged with HA (Key^LIRm-HA) (S Fig 1A&B). We bred flies with this allele (or Key^WT-HA) in trans with null mutant alleles (Key^C), and expressed Vps13D RNAi in motoneurons to visualize the recruitment of phagophores. In both Key^WT-HA and Key^LIRm-HA conditions, endogenously tagged Kenny-HA protein is recruited to a subset of mitochondria, presumably Ub+ mitochondria based on our previous results. In a Key^LIRm-HA mutant background, there is a significant reduction in the recruitment of phagophores to Ub+ mitochondria, compared to Key^WT-HA conditions which had phagophores on 64% of Ub+ mitochondria (Fig 5A&B). Although 28% of Ub+ mitochondria contain some staining for Atg8A in the Key^LIRm-HA mutant conditions, staining was typically small, diffuse puncta (open arrowheads in inset) compared to the bright crescent-shaped phagophores associated with Ub+ mitochondria in Key^WT-HA conditions (closed arrowheads in insets). These results suggest that the LIR domain of Kenny is required to recruit a phagophore to Ub+ mitochondria in conditions of Vps13D loss.

Figure 5: Knock-in LIR domain Kenny mutants disrupt phagophore recruitment to Ub+ mitochondria.

Representative images of midline motoneuron cell bodies in the larval VNC. A) Larval neurons expressing Vps13D RNAi in a genetic background of Key^WT-HA (top panel) or Key^LIRm-HA (bottom) alleles over a Kenny mutant allele (Key^c). Tissue was stained for HA (Kenny-HA, cyan), phagophore protein Atg8A (magenta) and mitochondrial protein ATP5A (yellow). Larger images show a group of midline motoneurons. Dashed box outlines a single Gal4-expressing neuronal cell body that is shown in high magnification in the inset in the bottom right corner, which is a projection of only 1-3 Z-planes containing the indicated Ub+ mitochondria. All arrows/arrowheads indicate examples of Kenny-HA+ mitochondria: closed arrowheads contain bright phagophores, open arrowheads contain weak Atg8A staining or small puncta, and arrows lack phagophores. Scale bars=5, 2μm. B) Quantification of the % of mitophagy intermediate (Kenny-HA+/ATP5A+ structures) that contain an associated phagophore (Atg8A staining) for the indicated genotypes (below) from data analyzed in (A). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 40-90 individual kenny-HA+ mitochondria per larval VNC). *** represents p=0.0005 based on an unpaired, two-tailed T-test. C) Representative images of individual midline motoneuron cell bodies in the larval VNC expressing mitoGFP (cyan) via the D42-Gal4 in indicated genotypes (left) stained for Ub (magenta) and HA (Kenny-HA, yellow). Each image represents a projection of 2-4 Z-planes. Arrowheads indicate examples of Ub+ mitochondria (Ub+/ATP5A+) that co-localize with Kenny-HA staining. Scale bar=2μm. D) Quantification of the % of midline motoneurons that contain at least 1 Ub+ mitochondria from indicated genotypes (bottom), analyzed from data in (C). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 30-60 neurons per larval VNC). *** represents p=0.0002 based on an unpaired, two-tailed T- test.

We next assessed whether we can observe Ub+ mitochondria in motoneuron cell bodies in Key^LIRm-HA transheterozygous mutant neurons in basal conditions, as we previously observed in Kenny null mutants. We observed 50% of neuronal cell bodies in Key^LIRm-HA mutants that contained a Ub+ mitochondria, compared to only 8% in the control Key^LIRm-HA/+ condition (Fig 5C&D). These Ub+ mitochondria co-localized with HA-staining, indicating that mutant Kenny protein was recruited to the Ub+ mitochondria. But in the absence of the LIR domain, the phagophore was not recruited, and therefore, the mitochondria fated for Ub-dependent mitophagy were prevented from being properly degraded.

To determine the effect of Kenny loss on overall mitophagic flux, we expressed the fluorescent mitophagy reporter matrix-QC in larval motoneurons of Kenny mutants (Long et al., 2022). This dual fluorescent reporter, localized to the mitochondrial matrix, reads out mitophagic flux through the quenching of EGFP and persistence of mCherry when mitochondria are delivered to lysosomes. Flux is observed as a fluorescent signal that is only mCherry+ and termed “mitolysosomes” (Sanchez-Martinez et al., 2024). Prior studies using this reporter in larval motoneurons have observed on average ~5-10 mitolysosomes per neuron in control conditions (Long et al., 2022; Sanchez-Martinez et al., 2023). However, in our experiments, we consistently observed that only a low percentage of larval motoneurons contain observable mitolysosomes (S Fig 5A&B, arrowheads). In Kenny heterozygous (Key^C/+) larvae, 7.6% of neurons contained at least one detectable mitolysosome, compared to 15.8% of neurons in Kenny mutant neurons. While the average surprisingly suggests higher mitophagic flux in Kenny mutants, this result was not statistically significant when comparing numbers from 6 larvae in each condition (S Fig 5 B). We observed that among the neurons containing at least one mitolysosome, most contained only a single mitolysosome (83%, combined from both conditions). In comparing only the neurons that contained at least one mitolysosome, there was no difference in the number of mitolysosomes between Kenny heterozygous and mutant larvae (S Fig 5 C). Overall, these results suggest that Kenny-mediated mitophagy does not significantly contribute to the overall mitophagy flux in neurons in basal conditions, at least not to a high enough degree to be visualized with the matrix-QC reporter.

Complete loss of Kenny reduces the lifespan of flies, but loss of Kenny-mediated mitophagy does not alter survival

To assess the organismal consequences of disrupting Kenny-dependent mitophagy, we assessed the lifespan of Kenny mutant flies. We reasoned that age-dependent accumulation of damaged mitochondria may compromise lifespan. We observed that transheterozygous Key^C/null mutant flies had significantly reduced lifespan in comparison to Key^C/Key^WT-HA heterozygous flies (Figure 6A). This heterozygous fly contains the CRISPR-modified, epitope tagged WT allele (S Fig 1A) to properly control for the genetic modification and tag. However, interpretation of enhanced lethality of Kenny mutants is complicated because these mutant flies are immunocompromised by the essential role of Kenny in IMD signaling (Rutschmann et al., 2000). Hence, this lifespan defect is likely the result of the combination of a mitophagy defect and immunosuppression. Therefore, we tested whether our knock-in LIR domain mutants can uncouple these two functions of Kenny, and isolate a mitophagy-specific defect.

Figure 6: Kenny loss of function mutants have compromised longevity, but LIR mutants with specific disruption in mitophagy adaptor function do not.

A) Lifespan curve of adult male flies of the indicated genotypes (top). The total number of flies assessed is indicated in the key. ***p < 0.001 based on a Log-Rank (Mantel-Cox) test. B) qPCR assessment of transcript levels of AttC (left) and DptA (right) in WT conditions with fat body driven (cgGal4) expression of control (UAS-EGFP) or UAS-IMD-CA transgenes. Bars represent the mean ± SEM, with individual grey dots representing the average fold change of expression in individual samples (n=3 samples of 5 whole larvae). ** represents p=0.0069 (AttC) and 0.0088 (DptA) based on an unpaired, two tailed T-test. C) qPCR assessment of transcript levels of AttC (left) and DptA (right) in three genetic conditions indicated below the graphs with fat body driven (cgGal4) expression of UAS-IMD-CA. All Fold Change values were normalized to the control condition (Key^C/Key^WT-HA). Bars represent the mean ± SEM, with individual grey dots representing the average fold change of expression in individual samples (n=5 samples containing 5 whole larvae). ns represents p=0.9869 (AttC) & 0.666 (DptA) and in AttC graph ** represents p=0.0042 (left) and p=0.0055 (right), in DptA graph *** represents 0.0004 (left) and ** represents p=0.0018 (right) based on a one-way ANOVA with Tukey’s multiple comparison test. D) Lifespan curve of adult male flies with pan-neuronal expression (via nSybGal4) of UAS-luciferase RNAi (Control RNAi) versus UAS-Kenny RNAi. The total number of flies assessed is indicated in the key. ***p < 0.001 based on a Log-Rank (Mantel-Cox) test. E) Lifespan curve of 7 day old adult male flies fed 10mM PQ. The genotypes of the flies tested and the total number of flies assessed are indicated in the key. ****p < 0.001 based on a Log-Rank (Mantel-Cox) test.

Upstream of Kenny in the IMD pathway is cleavage and activation of the IMD protein (Aalto et al., 2023). Expression of the cleaved IMD protein acts as a “constitutively-active” form of IMD (IMD-CA), and robustly activates IMD signaling (Petkau et al., 2017; Davoodi et al., 2019). We found that expression of IMD-CA in larval fat bodies (via cgGal4) results in a strong increase in expression of IMD-dependent antimicrobial peptides (AMPs) Attacin C (AttC) and Diptericin A (DptA) in whole larval RNA samples (Figure 6B), consistent with previous studies (Davoodi et al., 2019). When we expressed this transgene in the fat body of Key^C/Key^WT-HA heterozygous flies, we similarly observed AttC and DptA upregulation, which was severely blunted in a Kenny loss of function condition (Figure 6C). In contrast, Kenny LIR domain mutants (Key^C/LIRm) did not disrupt AMP upregulation caused by expression of IMD-CA in the fat body, suggesting that this mutant is competent in IMD-related signaling.

When we assessed the lifespan of Kenny LIR domain mutant flies, we found that their lifespan was not significantly different from Key^C/Key^WT-HA conditions, and significantly enhanced compared to the Key^C/Key^null null mutants (Figure 6A). These results suggest that the specific ablation of Kenny function as a mitophagy adaptor does not disrupt the overall lifespan of flies, and that the compromised IMD signaling in Kenny null mutants is likely the cause of reduced lifespan. Consistent with this, we found that neuron-specific knockdown of Kenny (via the nSybGal4) did not shorten the lifespan of flies, but surprisingly, enhanced survival (Figure 6D). We suspect this may be due to immune signaling, as blunted IMD signaling in neurons has previously shown to enhance survival of flies (Kounatidis et al., 2017). These results suggest that the loss of Kenny-dependent mitophagy in basal conditions does not significantly disrupt physiology to an extent that reduces overall survival.

We next tested if Kenny mutant flies were sensitive to mitochondrial stress that would increase the demand for degrading damaged mitochondria through mitophagy. It is thought that elevated reactive oxygen species (ROS) are a trigger for Ub-mediated mitophagy (Xiao et al., 2017); therefore, we fed flies the ROS-generating toxin paraquat (PQ), which has previously been shown to cause enhanced lethality in flies mutant for the mitophagy mediators Pink1 and Parkin (Clark et al., 2006; Malik et al., 2015). Flies heterozygous for Kenny, Key^C/Key^WT-HA, survive a median of 6 days when fed 10 mM PQ, compared to a significant reduction of lifespan to a median of 3 days in the Key^C/Key^null null mutants (Figure 6E). While the null Kenny mutants are compromised in both IMD signaling and mitophagy, the feeding of PQ represents an insult that will cause particular vulnerability to the compromised mitophagy function. Additionally, prior studies have indicated that blunted IMD signaling enhances survival in conditions of PQ feeding (Maitra et al., 2019), which is the opposite of what we observed in Kenny mutants. Therefore, these results suggest that the lack of Kenny-dependent mitophagy sensitizes flies to the mitochondria stress of elevated ROS. However, we find that the survival of PQ fed Key^C/Key^LIRm-HA mutant flies is no different from Key^C/Key^WT-HA heterozygotes, suggesting that Key^LIRm-HA mutants are more resilient to the elevated ROS from PQ compared to the null mutants (Figure 6E). This result suggests that Key^LIRm-HA mutants have some currently unknown functionality in the non-LIR domain regions important for protection from mitochondrial stress. Understanding this, in comparison to the null mutants lacking Kenny altogether, requires additional experiments in the future.

Kenny mediates Ub-dependent mitophagy in conditions of compromised mitochondrial fission

We have previously observed that disrupting mitochondrial fission by knockdown of essential fission mediator Drp1 induces Ub-dependent mitophagy in Drosophila neurons (Insolera et al., 2021), which has additionally been shown in HeLa cells (Burman et al., 2017) and primary cultured mammalian neurons (Li et al., 2021). We hypothesized that Kenny mediates the induced Ub-dependent mitophagy downstream of Drp1 knockdown. To test this, we knocked down Drp1 in Kenny mutants, and stained larval neurons for Ref(2)p and the endogenous mitochondrial marker ATP5A to visualize mitophagy intermediates. Our prior results demonstrated that Ref(2)p is recruited to ~85% of Ub+ mitochondria regardless of the presence of Kenny (Figure 3E&F), making this a valid marker for mitophagy intermediates in this scenario. Neuronal cell bodies were visualized with staining for the neuronal transcription factor Elav. In conditions of Drp1 knockdown in Kenny heterozygous larva, enlarged Ref(2)p+ mitochondria were observed in a 3.5% of motor neuron cell bodies (Figure 7A&B), consistent with our previous results (Insolera et al., 2021). However, in the absence of Kenny, Drp1 knockdown caused a significant increase in Ref(2)p+ mitochondria that were observable in 58.8% of motoneuron cell bodies. Drp1 knockdown induced enlarged Ref(2)p+ mitochondria that are similarly present as in heterozygous and mutant conditions (Figure 7A, inset #1 & 2); however, in the Kenny mutant condition, there is a substantial increase in smaller Ref(2)p+ puncta, many of which were positive for ATP5A (Figure 7A, inset #3). This implies that smaller pieces of mitochondria with Drp1 knockdown that are typically degraded by Ub-dependent mitophagy are trapped in Kenny mutants, which is similar to what was previously observed with Drp1 knockdown in a mutant for the core autophagy gene Atg5 (Insolera et al., 2021).

Figure 7: Neuronal Drp1 knockdown in kenny mutants causes the accumulation of mitophagy intermediates.

A) Representative images of midline motoneuron cell bodies in the larval VNC which express UAS-Drp1 RNAi, via the D42-Gal4 driver. Top panel is from kenny heterozygous larvae (Key^C/+), and bottom panel is from kenny mutant larvae (Key^C/C). Tissue was stained for neuronal transcription factor Elav (cyan), Ref(2)p (magenta), and mitochondrial protein ATP5A (yellow). Larger images show a group of midline motoneurons. Numbered dashed boxes outline a single Gal4-expressing neuronal cell body that is shown in high magnification below, which is a projection of only 2-5 Z-planes containing the indicated Ref(2)p+ mitochondria. Box #1&2 indicates examples of enlarged Ref(2)p+ mitochondria present in both conditions. Box #3 indicates examples of smaller Ref(2)p+ mitochondria only present in Key^C/C condition. Scale bars=5, 2μm. B) Quantification of the % of midline motoneurons that contain at least 1 Ref(2)p+ mitochondria from indicated genotypes (bottom), analyzed from data in (A). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 50-65 neurons per larval VNC). **** represents p<0.0001 based on an unpaired, two-tailed T-test. C) Representative images of midline motoneuron cell bodies in the larval VNC which express Drp1 RNAi and UAS-matrix-QC, via the D42-Gal4 driver. Genotypes are indicated on the left. GFP alone signal (cyan) and mCherry (RFP) signal alone (magenta) are shown in separate panels in greyscale, and the merged picture appears greyscale due to the near perfect overlap of the cyan and magenta channels. Arrowheads indicate examples of “mitolysosomes” which are RFP-only puncta. Scale bar=5μm D) High magnification image of the cell body indicated by the dashed box in (C) in Kenny heterozygous conditions with Drp1 knockdown. Arrowheads represent mitolysosomes. Scale bar=2μm E) Quantification of the % of midline motoneurons that contain at least 1 mitolysosome from tissue expressing matrix-QC and Drp1 RNAi from the indicated genotypes (bottom), analyzed from images represented in (C). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=10 larvae for each condition, with 35-55 neurons per larval VNC). **** represents an adjusted p-value of <0.0001, ** represents an adjusted p-value of 0.0012, and * represents an adjusted p-value of 0.03 based on a one-way ANOVA with Tukey’s multiple comparisons test.

We next determined if enhanced mitophagic flux in motoneurons lacking Drp1 was Kenny-dependent, through the analysis of mitolysosomes in neurons expressing matrix-QC. In contrast to basal conditions when mitolysosomes were rare (in 7.6% of neurons), in neurons lacking Drp1, mitolysosomes were observed in 61.8% of neurons (Figure 7C–E) indicating elevated levels of mitophagy. Consistent with the characteristics of the Ref(2)p+ mitochondria in Kenny mutant animals (Figure 7A, inset #3), mitolysosomes in neurons lacking Drp1 are present as numerous, small red-only puncta (Figure 7D). When we knockdown Drp1 in Kenny null mutant animals, mitophagic flux is significantly reduced such that only 21.1% of neurons contain mitolysosomes. We additionally tested mitophagic flux in Kenny LIR domain mutants and found a decrease in the number of neurons containing mitolysosomes to 37.5%, which was significantly reduced from the heterozygote condition, but not as complete as the null mutant (Figure 7C&E). This result suggests that Kenny LIRm mutants are not fully compromised in mitophagy function, and can promote limited flux. Overall, these results demonstrate that the completion of mitophagy caused by Drp1 knockdown is dependent on Kenny functioning as a mitophagy adaptor.

We next examined the physiological consequences of compromised Kenny-mediated mitophagy in flies with neuronal Drp1 knockdown. Flies with pan-neuronal Drp1 knockdown die shortly after emerging as adults, typically within 1 day, but survive pupal stages and eclose as adults at a relatively high success rate. We had previously found that disrupting autophagy through knockdown of core autophagy gene Atg5 in combination with Drp1 knockdown significantly reduced eclosion rates (Insolera et al., 2021). We therefore used pupal lethality, or a failure to eclose, to assess the lethality caused by Drp1 knockdown in Kenny mutant backgrounds. In a Key^C/+ background, pupae with pan-neuronal knockdown of Drp1 successfully eclosed 96% of the time. In Key^C/C mutants, successful eclosion dropped significantly to 86%. However, this reduction in successful eclosion does not appear to be a consequence of the knockdown of Drp1 since expression of control RNAi in Kenny mutants reduced successful eclosion to a similar degree (88%). Therefore, the total loss of Kenny appears to be the driving force for lower eclosion rates, and the pupae expressing Drp1 versus control RNAi in neurons are not more sensitive to lethality than that caused by Drp1 knockdown (S Fig 6A). This suggests that the increased number of larval neurons containing Ub+ mitochondria in Kenny mutants lacking Drp1 did not significantly disrupt survival in the pupal stages.

We additionally tested the sensitivity of Key^LIRm-HA mutants to neuronal knockdown of Drp1, and found that these mutants were slightly more sensitive to pupal lethality. While expression of control RNAi in the genetic background of Key^C/Key^LIRm-HA did not reduce successful eclosion rates (99%), expression of Drp1 RNAi in this genetic background, slightly but significantly reduced eclosion rates to 90%. This was significantly lower than the 96% eclosion rate of Drp1 knockdown in the Key^C/+ condition (S Fig 6A). While these data demonstrate a slight reduction in survival in conditions of compromised mitophagy adaptor function, it has much less of an effect than what we had previously observed with the combined knockdown of core autophagy protein Atg5 and Drp1 (Insolera et al., 2021) for currently unknown reasons. Overall these results suggest that Kenny-mediated mitophagy is activated in conditions of neuronal Drp1 knockdown, and Kenny mutants lacking mitophagy adaptor function are slightly less capable of surviving this stress.

Finally, we tested the longevity of flies with adult-onset knockdown of Drp1 and Kenny, hypothesizing that the accumulation of Ub+ mitochondria may have a stronger effect on adult neurons that survive the duration of the fly’s life. We utilized the pan-neuronal GeneSwitch (GS) genetic tool elavGS (Osterwalder et al., 2001), in which flies were fed the inducing drug RU486 after eclosion to induce expression of RNAi in adulthood. Knockdown of Kenny (plus control RNAi, to balance transgenes) alone in adult neurons did not significantly reduce lifespan compared to control conditions (2x Control RNAi expression), with median survival times of 57 days for Kenny knockdown and 58.5 days for Control knockdown (S Fig 6B). Adult onset expression of Drp1 RNAi (plus control RNAi) resulted in a significant reduction in lifespan, with a median survival of 46 days. When we combined the knockdown of Drp1 and Kenny, the median lifespan was 50 days. This was significantly worse than Kenny knockdown alone, but was significantly better than flies with Drp1 knockdown alone suggesting that the reduction of Kenny in neurons gives a slight survival advantage in conditions of Drp1 knockdown (S Fig 6B). This is consistent with the survival advantage conferred by the reduction of Kenny in neurons throughout the entire lifecycle (Figure 6D), and may be due to reduced IMD signaling in adult neurons which has been previously shown to result in a survival advantage (Kounatidis et al., 2017). This lifespan data, combined with our data for pupal survival (S Fig 6A), implies that fly neurons appear to tolerate the accumulation of Ub+ mitochondria. Compared with the susceptibility of Kenny mutant flies to the systemic insult of feeding PQ (Figure 6E), these neuron-specific manipulations do not appear to severely affect overall survival.

Kenny mediates mitophagy induced by depolarization of mitochondrial membrane potential in mammalian cells and in Drosophila fat bodies

While our prior data suggests involvement of Kenny in Ub-mediated mitophagy in fly neurons, we know little about the underlying stress inducing mitophagy in the in vivo conditions we have examined: in basal conditions (Figure 1), with Vps13D knockdown (Figure 2), or Drp1 knockdown (Figure 7). Therefore, we sought to determine if Kenny mediates mitophagy in a well-established assay for assessing Ub-mediated mitophagy. The gold standard is Pink1/Parkin-mediated mitophagy, which is induced through the global application of the mitochondrial uncoupling toxins in cultured cells expressing Parkin (Narendra et al., 2008, 2010b). This insult depolarizes mitochondria, causing recruitment of Parkin to the mitochondrial OMM, ubiquitination of OMM proteins, recruitment of autophagy machinery, and delivery to the lysosomes (Narendra and Youle, 2024). Therefore, we generated constructs that express Drosophila Kenny, which was fused to the HA epitope tag on its C-terminus. We expressed this construct in combination with EGFP-tagged Parkin in HeLa cells. In control conditions with the application of vehicle (DMSO), both EGFP-Parkin and Kenny-HA show diffuse localization throughout the cytoplasm, consistent with Parkin and OPTN localization in untreated HeLa cells (Figure 8A, top panel) (Wong and Holzbaur, 2014). Upon treatment of the cells with 20μM of the uncoupling toxin carbonyl cyanide m-chlorophenyl hydrazone (CCCP) for 75 minutes, EGFP-parkin co-localizes with mitochondria. Similar to its mammalian homolog OPTN, expressed Drosophila Kenny is also recruited to the mitochondrial surface upon mitochondrial membrane depolarization (Figure 8A, bottom panel). This result suggests that Kenny localizes similarly to OPTN in in vitro assays of Pink1/Parkin-mediated, and thus Ub-mediated mitophagy.

Figure 8: Kenny mediates mitophagy induced by mitochondrial membrane depolarization.

A) Representative images of HeLa cells co-expressing EGFP-Parkin (cyan) and Drosophila Kenny fused to HA (Kenny-HA, yellow), stained for the mitochondrial protein TOMM20 (magenta). The top panel represents control cells treated with Vehicle (DMSO), and the bottom panel represents cells treated with 20μM CCCP for 75 minutes. Numbered dashed boxes outline regions containing Parkin+ mitochondria, and are shown in high magnification below, which is a single Z-plane. Arrowheads represent mitochondria double positive for EGFP-Parkin and Kenny-HA. Scale bars=10, 1μm. B) Representative images of larval fat body tissue expressing UAS-matrix-QC, via the cgGal4 driver. Genotypes are indicated on the left. Larvae in the top panel were fed vehicle (DMSO), while larvae in the bottom 2 panels were fed 500μM FCCP for 10 hours. GFP alone signal (cyan) and mCherry (RFP) signal alone (magenta) are shown in separate panels in greyscale, and the merged picture appears greyscale due to the near perfect overlap of the cyan and magenta channels. The dashed box outlines a region in each condition that is shown in a high magnification merged image in the “Zoom matrix-QC” panel to the right. Arrowheads represent mitolysosomes. Scale bars=10, 2μm. C) Quantification of the number of mitolysosomes per area in larval fat body tissue expressing matrix-QC from the indicated genotypes (bottom), analyzed from images represented in (B). Feeding conditions are indicated in the key (above). Bars represent the mean ± SEM, with individual black dots representing the average # of mitolysosomes per larvae/μm² (n=5 larvae for each condition). *** represents an adjusted p-value=0.0001 and 0.0003, and ns represents an adjusted p-value of 0.8784 based on a one-way ANOVA with Tukey’s multiple comparisons test.

While the former data implies an evolutionary conserved role of Kenny in Ub-mediated mitophagy induced by mitochondrial depolarization, we sought to establish its functional role in supporting mitophagic flux in this scenario. Prior studies have demonstrated membrane depolarization-induced mitophagy in the Drosophila larval fat body upon consumption of the uncoupling toxin carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) (Tsapras et al., 2019). We hypothesized that membrane depolarization-dependent mitophagy is mediated by Kenny in this scenario. We found that upon feeding larva 500 μM FCCP compared to vehicle conditions, we could visualize a significant increase in the frequency of Ub+ mitochondria that co-localize with endogenous Kenny (S Fig 7A&B). To test the functional role of Kenny in this induced mitophagy, we expressed the fluorescent mitophagy reporter matrix-QC in the fat body via the cgGal4 driver. In vehicle-treated fat body tissue, we observed a basal level of mitophagic flux, with occasional mitolysosomes (Figure 8B&C). Upon feeding FCCP, we observed a significant increase of mitolysosomes in Kenny heterozygous animals. In contrast, Kenny mutant animals showed no increase in mitolysosomes upon FCCP feeding (Figure 8B&C), indicating that mitophagic flux is inhibited by the loss of Kenny. These combined results suggest that Kenny is critical for mitophagic flux induced by mitochondrial membrane depolarization both in culture conditions, and in vivo in the fly fat body cells.

Discussion

Much of the previous research associated with the Kenny gene has studied its essential role in the IMD pathway in innate immunity (Rutschmann et al., 2000; Ertürk-Hasdemir et al., 2009), consistent with its homology to the mammalian NF-kappa-B essential modulator (NEMO) protein. However, a recent study identified Kenny as an autophagy adaptor (Tusco et al., 2017), defining a role for Kenny in the autophagic degradation of the Drosophila IKK complex consisting of Kenny and Ird5/dIKKβ. This study noted the homology of Kenny to mammalian NEMO, and mathematically modeled the evolution of Kenny, describing the loss of the LIR domain which is not present in NEMO (Tusco et al., 2017). The strong homology of OPTN and NEMO in mammals (Zhu et al., 2007) suggests a common evolutionary ancestor like Kenny. Our work now establishes Kenny as a functional homolog of OPTN in Drosophila, defining a direct role for it in the recruitment of the phagophore to mitochondria undergoing Ub-dependent mitophagy. Therefore, it appears that Kenny functionally acts similar to both OPTN and NEMO in flies. Interestingly, it has recently been demonstrated that NEMO is recruited to damaged mitochondria in PINK1/Parkin-mediated mitophagy to initiate downstream NF-kappa-B signaling (Harding et al., 2023). This work in cultured mammalian cells demonstrated that NEMO and OPTN are recruited to distinct populations of mitochondria undergoing mitophagy, suggesting a level of regulation of differential recruitment that would not exist in the flies that only contain the Kenny protein. However, it will be interesting to determine in future work if compromised mitophagy in flies in vivo can lead to initiation of IMD-signaling mediated via Kenny association with Ub+ mitochondria not being properly degraded.

Our work adds to an unresolved question about the role of Ref(2)p/p62 in Ub-mediated mitophagy. We have shown that Ref(2)p is recruited to Ub+ mitochondria (Figure 1A, 1C, & 2A), but does not appear to be involved in the recruitment of the phagophore. This is consistent with prior work demonstrating the lack of a contribution of p62 to Pink1/Parkin mediated mitophagy in cultured mammalian cells (Lazarou et al., 2015). It has been suggested that p62 mediates the clustering of mitochondria fated for mitophagy in cultured cells undergoing bulk mitophagy driven by global application of uncoupling toxins (Narendra et al., 2010a; Okatsu et al., 2010), but it is unclear whether such clustering is involved in mitophagy in in vivo scenarios. It is also possible that Ref(2)p/p62 plays a facilitative role in the growth and completion of the phagophore, which we could not accurately test in our assays. Prior work has demonstrated that Ub-driven oligomerization of autophagy receptors promotes the formation of phase separated condensates that promote the efficient growth of the phagophore [reviewed in (Chen et al., 2021)]. This is well-established for p62 (Sun et al., 2018; Zaffagnini et al., 2018), and has been demonstrated recently with mammalian OPTN during mitophagy (Yang et al., 2024). Based on our data that Kenny asymmetrically localized to the region of Ub+ mitochondria where the phagophore is present in conditions of Vps13D knockdown (Figure 2C), we speculate that Kenny may mediate the initial recruitment of the phagophore by regionally concentrating on the mitochondria, while perhaps Ref(2)p associates with the entire Ub+ mitochondria to promote phase separation of this relatively large cargo to aid in efficient phagophore growth. Alternatively, Kenny and Ref(2)p may cooperatively oligomerize to facilitate efficient engulfment of the mitochondria by the phagophore, as has been previously demonstrated to occur in autophagy in cultured mammalian cells with OPTN and p62 (Liu et al., 2014). More work is needed to examine these possibilities in different in vivo cell types and contexts. The genetic tools developed in this study and others (Bhattacharjee et al., 2022), along with the lack of genetic redundancy in autophagy adaptor proteins Drosophila will be advantageous to examining these questions.

Our data indicating the presence of Ub+ mitochondria in Atg5 mutants (Figure 1), Kenny loss of function mutants (Figure 4C&D), and Kenny LIR domain mutants (Figure 5C&D) in basal conditions strongly support the notion that Ub-dependent mitophagy is active in larval motoneurons. This is consistent with other recent studies (Insolera et al., 2021; Sanchez-Martinez et al., 2023). It is intriguing that Ub+ mitochondria were present in a fraction of motoneurons in these conditions of compromised Ub-dependent mitophagy. It is possible that the neurons containing Ub+ mitochondria undergo higher rates of Ub-dependent mitophagy, and therefore, these mitophagy intermediates are more readily observable by our methods which provide only a snapshot of current conditions in the neurons. Because the fate of these stalled mitochondria is unknown, we cannot rule out that Ub+ mitochondria are degraded by alternative mitochondrial quality control mechanisms that may compensate for the loss of Ub- dependent mitophagy. Mitophagy receptor proteins, such as BNIP3 and FUNDC1, mediate mitophagy independent of Ub, and may be a mechanism to degrade damaged mitochondria when Ub-dependent mitophagy is compromised. This could explain why we could not observe a change in overall mitophagic flux in basal conditions in Kenny mutant neurons using the matrix-QC reporter (s Fig 5). We did, however, observe changes in flux in Kenny mutants when we experimentally elevated Ub-mediated mitophagy by Drp1 knockdown in neurons (Figure 7) and with uncoupling toxins in fat body cells (Figure 8). Our future experiments will test the hypothesis that receptor-mediated mitophagy can compensate for perturbations in Ub-dependent mitophagy at basal levels. Such compensation may also explain the lack of change in lifespan of Key^LIRm-HA mutant flies in basal conditions (Figure 6A). Further, mitophagy-independent mechanisms could also compensate in conditions of compromised mitophagy at basal levels, as elegant studies in flies have estimated that autophagy can account for only a third of the degradation of mitochondrial proteins (Vincow et al., 2013, 2019). However, our current knowledge of mitophagy-independent mechanisms of mitochondrial quality control is limited, and requires additional research to understand its complexities, as well as the crosstalk with mitophagy.

Our data provides cellular evidence of the importance of Kenny for Ub-dependent mitophagy. However, due to the strong connection between mutations in OPTN and the neurodegenerative disease ALS, it is surprising that we were unable to observe significant disruptions in the survival of flies when Kenny-mediated mitophagy was compromised (Figure 6A). While we did observe a reduction in the lifespan of Kenny loss of function mutant flies in basal conditions (Figure 6A) and in conditions of elevated ROS (Figure 6E), we did not observe a decrease when we disrupted the mitophagy specific function of Kenny by mutating the LIR domain (Figure 6A). Our results from Kenny mutant flies are consistent with studies of OPTN mutant mice. Loss of function OPTN mutant mice have dysmyelination and degeneration of motor axons in the spinal cord, but no loss of motor neurons, and only subtle age-dependent motor defects (Ito et al., 2016). Other independent OPTN mutant mouse models have observed no change in lifespan of mice, and no age-dependent motor defects despite cellular defects suggesting autophagic disruption in motor neurons (Markovinovic et al., 2018; Kurashige et al., 2021; Moharir and Swarup, 2022). Therefore, cellular hallmarks of compromised autophagy in neurons are common to both Kenny mutant flies, and OPTN mutant mice; however, the manifestation of these phenotypes into neurodegeneration seen in ALS is still not well understood and requires additional research.

It was also surprising that when we induced a stress that triggered Ub-dependent mitophagy by knocking down Drp1, it did not strongly alter the survival of Kenny mutant animals (S Fig 6). We had previously observed that combining Drp1 knockdown with knockdown of the core autophagy gene, Atg5, led to strong pupal lethality (Insolera et al., 2021), but this did not occur with combined loss of Drp1 and Kenny (S Fig 6A). Even the combined knockdown of Drp1 and Kenny in adult neurons did not reduce the survival of flies more than Drp1 knockdown alone (S Fig 6B), which was a surprise due to the observed accumulation of mitophagy intermediates in this condition (Figure 7A). We suspect that other forms of mitophagy, such as receptor-mediated mitophagy, can still be activated in conditions of Kenny loss, but not when Atg5 is knocked down. This may account for the discrepancy with our previous results, but this requires further exploration. It was also surprising that Kenny LIRm mutants did not have decreased lifespan (Figure 6A), and were not sensitive to PQ treatment, compared to the null mutants (Figure 6E). However, mitophagic flux data in Figure 7B&C suggests that Kenny LIRm mutants are capable of supporting limited flux: less than control conditions, but higher than Kenny null mutants. Differential compensatory mechanisms are likely to arise in these two different Kenny mutants, as prior work comparing Ref(2)p null mutants to LIR-domain mutants demonstrated unexpected cellular and physiological differences (Bhattacharjee et al., 2022). Therefore, more work is required to understand the differences of Kenny LIRm mutants compared to loss of function Kenny mutants.

In summary, this work establishes Kenny as a functional homolog of mammalian OPTN in Drosophila, required for the recruitment of the phagophore to mitochondria in Ub-dependent mitophagy. There are direct genetic associations of OPTN to the human diseases ALS (Zhao et al., 2023), glaucoma (Swarup and Sayyad, 2018), and Paget disease of bone (PDB) (Albagha et al., 2010), and indirect connections to numerous additional diseases (Qiu et al., 2022). Therefore, a comprehensive genetic, physiological, and molecular understanding of OPTN is needed to understand underlying mechanisms of these human diseases. Thus, this work opens the door to utilize the powerful genetic tools available in Drosophila to further investigate Kenny function in vivo, and gain a better understanding of the consequences of compromised mitophagy that may underlie several human pathological conditions.

Materials and Methods

Fly maintenance and Drosophila stocks

Fly stocks were maintained on a 10% yeast/sugar diet. All larval experiments used 3rd instar larvae which were cultured at 25°C in a 12:12h light:dark cycle incubator.

The following strains were used in this study that were obtained from the Bloomington Stock Center: D42-Gal4 (BL #8816), Vps13D RNAi (BL #38320), luciferase RNAi (Control RNAi) (BL #31603), Ref(2)p^c03993 (shortened to Ref(2)p^c)( BL#85043), Key^c02831 (shortened to key^C) (BL#11044), Kenny RNAi (BL# 57759), Drp1 RNAi (BL #67160), Atg5 RNAi (BL #34899), matrix-QC (BL# 602462), nSyb-Gal4 (BL #51635), UAS-EGFP (BL #5431), Act5C-Gal4 (BL #3954), elavGS (BL# 43642), and cgGal4 (BL# 7011). The following strains were gifts: Atg5^5cc5 (Kim et al., 2016) (from G Juhasz, Eötvös Loránd University, Hungary), Key¹ (Rutschmann et al., 2000) (from Dominique Ferrandon, University of Strasbourg Institute for Advanced Study, France), Ref(2)p^OD3 (from Eric Baehrecke, UMass Chan Medical School, USA), and UAS-IMD-CA (from Edan Foley, University of Alberta, Canada). The following strains were generated in this study (described below): Key^null (deletion of entire Kenny coding sequence) , Key^WT-HA (endogenous kenny tagged with HA on the C-terminal), and Key^LIRm-HA (endogenous kenny with a mutated LIR domain, tagged with HA on the C-terminal).

For elavGS experiments, RU486 was prepared in a stock at 10mM in 70% ethanol, and mixed into the food while cooking at a final concentration of 0.2mM. Flies were fed RU486 containing food only after eclosion to induce adult-onset expression.

Generation of kenny knock-in flies via CRISPR/Cas9

CRISPR-mediated mutagenesis of Kenny was performed by WellGenetics Inc. (Taipai, Taiwan) using modified methods from previously published protocols (Kondo and Ueda, 2013). In brief, the upstream gRNA sequence GGCAATGATTCATTAGGCGT[GGG] and the downstream gRNA sequence GTGACTCTGAAGCACGCTTA[AGG] were cloned into U6 promoter plasmid(s) separately. Cassette RMCE-3xP3-RFP, which contains two attP sites, a floxed 3xP3 RFP and two homology arms were cloned into pUC 57 Kan as donor template for repair. key/CG16910 targeting gRNAs and hs Cas9 were supplied in DNA plasmids, together with donor plasmid for microinjection into embryos of control strain w¹¹¹⁸. F1 flies carrying selection marker of 3xP3 RFP were further validated by genomic PCR and sequencing. CRISPR generated a 1,649 bp deletion allele of Key/CG16910, deleting partial 5’ UTR/CDS of Key/CG16910 gene and is replaced by cassette RMCE-3xP3-RFP. The resulting fly lines (Key^{RMCE-3xP3-RFP}) were validated for proper insertion by PCR and genomic sequencing. To generate the Key^null allele described above, the Key^{RMCE-3xP3-RFP} line was crossed for 2 generations with a fly line containing Cre-recombinase to remove the 3xP3-RFP by loxP-mediated recombination.

The missing fragment of the Key/CG16910 gene removed by the CRISPR/Cas9 modification was synthesized and cloned (Genscript Inc.) into the pBS-KS-attB1-2 plasmid (Venken et al., 2011). Variants of pBS-KS-attB1-2-key (described below) were injected into embryos of the Key^{RMCE-3xP3-RFP} fly line by Bestgene Inc. (Chino, CA), and progeny were screened for the loss of 3xP3-RFP phenotype indicating successful recombinant-mediated cassette exchange (RMCE). Individually identified variants were further tested for insertion of the Kenny genomic fragment in the proper orientation by genomic PCR, and variants with the correct orientation were subsequently validated by sequencing and western blotting for Kenny protein expression.

Separate modifications of the Key/CG16910 gene fragment were synthesized and cloned for RMCE to generate the knock-in alleles described above. A “WT” fragment, which did not modify the genomic sequence, was generated (pBS-KS-attB1-2-key) and western blotting demonstrated that this line expressed Kenny at levels comparable to control flies lacking genomic modification (not shown). This control demonstrated that the genomic scarring that occurred as a result of the RMCE did not alter Kenny expression. A separate gene fragment was synthesized and cloned containing the nucleotide sequence of the HA-epitope tag inserted in-frame at the C-terminus of the Kenny gene directly before the stop codon (pBS-KS-attB1-2-key-HA). This was used to generate the “Key^WT-HA” knock-in allele. Additional mutations were introduced through site-directed mutagenesis in the pBS-KS-attB1-2-key-HA plasmid to generate the Key^LIRm-HA allele, in which nucleotides were mutated to alter the amino sequence of kenny (6-13) protein from SFVILGSS to SAVICSSS. F7 and L10 amino acids (mutated to A and C, respectively), were previously identified as essential LIR domain residues (Tusco et al., 2017). While the intended strategy was to mutate F7 and L10 both to A, the mutagenized plasmid and resultant fly contained an unintended mutation that caused L10C and G11S protein changes, instead of L10A alone. Because the core LIR domain was mutated, and the remaining protein was unaltered (besides the additional G11S mutation), we chose to utilize this fly line despite the unintended mutation.

Toxin administration to larva/flies

To administer PQ to adult flies, 15 male flies 7 days after eclosion were maintained in vials containing a 23mm circle of filter paper (Whatman) containing 200 μL of a solution of 5% sucrose (w/v) with a final concentration of 10mM paraquat (Sigma). The # of dead flies was monitored every 12 hours, and the flies were flipped to new vials with fresh sucrose/PQ solutions daily until all flies in the vial died.

To feed larvae FCCP (Sigma), feeding third instar larvae of the proper genotype were collected and placed in 35mm dishes containing 0.4g of instant Drosophila food (Formula 4-24, Carolina Biological Supply Company), mixed with 1 mL of water containing either vehicle (DMSO at the same concentration as FCCP dilution) or 500μM FCCP. For experiments visualizing Kenny co-localization with Ub+ mitochondria, larvae were fed for 5h before dissection. For experiments with matrix-QC expression in the fat body, larvae were fed for 10h before dissection.

Immunohistochemistry

Third instar larvae were selected based on visual and fluorescent markers, and filet dissections as described previously (Budnik et al., 2006) were performed in ice-cold PBS. Larvae were fixed with undiluted Bouin’s Fixative (Ricca Chemical Cat# 1120–16) for 7 minutes at room temperature. Following fixation, dissected larvae were washed three times in PBS for ten minutes on a low-speed orbital shaker, followed by three washes with PBS-T (PBS with 0.1% Triton X-100) for 5 minutes before blocking for at least 30 minutes at room temperature in PBS-T supplemented with 5% normal goat serum. Primary and secondary antibodies were diluted in the same buffer used for blocking. Primary antibodies were incubated overnight at 4°C, followed by PBS-T washes. Secondary antibodies were incubated for at least 2 hours at room temperature, followed by PBS-T washes. Following staining, fileted larvae were mounted using VectaShield mounting media (Vectorlabs).

The following primary antibodies were used in this study: anti ATP5A at 1:1000 (Abcam #ab14748), anti Ref(2)p at 1:500 (Abcam #ab178440), anti Atg8 (GABARAP) at 1:500 (Cell Signaling Technology #13733S), anti GFP at 1:1000 (Aves Labs #GFP1020), anti GFP at 1:1000 (Life Technologies #A6455), anti Multi Ubiquitin (“Ub”) at 1:500 (FK2) (MBL International #D058-3), anti Elav at 1:100 (Developmental Studies Hybridoma Bank #Rat-Elav-7E8A10), anti HA at 1:500 (Cell Signaling Technology #3724) , anti HA at 1:500 (Roche #11867423001), and anti ATPβ at 1:500 (Abcam #ab14730). The anti-Kenny antibody was kindly gifted to us by Rui Zhou (JHMI, St. Petersburg, FL), and used in immunostaining at a dilution of 1:500.

Preparation of samples expressing matrix-QC were performed as previously described (Sanchez-Martinez et al., 2024). Briefly, larvae were dissected in ice-cold PBS, and immediately fixed in a fixation buffer of neutral pH (4% formaldehyde in 200mM HEPES, pH 7.0) for 20 minutes at room temperature. Larvae were washed with PBS to remove fixative and mounted on slides using Prolong Diamond mounting media (Life Technologies). Images were acquired within one day of dissection/fixation.

Dissection and staining of the fat body dissection was modified from previous descriptions (Dark et al., 2022). Briefly, third instar larvae were fileted and the trachea were carefully cut while avoiding the fat body. The gut contents together with the salivary glands were removed with deliberate caution to cause minimal to no disruption to the fat body. All incubations and washing of the samples were done gently to prevent dislodging of the fragile fat body. We manually created depth during mounting by making a spacer with tape to prevent distorting or crushing the fat body when the coverslip was added. All other steps of immunohistochemistry are as described earlier.

Imaging

Imaging of fixed and stained tissue was performed on either a Leica SP5, or Leica SP8 laser scanning confocal microscope equipped with a 63x HC PL APO glycerol immersion objective lens (NA 1.3), with Z-sections of 0.2-0.3μm. All imaging settings were the same for samples directly compared.

For imaging matrix-QC samples, a spinning disk confocal microscope was used equipped with a 63x oil immersion objective lens (NA 1.4), with Z-sections of 0.2-0.3μm. This scope is a Leica DMI6000B body with an X-Light V2 spinning disk (Crest Optics), 16 bit CMOS camera (Photometrics), and LDI 7 laser launch (405, 445, 470, 520, 528, 555, and 640nm) (Cairn Research and 89 north).

Image analysis

Image analysis was performed with ImageJ. Acquired Z-stacks were manually assessed in individual Z-planes for all analysis. For %Ub+ Mito Co-localization, Ub+ mitochondria were manually identified individually by a Ub puncta localizing to a mitochondrial marker (either mitoGFP or ATP5A), and then individually determined to contain ref(2)p or kenny staining. To determine the % of neurons containing a mitophagy intermediate, individual mid-line motor neuron cell bodies in the larval VNC were identified and counted based on morphology of mitochondria. Following identification of motoneurons, individual motoneurons were assessed manually through Z-planes to determine whether they contain a mitochondria (labeled with either mitoGFP or ATP5A) that co-localizes with a Ub punctum or halo. Any motoneuron containing 1 or more Ub+ mitochondria was considered containing a mitophagy intermediate. To determine whether a Ub+ mitochondria contained a phagophore, individual Ub+ mitochondria were identified manually through Z-planes. If each individual Ub+ mitochondria contained associated Atg8A staining (puncta, crescent, or halo), it was considered having a phagophore. For matrix-QC quantification, individual mid-line motor neuron cell bodies in the larval VNC were identified and counted based on morphology of mitochondria. For each motoneuron, the presence of mitolysosomes were assessed manually through the Z-planes. A neuron was considered having a “mitolysosome” if there was a puncta that contained only fluorescence in the mCherry channel. For each neuron that contained a mitolysosome, the number of mitolysosome in that neuron was counted.

For mitophagy flux assessment in the fat body, quantification of mitolysosomes were adapted from previous publications (Montava-Garriga et al., 2020; Sanchez-Martinez et al., 2024). Due to the voluminous z stacks acquired from the fat body confocal imaging and to ensure standardized comparisons, the most representative range of z planes (~15-20) were considered and assessed. These planes were z-projected with maximal intensity with ImageJ. The number of mitolysosomes were manually counted, and the area assessed was determined using the region of interest (ROI) manager feature on ImageJ. The number of mitolysosomes per ROI was calculated for each sample.

For assessment of mitophagy intermediates in the fat body, we generated a z-projected image and ROI determined like described before. The number of different parameters of interest indicated in text were recorded and their ratio to ROI calculated.

RNA isolation and qPCR

Total RNA was extracted using a modified protocol for the Direct-zol RNA Micro Kit (Zymo). First, samples were homogenized in Trizol, and chloroform was added (per Trizol manufacturer’s protocol). The subsequent aqueous phase was combined with ethanol at a 1:1 ratio, and used with the manufacturer’s protocol of the Direct-zol RNA Micro Kit for RNA isolation. For whole fly samples testing RNAi efficiency, 5 whole flies (1 week old) were used per sample. For whole larval RNA samples, 5 washed whole 3rd instar larvae were used per sample. Reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosciences), in which 1000ng of total RNA was loaded per sample. qRT-PCRs were performed using iTaq Universal SYBR Green Supermix (BioRad) and a BioRad CfX DUET RT-qPCR machine (Bio-Rad). The 2^-ΔΔct method (relative quantification) was used to calculate the expression levels of the targets using the ribosomal protein subunit gene rpl32 (Rp49) as an endogenous control.

Primers used are as follows (all 5’-3’): Rpl32 F, CAGCATACAGGCCCAAGATC ; Rpl32 R, TTGCGCCATTTGTGCGAC ; Kenny F, ATTGCAGAGGAGGAACCAGG ; Kenny R, TGTTGGGTCGAGAATTCTTACTG ; AttC F, CTGCACTGGACTACTCCCACATCA ; AttC R, CGATCCTGCGACTGCCAAAGATTG ; DptA F, ATGACCATGAAGCCCACTCC ; DptA R, CAATCTCGTGGCGTCCATTG .

Eclosion assay

Pupae of the proper genotype (based on morphology and fluorescence) were counted 8 days following egg laying, and counted pupae were tracked for a total of 7 days. Successful eclosion was counted as complete exit from the pupal case, as flies that died while partially eclosed were counted as failed.

Lifespan assay

Adult flies for lifespan assays were maintained on standard food at 25°C in an incubator with a 12:12h light: dark cycle and transferred to new vials every 2-3 days. The number of deaths were recorded until all flies in all conditions were dead. Only male flies were used for lifespan assays.

Mammalian Cell Culture, Expression Plasmids and Immunostaining

Human HeLa (cervical carcinoma patient) cells were cultured in a T-25 flask in Eagle’s Minimum Essential Medium (EMEM, cat. #: 30-2003, ATCC) with 10% fetal bovine serum (FBS, cat. #: 30-2020, ATCC) and 1x penicillin-streptomycin (cat. #: 15-140-122, Gibco). Cells were grown in a Heracell VIOS 150i CO2 incubator (Thermo Scientific) at a temperature of 37°C and carbon dioxide level of 5%.

The coding sequence of Drosophila Kenny was optimized for human codons, fused on its C-terminal to the HA epitope tag, synthesized and cloned into the EcoRI/NheI restriction sites of pcDNA3.1+ (Genscript Inc.). The plasmid expressing human Parkin tagged with EGFP was purchased from Addgene: pEGFP-parkin WT (45875). Cells were plated on coverslips, and the plasmids were co-transfected into HeLa cells using FugeneHD, according to the manufacturer’s instructions. Toxins were added 24h post transfection. Stock solutions of CCCP were dissolved in DMSO at a concentration of 20mM, and diluted 1:1000 in culture media (with Vehicle treatments receiving 1:1000 dilution of DMSO). After 75 minutes of treatment, cells were fixed with 4% formaldehyde in PBS for 15 minutes at room temperature. Following washes and blocking, cells were stained with the following primary antibodies: anti TOMM20 at 1:2000 (Abcam ab56783), anti GFP at 1:2000 (Life Technologies #A6455) and anti HA at 1:2000 (Cell Signaling Technology #3724). Secondary antibodies were the same as previously described. HeLa cells were imaged with a 100X HC PL APO objective lens (NA 1.47) on the spinning disk confocal microscope described above.

Methodology and Statistics

Sample sizes were chosen based on previously published results. No samples were excluded from analysis. Experimenters performing analysis were not blinded to genotypes or conditions.

Statistical measures are indicated in Figure legends for each quantification.

Supplementary Material

1

S Fig 1: Schematic outlining newly generated knock-in kenny mutants. A) Procedural strategy used to generate kenny knock-in flies via CRISPR/Cas9 (see Materials and Methods for more detail). Note the names and relationship of alleles used in the manuscript depicted in this figure: Key^null, Key^WT-HA, and Key^LIRm-HA. B) Domain structure of the Drosophila kenny protein, with an emphasis on the amino acid sequence in the core LIR domain in the N-terminal region. Magenta residues are critical LIR domain residues, and shown are the introduced mutations in the Key^LIRm-HA line indicated by the grey amino acids.

S Fig 2: Validation of loss of protein expression in ref(2)p and kenny mutants with different alleles. Representative images of midline motoneuron cell bodies in the larval VNC which express UAS-Vps13D RNAi, via the D42-Gal4 driver. Genotypes are indicated on the left. Tissue is stained with Ub (magenta) and mitochondrial protein ATP5A (yellow). A) Tissue from ref(2)p heterozygous larvae (top panel) and two different mutants (lower panels) were stained for ref(2)p (cyan) to confirm loss of protein expression, which typically localizes to Ub+ mitochondria as in the heterozygous larvae (top panel). B) Tissue from kenny heterozygous larvae (top panel) and two different mutants (lower panels) were stained for kenny (cyan) to confirm loss of protein expression, which typically localizes to Ub+ mitochondria as in the heterozygous larvae (top panel). Scale bar=5μm.

S Fig 3: Kenny associates with Ub+ mitochondria in body wall muscles lacking Vps13D. Representative images of 3rd instar larval body wall muscle 12 expressing UAS-Luciferase RNAi (Control RNAi) versus UAS-Vps13D RNAi via the muscle12 (M12)-Gal4. Tissue was stained for Ub (magenta) and mitochondrial protein ATP5A (yellow). A) Representation of phenotype resulting from Vps13D knockdown in larval body wall muscles including enlarged mitochondria, and accumulation of Ub+ mitochondria, indicated by arrowheads. Scale Bar=20μm. B) Tissue was additionally stained for Kenny (cyan). Arrowheads indicate examples of Ub+ mitochondria that co-localize with kenny. Scale Bar=5μm.

S Fig 4: Cell autonomous knockdown of kenny in neurons causes the presence of Ub+ mitochondria. A) qPCR analysis of transcript levels of Kenny from whole adult flies expressing UAS-Luciferase RNAi (Control RNAi) versus UAS-Kenny RNAi via the ubiquitous Act5C-Gal4. Bars represent the mean ± SEM, with individual grey dots representing the fold change per sample (n=3 samples for each condition, containing 5 whole flies each). * represents p=0.0101 based on an unpaired, two-tailed T-test. B) Representative images of individual midline motoneuron cell bodies in the larval VNC which co-express UAS-mitoGFP (cyan), and either UAS-Luciferase RNAi (control RNAi) or UAS-Kenny RNAi, via the D42-Gal4 driver. Tissue was stained for Ub (magenta). Arrowhead indicates an example of a Ub+ mitochondria. Each image represents 1-3 Z-planes. Scale bar=2μM. C) Quantification of the % of midline motoneurons that contain at least 1 Ub+ mitochondria from tissues expressing the indicated RNAi (bottom), analyzed from data in (B). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 15-40 neurons per larval VNC). **** represents p<0.0001 based on an unpaired, two-tailed T-test.

S Fig 5: Mitophagic flux measurement in kenny mutants with matrix-QC. A) Representative images of midline motoneuron cell bodies in the larval VNC which express UAS-matrix-QC, via the D42-Gal4 driver. Genotypes are indicated on the left. GFP alone signal (cyan) and mCherry (RFP) signal alone (magenta) are shown in separate panels in greyscale, and the merged picture appears greyscale due to the near perfect overlap of the cyan and magenta channels. Arrowheads indicate examples of “mitolysosomes” which are RFP-only puncta. B) Quantification of the % of midline motoneurons that contain at least 1 mitolysosome from tissues expressing matrix-QC from the indicated genotypes (bottom), analyzed from data in (A). Bars represent the mean ± SEM, with individual grey dots representing the average % per larvae (n=5 larvae for each condition, with 35-55 neurons per larval VNC). ns represents p=0.0952 based on an unpaired, two tailed T-test. C) Quantification of the # of mitolysosomes per neuronal cell body, quantified only among the neurons that contained at least 1 mitolysosome. Individual grey dots represent individual neurons (n=21 for Key^C/+ and n=39 for Key^C/null). ns represents p=0.3919 based on an unpaired, two tailed T-test.

S Fig 6: Survival of flies with combined loss of Drp1 and Kenny in neurons. A) Quantification of successful eclosion frequency of pupae with expression of indicated RNAi, via the nSyb-Gal4 driver. RNAi was expressed in the three genotypes indicated below the x-axis. The number of pupae counted for each condition is indicated in the bars on the graph. ns indicates p=0.3743, ^ indicates p=0.0024, # indicates p=0.0162, * indicates p=0.0256, and + indicates p<0.0001 based on Chi square test of two compared genotypes indicated. B) Lifespan curve of adult male flies with adult-onset expression of the indicated RNAi’s via the elavGS driver, which was induced by feeding RU486-containing food after eclosion. The total number of flies assessed are indicated in the key. ****p < 0.001 based on a Log-Rank (Mantel-Cox) test.

S Fig 7: FCCP induces Kenny recruitment to Ub+ mitochondria in larval fat body cells. A) Representative images of cells in the larval fat body stained for Ub (cyan), Kenny (magenta) and the mitochondrial protein ATP5A (yellow). Larvae in the top panel were fed vehicle (DMSO), while larvae in the bottom panel were fed 500μM FCCP for 5 hours. Arrowhead represents a mitochondria that is double positive for Ub and Kenny. Scale bar=2μm. B) Quantification of the number of mitochondria double positive for Ub and Kenny per area, analyzed from data in (A). Laval feeding conditions are indicated below. Bars represent the mean ± SEM, with individual black dots representing the average # double positive mitochondria/μm² per larvae (n=5 larvae for each condition). ** represents p=0.0061 based on an unpaired, two-tailed T-test.