Abstract
Purpose
Epithelial–mesenchymal transition (EMT) is a major pathological characteristic of airway remodelling in severe asthma. Interleukin (IL)-36 belongs to the IL-1 family and is associated with allergic disease, but the role of IL-36 in airway remodelling in asthma remains unclear. We aimed to explore the effect of IL-36 on EMT and to verify whether blocking IL-36-induced EMT can alleviate the airway remodeling in severe asthma.
Methods
In this study, BEAS-2B cells were stimulated with IL-36 receptor (IL-36R) agonist. The expression of epithelial‒mesenchymal transition (EMT) markers and the migration capacity of cells were determined. A chronic asthma mouse model was established to evaluate the effects of IL-36 signalling on airway inflammation and remodelling.
Results
In vitro, EMT and cell migration in BEAS-2B cells were induced by IL-36. In addition, IL-36 facilitated the phosphorylation of NF-κB and STAT3. In vivo, blocking IL-36R via treatment with an IL-36 receptor antagonist (IL-36Ra) inhibited the infiltration of inflammatory cells, decreased airway hyper-responsiveness (AHR) and alleviated airway remodelling (by inhibiting processes, such as EMT) in asthmatic mice. Compared with the administration of IL-36Ra alone, the coadministration of IL-36R agonist with IL-36Ra restored pathological changes related to airway remodelling.
Conclusions
These data indicated that IL-36 signalling may participate in airway remodelling by inducing EMT. IL-36 may be a new therapeutic target for airway remodelling in severe asthma.
Supplementary Information
The online version contains supplementary material available at 10.1186/s40001-026-03886-z.
Keywords: IL-36, EMT, Asthma, Airway remodelling
Introduction
Asthma is a chronic inflammatory airway disease characterized by airway inflammation, airway hyper-responsiveness (AHR) and airway remodelling [1]. It affects the health of 300 million people worldwide [2]. Airway remodelling has been confirmed to be crucial for the pathogenesis of severe and refractory asthma [3–5]; it has been described as changes in the structure of the airway wall, including subepithelial fibrosis, extracellular matrix (ECM) deposition, a greater proportion of smooth muscle, and angiopoiesis [6–10]. This results in the narrowing and blockage of small air passages, leading to more frequent asthma attacks and higher mortality rates [11]. Currently, the main treatment for asthma targets airway inflammation, but its effect on airway remodelling is weak; thus, approximately 10% of asthma patients may still experience poor control of their condition even with proper treatment [12, 13]. Therefore, it is crucial to understand the mechanisms of airway remodelling and identify new therapeutic targets to inhibit airway remodelling and decrease the severity of asthma.
Airway epithelial cells play a central role in airway remodelling in asthma, serving as the first line of defence against allergens [14]. Epithelial–mesenchymal transition (EMT) is a complex pathological phenomenon involving the loss of epithelial polarity due to the disruption of cell‒cell junctions, aberrant expression of mesenchymal proteins, and the transformation of epithelial cells into mesenchymal cells [15]. Increasing evidence suggests that EMT plays a key role in subepithelial fibrosis, which is a prominent hallmark of airway remodelling in asthma [12, 14, 16]. In EMT, cells of the airway epithelium undergo a shift in phenotype. This process involves a reduction in characteristic epithelial features, such as cell-to-cell adhesion and apical–basal polarity. Through molecular reprogramming, these cells gain motility traits that are typical of mesenchymal cells. The final outcome is their differentiation into tissue-resident fibroblasts, which exhibit increased migratory potential and a capacity for both synthesizing and remodeling extracellular matrix components [17, 18]. Consequently, EMT plays a role in the pathological remodeling of the airway wall, leading to its thickening, an increase in smooth muscle bulk, and the development of fibrotic lesions [19]. However, the underlying molecular mechanisms have not been fully elucidated.
IL-36 cytokines belong to the IL-1 superfamily and comprise three receptor agonists, IL-36α, IL-36β, and IL-36γ, as well as a receptor antagonist, IL-36Ra. By binding to IL-36 receptor (IL-36R) and IL-1 receptor accessory proteins (IL-1RAcP), IL-36 agonists induce inflammation by recruiting MyD88 adaptor proteins and activating downstream signaling pathways including the NF-κB and MAPK pathways [20]. IL-36Ra, as an antagonist of IL-36R, exerts anti-inflammatory effects by binding to IL-36R, suppressing the recruitment of IL-1RAcP and preventing the initiation of a signalling response mediated by downstream signalling pathways [21].
IL-36 cytokines are highly expressed and play important roles in allergic diseases. Shen et al. reported that in patients with non-eosinophilic (non-Eos) chronic rhinosinusitis with nasal polyps (CRSwNP), the level of IL-36γ was increased and related to EMT [22]. Moreover, in mice with house dust mite (HDM)-induced asthma, IL-36 is also highly expressed in the lungs [23, 24]. Moreover, Chang et al. reported that IL-36γ can induce the expression of MUC5AC via the IL-36R-mediated ERK1/2 and p38/NF-κB pathways in human airway epithelial cells [25]. Nevertheless, the role of IL-36 in asthma, especially in airway remodelling, is unclear. NF-κB is a key regulator of inflammation [26], and STAT3 is an important transcription factor [16]; these factors have been demonstrated to be critical for airway remodelling in asthma.
In this study, in vitro, Beas-2B cells were used to explore the effects of IL-36 on EMT. In vivo, a chronic asthma mouse model was established to evaluate the potential involvement of IL-36 in asthma, especially in airway remodelling, and to explore the underlying mechanism.
Materials and methods
Cell culture
Human bronchial epithelial cells (BEAS-2B) were obtained (Procell, Wuhan, China) and were maintained in RPMI-1640 medium (Gibco, USA) containing 1% streptomycin/penicillin (Gibco, USA) and 10% fetal bovine serum (FBS) (Gibco, USA) in 5% CO2 at 37 °C. When the confluency of cells reaches 60%, the cells were stimulated by rhIL-36R agonist (IL-36 γ) (Cat: CM77, NovoProtein) for different times and IL-36Ra (Cat: CR60, NovoProtein).
Gene mRNA analysis
To analyze IL-36R and IL-1RAcP mRNA expression in BEAS-2B cells, total RNA of the cells was extracted and then reversely transcribed to cDNA. PCR was carried out using a PCR mixture, cDNA, and gene-specific primers. The resulting PCR products were resolved by 1% agarose gel electrophoresis. The primer sequences are presented in Table 1.
Table 1.
Sequence of primers for qRT-PCR
| Gene | Primer sequence (5′–3′) |
|---|---|
| Human-IL-36R | Forward CTGGACAAGCCGTGGCCAATGT |
| Reverse AGCCCAGCGATTCGGGGACC | |
| Human-IL-1RAcP | Forward TTGCAGCAAAGTTGCATTTC |
| Reverse CCAAACCTCATTGCGAGAAT | |
| GAPDH | Forward GAGTCAACGGATTTGGTCGT |
| Reverse GACAAGCTTCCCGTTCTCAG |
Protein isolation and western blotting
Cultured cells were washed by PBS. Cell proteins were isolated using an ice-cold RIPA lysis buffer, which was supplemented with cocktails of protease and phosphatase inhibitors, with the entire procedure carried out on ice. Protein concentrations were determined by a BCA protein quantitative kit. After electrophoresis, the samples were transferred to the polyvinylidene difluoride membrane. Membranes were blocked with 5% skim milk, followed by administration with primary antibodies fibronectin (Cat No: 66042-1, Proteintech, China), E-cadherin (Cat No: 60335-1, Proteintech, China), vimentin (Cat No: 5741 T, Cell signaling Company, USA), α-SMA (Cat No: 14395-1, Proteintech, China), p-STAT3(Cat No: 9145 T, Cell signaling Company, USA), t-STAT3(Cat No: 12640 T, Cell signaling Company, USA), p-NF-κB(Cat No: 3033 T, Cell signaling Company, USA), t-NF-κB(Cat No: 8242 T, Cell signaling Company, USA) and GAPDH (Cat No: GB11002, Servicebio, China) at 4 °C overnight. The following day, the PVDF membranes were rinsed with TBST and then incubated with second antibody (1:5000, Proteintech, China). ECL detection reagent (Transgen Biotech, China) was used for visualizing.
Immunofluorescence
The BEAS-2B cells were fixed and permeabilized, then blocked with 5% BSA. Cells were incubated with primary antibodies fibronectin (Cat No: 66042-1, Proteintech, China), E-cadherin (Cat No: 60335-1, Proteintech, China), vimentin (Cat No: 5741 T, Cell signaling Company, USA) and α-SMA (Cat No: 14395-1, Proteintech, China) at 4 °C overnight. The following day, the cells were added with anti-rabbit IgG labeled with Alexa Fluor 555 (Cat No: 4413S, Cell signaling Company, USA) for 1 h away from light, followed by staining of cell nucleus with DAPI. The cells were viewed using a fluorescence microscope.
Transwell assay and wound healing
A transwell assay and a wound healing assay were used to measure the migrated ability of cells. Cells were suspended in 100 μl serum-free medium and seeded in the upper chamber of transwell plate with a cell density of 5×104 cells/well. The lower chamber was filled with 600 μl of medium containing 10% FBS. The cells were cultured in 5% CO2 for 24 h with rhIL-36R agonist, rhIL-36Ra, and PBS in the lower chamber. After discarding the cells in upper chamber, the upper chambers were fixed by paraformaldehyde and stained with crystal violet. The cells were captured with a microscope at 100 × magnification after washing and drying. Five different parameters were calculated on per well to assess the number of migrated cells [27].
Horizontal lines were drawn on the back of the 6-well plate and 1 × 105 cells were inoculated for each group. After 24 h, three tracks perpendicular to the straight line were drawn on the bottom. After washing with PBS, serum-free medium was added. PBS and rhIL-36R agonist were added to the cells, respectively, and images were taken under 40╳optical microscope (0 and 24 h) [27].
Experimental model for HDM-induced chronic asthma
The Guangdong Yao kang Biotechnology (Guangdong, China) provided healthy female BALB/c mice. House dust mite (HDM) induction was accomplished using a modified protocol as previously described by our research team [16] and the protocol was shown in Fig. 4a. Mice were randomized into four groups in each group (n = 5): PBS group, HDM group, HDM + IL-36Ra group and HDM + IL-36Ra + IL-36R agonist group. Mice were given intranasal administration of 25 μg HDM (Geer, USA) in 25 μl PBS buffer solution 5 days/week for 5 weeks to establish a chronic asthma model. For intervention experiments, intranasal administration of rmIL-36Ra (1 μg/mouse/day, PeproTech) or IL 36R agonist (2 μg/mouse/day, NovoProtein) 1 h before HDM exposure was carried out from the third week onward. Meanwhile, the PBS group mice were given 25ul PBS buffer. 24 h after the last challenge, all mice were examined.
Fig. 4.
IL-36 contributes to airway inflammation and AHR in an asthma mouse model. a Diagram of the establishment of the chronic asthma model. b Representative images of H&E-stained lung tissue sections from each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×) (n = 3 random fields per group). c Inflammation scores of lung tissue sections from each group. d Airway resistance was determined with a FinePointe RC system. The data are presented as the means ± standard deviations (SDs) from three replicate experiments. * Represents a difference between any sample relative to the PBS group; # represents a difference between the indicated groups. *, #p < 0.05, **, ##p < 0.01, ***, ###p < 0.001
Assessment of airway hyper-responsiveness (AHR)
The AHR was determined 24 h after the last HDM challenge by intubating mice intratracheally and connecting them to an invasive ventilator after anesthesia with pentobarbital sodium. Then, mice were aerosolized with saline or different doses of methacholine for 3 min at each dose with 30 s intervals, recording and averaging their airway resistance values [28].
Cells analysis in bronchoalveolar lavage fluid (BALF)
BALF was obtained after euthanizing mice and centrifuged. The sediment was resuspended in 100 μl PBS and Giemsa (Beyotime, China) staining was used for counting the total cells and inflammatory cells through a microscope and a hemocytometer.
Lung histologic examination
The left lung tissues of mice were fixed with 4% paraformaldehyde and embedded in paraffin. The lung samples were cut into 5 μm-thick sections and stained with H&E, Masson and PAS. Images were visualized with a microscope. The airway inflammation score was quantified according to previously published methods [29].
Lung immunohistochemical analysis (IHC)
After permeabilizing and blocking, the sections were added with primary antibodies, including fibronectin (Cat No: 66042-1, Proteintech, China), E-cadherin (Cat No: 60335-1, ProteinTech, China), vimentin (Cat No: 5741 T, Cell signaling Company, USA), α-SMA (Cat No: 14395-1, Proteintech, China), MMP2 (Cat No: 10373-2-AP, ProteinTech, China) and MMP9 (Cat No: ab76003, Abcam, USA) overnight at 4 °C. On second day, secondary antibodies conjugated to HRP were added to the slides. At last, sections were stained with diaminobenzidine (DAB) and hematoxylin. The pictures were captured using a light microscope.
Flow cytometry
Lung tissue single-cell suspensions were prepared for flow cytometric analysis after tissue digestion and red blood cell lysis. To prevent nonspecific antibody binding, cells were incubated with an anti-CD16/32 antibody for 30 min to block Fc-gamma receptors. For the identification of neutrophils and eosinophils, cell suspensions were incubated with anti-mouse CD45 (clone: 30-F11, Biolegend), anti-mouse CD11b (clone: M1/70, Biolegend), anti-mouse CD11c (clone:N418, Biolegend), anti-mouse Ly6G (clone: RB6-8C5, Biolegend) and anti-mouse Siglec-F (clone: S17007L, Biolegend) for 30 min on ice. To assess cytokine production in T lymphocytes, cells were first stimulated with a Leukocyte Activation Cocktail for 4 h at 37 °C. Following stimulation, cell surface markers were labeled using anti-mouse CD3 (clone: 145-2c11, Biolegend) and anti-mouse CD4 (clone: RM4-5, Biolegend). Subsequently, the cells underwent fixation and permeabilization using a cytofix/cytoperm solution for 1 h at 4 °C, after which intracellular staining was performed with an anti-mouse IL-4 antibody(clone: 11B11, Biolegend) for 30 min under light-protected conditions. The gating strategy for specific populations was defined as: neutrophils (CD45⁺ CD11c⁻ CD11b⁺ Ly6G⁺), eosinophils (CD45⁺ Siglec-F⁺ CD11b⁺ CD11c⁻), and Th2 cells (CD3⁺ CD4⁺ IL-4⁺). The gating strategies are shown in Supplementary Fig. S5. Reactive cells were examined through a flow cytometer, and then analyzed with FlowJo software.
RNA isolation and real-time PCR
Total RNA was extracted from lung tissues and then converted into cDNA. Real-time quantitative PCR was performed using the Light Cycler 480 System and ChamQ SYBR Green PCR kit (Vazyme, China), and the relative mRNA levels were analyzed through the 2−ΔΔCt method. The primer sequences are presented in Table S1.
Statistical analysis
The data were reported as the average ± standard deviation (SD) and underwent analysis. Data analysis was conducted by GraghPad Prism 9.0. Differences among different groups were analyzed using Student's t test or one-way ANOVA analysis. In every instance, values of p < 0.05 were considered statistically significant.
Results
IL-36R agonist can induce bronchial epithelial cell EMT and migration
EMT is a process that involves the loss of epithelial polarity and intercellular connections, resulting in the acquisition of a mesenchymal-like phenotype. An increase in EMT can decrease the regenerative capacity of the epithelial barrier, thereby promoting airway remodeling [30]. EMT has been verified to be the crucial step involved in airway remodelling in chronic asthma [31]. In our preliminary study, we confirmed that IL-36gamma is upregulated in the lung tissue of chronic asthma model mice. In this study, we demonstrated that the mRNA level of IL-36α was also elevated in the lung tissue of chronic asthma model mice compared with that of PBS-treated mice (Supplementary Fig. S1). Notably, IL-36β was not expressed in either group of mice. To investigate whether IL-36 can induce the EMT process, we verified that BEAS-2B cells express two receptors, IL-36R and IL-1RAcP on their surface (Supplementary Fig. S2). Then, we exposed BEAS-2B cells to recombinant human IL-36R agonist and measured the expression of EMT markers. The results indicated that IL-36R agonist markedly increased the levels of the mesenchymal biomarkers fibronectin, vimentin, α-SMA and decreased the level of E-cadherin in BEAS-2B cells in a concentration-dependent (Fig. 1a, c) and time-dependent (Fig. 1b, d) manner. The trend in the immunofluorescence staining results was similar to that in the Western blotting results (Fig. 2a). The cell migration capacity was also significantly greater in the IL-36R agonist-stimulated group than in the PBS group (Fig. 2b, c). Pretreatment of IL-36Ra can reverse this trend (Supplementary Fig. S3a, b and c). Therefore, the above results indicate that IL-36 can induce EMT and cell migration in BEAS-2B cells, which may be key elements facilitating airway remodelling.
Fig. 1.
IL-36-induced EMT in BEAS-2B cells tested by western blot. a Western blot images of fibronectin, E-cadherin, vimentin and α-SMA levels in BEAS-2B cells stimulated with IL-36R agonist at concentrations of 0, 25, 50, 100, and 200 ng/ml for 48 h. b Western blot images of fibronectin, E-cadherin, vimentin and α-SMA levels in BEAS-2B cells stimulated with IL-36R agonist (100 ng/ml) for different durations (0–72 h). c, d Quantification of each protein normalized to GAPDH. The data are presented as the means ± standard deviations (SDs) from three replicate experiments. *vs. the control group, *p < 0.05 **p < 0.01, ***p < 0.001, ns, not significant
Fig. 2.
IL-36 induced EMT tested by immunofluorescence and cell migration in BEAS-2B cells. a Immunofluorescence images of fibronectin, E-cadherin, vimentin, and α-SMA in BEAS-2B cells treated with or without IL-36R agonist (scale bar = 50 μm, 200 ×). b Cell migration was tested through a transwell assay (scale bar = 100 μm, 100 ×), and c wound healing (scale bar = 50 μm, 40 ×). The data are presented as the means ± standard deviations (SDs) from three replicate experiments. *vs. the control group, ***p < 0.001
In addition, we evaluated the effects of stimulation with IL-36R agonist on the STAT3 and NF-κB signalling pathways. The results revealed that activated IL-36 can promote the phosphorylation of STAT3 and NF-κB in BEAS-2B cells (Fig. 3a, b and c). These results suggested that IL-36 induces the EMT process likely through the STAT3 and NF-κB signalling pathways.
Fig. 3.
IL-36 can activate the STAT3 and NF-κB pathways. a Phosphorylation of the STAT3 and NF-κB signalling pathways stimulated by IL-36R agonist in BEAS-2B cells was analysed by western blotting. b, c Quantification of each phosphorylated protein normalized to GAPDH. The data are presented as the means ± standard deviations (SDs) from three replicate experiments. *vs. the control group, *p < 0.05 **p < 0.01, ***p < 0.001
IL-36 contributes to inflammation and AHR in the airway of chronic asthmatic mice
To better understand the role of IL-36 in chronic asthma, an asthma mouse model was established by continuous HDM challenge for 5 weeks (Fig. 4a). Blockade of IL-36R markedly suppressed the infiltration of inflammatory cells and the inflammation score in the lungs of asthmatic mice (Fig. 4b, c), and AHR was also markedly attenuated (Fig. 4d).
Moreover, blocking IL-36R resulted in a reduction in the number of inflammatory cells, including eosinophils, neutrophils, macrophages, and lymphocytes, in the bronchoalveolar lavage fluid (BALF) of asthmatic mice (Fig. 5a and Supplementary Fig. S4). We also evaluated the number of inflammatory cells in the lungs of each group of mice through flow cytometry. The numbers of eosinophils, neutrophils (Fig. 5b) and Th2 lymphocytes showed trends similar to those in the previous analysis (Fig. 5c). More importantly, the coadministration of IL-36R agonist with IL-36Ra partly restored HDM-induced inflammatory cell infiltration around the airway and AHR. Interestingly, we found that IL-36R agonist restored the number of neutrophils but had no effect on the number of eosinophils or lymphocytes. These findings suggested that IL-36 may contribute to the regulation of neutrophil-related inflammation in asthma. Collectively, these data suggested that IL-36 signalling may play an important role in airway inflammation in asthmatic mice.
Fig. 5.
Effect of IL-36 on inflammatory cells in the airway and lung tissues of chronic asthma model mice. a Number of total and inflammatory cells in the BALF was tested through Giemsa staining. b Flow cytometric analysis of inflammatory eosinophils (CD45 + SiglecF + CD11b + CD11c-), neutrophils (CD45 + Ly6G + CD11b + CD11c-) and c Th2 lymphocytes (CD4 + IL-4 +) in the lung tissues of each group was performed. The data are presented as the means ± standard deviations (SDs) from three replicate experiments. * Represents a difference between any sample relative to the PBS group; # represents a difference between the indicated groups. **, ##p < 0.01, ***, ###p < 0.001; ns, not significant
IL-36 promotes airway remodelling in chronic asthma model mice
To assess the effect of IL-36 on airway remodelling, we analysed the relevant parameters of airway remodelling by histopathological examination. Masson’s trichrome and PAS staining revealed significant collagen accumulation surrounding the bronchioles (Fig. 6a, c) and notable proliferation of goblet cells (Fig. 6b, d) in asthmatic mice, and these effects were significantly attenuated after IL-36Ra treatment.
Fig. 6.
IL-36 promoted collagen deposition and goblet cell hyperplasia in the lung tissues of asthmatic mice. a, b Representative images of Masson staining and PAS staining of lung tissue sections from each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×) (n = 3 random fields per group). c, d Quantification of Masson staining and PAS staining of lung tissue sections from each group. The data are presented as the means ± standard deviations from three replicate experiments. * Represents a difference between any sample relative to the PBS group; # represents a difference between the indicated groups. *, #p < 0.05, **, ##p < 0.01, ***, ###p < 0.001
Moreover, through immunohistochemistry, we found that the levels of matrix metalloproteinase 2 (MMP2) (Fig. 7a, c) and MMP9 (Fig. 7b, d), which are closely linked to EMT during airway remodelling, were markedly increased in the lungs. However, in the IL-36Ra + HDM group, these pulmonary pathological symptoms were obviously alleviated. IL-36R agonist coadministration with IL-36Ra partly reversed these HDM-induced pathological changes.
Fig. 7.
IL-36 promoted the expression of MMP2 and MMP9 in the lungs of asthmatic mice. a, b Representative images of MMP2 and MMP9 immunohistochemical staining of lung tissue sections from each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×) (n = 3 random fields per group). c, d Quantification of MMP2 and MMP9 immunohistochemical results in lung tissue sections from each group. The data are presented as the means ± standard deviations (SDs) from three replicate experiments. * Represents a difference between any sample relative to the PBS group; # represents a difference between the indicated groups. *, #p < 0.05, **, ##p < 0.01, ***, ###p < 0.001
Collectively, the results of these experiments strongly suggested that IL-36 is involved in the process of airway remodelling in chronic asthma.
IL-36 participates in the EMT process in the lung tissues of asthma model mice
To determine whether EMT induced by IL-36 contributes to airway remodelling in the HDM-induced asthma model, we analyzed the levels of EMT biomarkers in the lung tissues of each group. Immunohistochemistry analysis revealed that, in asthmatic mice, the levels of fibronectin (Fig. 8a, e), vimentin (Fig. 8c, g) and α-SMA (Fig. 8d, h) were significantly increased, and the level of E-cadherin decreased (Fig. 8b, f). After treatment with IL-36Ra, the effects on the expression of these four EMT biomarkers were markedly attenuated.
Fig. 8.
IL-36 increased the expression of EMT biomarkers in the lung tissues of chronic asthma model mice. a Representative images of fibronectin immunohistochemical staining in the lungs of each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×). b Representative images of E-cadherin immunohistochemical staining in the lungs of each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×). c Representative images of vimentin immunohistochemical staining in the lungs of each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×). d Representative images of α-SMA immunohistochemical staining of the lungs from each group (scale bar = 50 μm for 200 ×; scale bar = 50 μm for 630 ×) (n = 3 random fields per group). e–h Quantification of the expression of fibronectin, E-cadherin, vimentin and α-SMA. The data are presented as the means ± standard deviations (SDs) from three replicate experiments. * Represents a difference between any sample relative to the PBS group; # represents a difference between the indicated groups. *, #p < 0.05, **, ##p < 0.01, ***, ###p < 0.001; ns, not significant
Compared with treatment with IL-36Ra alone, coadministration of IL-36R agonist with IL-36Ra partly restored the expression of EMT biomarkers. Overall, the above findings suggested that IL-36 signalling may participate in airway remodelling in asthma, at least in part by inducing EMT.
Discussion
Airway remodelling is the general term for the structural changes that occur in asthmatic airways. It is the pathological basis of persistent airflow limitation and progressive lung function decline, and it is also the main pathogenesis mechanism of severe asthma [32, 33]. Epithelial damage and deficiency are associated with EMT, which is considered to play a significant role in asthma and is a main cause of fixed airflow limitation during asthma exacerbation [34]. EMT is closely associated with airway remodelling, and inhibiting the EMT process can ameliorate airway remodelling in severe asthma [35, 36]. Therefore, finding new strategies to regulate the process of EMT is very important for severe asthma patients.
In the present study, we found that in vitro, IL-36R agonist can promote EMT and cell migration in the bronchial epithelium. Moreover, IL-36R agonist can also induce the activation of the STAT3 and NF-κB signalling pathways. In vivo, inhibiting IL-36R not only ameliorated inflammation and AHR but also attenuated airway remodelling in chronic asthma model mice by inhibiting EMT. IL-36R agonist and IL-36Ra coadministration counteracted the protective effect of blocking IL-36R on all of the above pathomorphological changes.
IL‐36 has been found to play a significant role in many inflammatory diseases, such as colon inflammation diseases and psoriasis. Yang et al. reported that IL-36R ligands promote the expression of cell‐matrix adhesion network genes in the colon epithelium during colitis [37]. Todorović et al. reported that IL-36γ can induce morphological changes consistent with psoriasis in a 3D skin-equivalent model and that IL-36Ra can attenuate the phenotype induced by IL-36γ [38]. Moreover, the effects of IL-36 on respiratory diseases have also been confirmed. For example, Kovach and Baker confirmed that, compared with those in healthy controls, the concentrations of IL-36γ and IL-36α in the BALF of chronic obstructive pulmonary disease (COPD) patients were markedly elevated, and the production of chemokines and cytokines by pulmonary macrophages was increased after IL-36γ stimulation [39, 40]. IL-36γ and IL-36α are also upregulated in the airspace and plasma of patients with P. aeruginosa-induced acute respiratory distress syndrome, and mortality is significantly lower than that of WT mice after P. aeruginosa challenge in IL-36γ-deficient (IL-36γ-/-) mice [41]. However, the function of IL‐36 in asthma, especially in airway remodelling, is still largely unknown.
Prior studies by our team have shown that continuous instillation of IL-36γ into mouse airways can activate lung fibroblasts around the airways [24]. The results of the present study indicated that, in vitro, IL-36R agonist increased the expression of fibronectin, vimentin, α-SMA and decreased the level of E-cadherin in BEAS-2B cells. Moreover, it promoted the migration of cells. These data revealed that IL-36 plays a key role in the EMT process. Hence, we speculated that IL-36 may contribute to airway remodelling through the induction of EMT. To verify this hypothesis, we established a chronic asthma mouse model by continuous HDM exposure for 5 weeks, which can better simulate the features of real-life allergic asthma. We detected that blocking IL-36R can suppress peribronchial collagen deposition and inhibit airway goblet cell hyperplasia. The expression of MMP2 and MMP9 was also downregulated after IL-36R blockade. More importantly, the expression of EMT biomarkers, including fibronectin, vimentin and α-SMA, increased, and the expression of E-cadherin decreased in the HDM group; these changes were reversed in the IL-36Ra-treated group. IL-36R agonist coadministration with IL-36Ra markedly reversed the HDM-induced the structural alterations described above. These in vivo results suggested that IL-36 can contribute to airway remodelling in chronic asthma, at least by inducing the EMT process. Taken together, these findings suggested that IL-36 may be a promising therapeutic target for protecting against airway remodelling.
In addition to regulating the classical NF-kB signalling pathway, IL-36 also regulated the STAT3 signalling pathway in BEAS‐2B cells. NF-κB and STAT3 inhibition have been shown to be closely related to EMT in airway remodeling [16, 42, 43]. In this study, we showed that IL-36R agonist can significantly facilitate the phosphorylation of NF-κB and STAT3, indicating that IL-36 may promote EMT in the context of airway remodelling through the NF-κB and STAT3 pathways.
Interestingly, we found that coadministration of IL-36Ra with sufficient IL-36R agonist partially restored the pathological characteristics of airway inflammation and remodelling in asthmatic mice compared with those in the group treated with IL-36Ra alone. Therefore, we speculated that other cytokines may activate IL-36R and contribute to airway remodelling and inflammation in chronic asthma, which needs further exploration.
Moreover, blocking IL-36R can decrease the number of inflammatory cells, including eosinophils, neutrophils, macrophages and lymphocytes in the BALF. IL-36R agonist cotreatment with IL-36Ra restored the number of neutrophils in the BALF but had no influence on the number of eosinophils or lymphocytes. This finding was similar to the results detected in lung tissues by flow cytometric analyses. These results may indicate that high expression of IL-36 in the lungs of asthmatic mice can regulate neutrophilic inflammation but has no effect on eosinophilic inflammation, which is consistent with the findings of a previous study [23]. However, whether the effect of IL-36 on inflammatory cells is associated with EMT remains to be investigated. In the future, this will also constitute a crucial research plan for our team.
There are some limitations that are worthy of further study. First, we assessed the process of EMT induced by IL-36 only in airway epithelial cells, and we need to use other cell lines to verify the results. Second, we tested that IL-36 can facilitate the phosphorylation of NF-κB and STAT3 the pathway and speculate that IL-36 may promote EMT through the NF-κB and STAT3 pathways. However, we did not use inhibitors of NF-κB and STAT3 to verify the results and this will be performed in our future study. At last, gene knockout mice need to be performed to study the role of IL-36 in airway remodelling, and more clinical data need to be collected and analysed to validate the experimental results.
Conclusion
In summary, we evaluated the effects of IL-36 on bronchial epithelial cells and chronic asthma in mice. These results verified that in vitro, IL-36 can induce the EMT process. In vivo, highly expressed IL-36 cytokines in asthmatic mice can contribute to airway remodelling by inducing the EMT process. IL-36 may be a possible therapeutic intervention for airway remodelling in chronic asthma.
Supplementary Information
Supplementary material 1: SF 1. The RNA level of IL-36R agonists in the lung tissues of asthma mice. a RNA level of IL-36γ in the lung tissues of asthma mice. b RNA level of IL-36α in the lung tissues of asthma mice. The data are presented as the means ± standard deviations. * represent a difference between any sample relative to the PBS group; *** p < 0.001.
Supplementary material 2: SF 2. The expression of IL-36R and IL-1RAcP in BEAS-2B cells determined by agarose gel electrophoresis.
Supplementary material 3: SF 3. IL-36Ra inhibited EMT and cell migration induced by IL-36 in BEAS-2B cells. a Western blot analysis of fibronectin, E-cadherin, vimentin, and alpha-smooth muscle actinin BEAS-2B cells stimulated with 100 ng/ml IL-36R agonist for 48 h in the presence or absence of IL-36Ra. b, c Number of migrated cells was analyzed by transwell assay. Data are presented as the mean ± standarddeviation from three replicate experiments. *vs. the control group, # vs. IL-36R agonist group, **, ## p < 0.01, ***, ### p < 0.001.
Supplementary material 4: SF 4.The representative image about BALF Giemsa staining for each group of mice.
Supplementary material 5: SF 5. The gating strategies of flow cytometry. a Gating strategies of eosinophils and neutrophils. b Gating strategies of Th2 lymphocytes.
Acknowledgements
We express our sincere gratitude to Tianyun Lan (Central Laboratory, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China) for her help with conducting flow cytometry analysis.
Abbreviations
- AHR
Airway hyper-responsiveness
- BALF
Bronchoalveolar lavage fluid
- DAPI
4,6-Diamidino-2-phenylindole
- EMT
Epithelial–mesenchymal transition
- HDM
House dust mite
- MMP
Matrix metalloproteinase
Author contributions
Project administration, T.Z.; Conceptualization, M.Z. and T.Z.; methodology, M.Z., J.C. and W.G.; Investigation, M.Z., J.C. and K.F.; Data curation, M.Z., J.C., W.G., H.L. and T.Z.; Formal analysis, M.Z., J.C., H.Y., X.Z. and T.Z.; Validation, T.Z. and H.L.; Writing—original draft preparation, M.Z.; Writing—review and editing, T.Z.; Funding acquisition, T.Z. and H.L.
Funding
National Natural Science Foundation of China (Grant Nos. 82470026, 82370034).
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
The research was authorized by the Ethics Committee of the Third Affiliated Hospital of Sun Yat-Sen University. The animal experiment was complied with the ARRIVE guidelines.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Min Zhang and Jiemei Cen have contributed equally to this work.
Contributor Information
Hongtao Li, Email: lht791@163.com.
Tiantuo Zhang, Email: zhtituli@163.com.
References
- 1.Hammad H, Lambrecht BN. The basic immunology of asthma. Cell. 2021;184(6):1469–85. 10.1016/j.cell.2021.04.019. [DOI] [PubMed] [Google Scholar]
- 2.GBD 2017 Disease and Injury Incidence and Prevalence Collaborators. Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392(10159):1789–858. 10.1016/S0140-6736(18)32279-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cho JY. Recent advances in mechanisms and treatments of airway remodeling in asthma: a message from the bench side to the clinic. Korean J Intern Med. 2011;26(4):367–83. 10.3904/kjim.2011.26.4.367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Pepe C, Foley S, Shannon J, Lemiere C, Olivenstein R, Ernst P, et al. Differences in airway remodeling between subjects with severe and moderate asthma. J Allergy Clin Immunol. 2005;116(3):544–9. 10.1016/j.jaci.2005.06.011. [DOI] [PubMed] [Google Scholar]
- 5.Kaminska M, Foley S, Maghni K, Storness-Bliss C, Coxson H, Ghezzo H, et al. Airway remodeling in subjects with severe asthma with or without chronic persistent airflow obstruction. J Allergy Clin Immunol. 2009;124(1):45–51. 10.1016/j.jaci.2009.03.049. [DOI] [PubMed] [Google Scholar]
- 6.Hough KP, Curtiss ML, Blain TJ, Liu RM, Trevor J, Deshane JS, et al. Airway remodeling in asthma. Front Med Lausanne. 2020;7:191. 10.3389/fmed.2020.00191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Varricchi G, Ferri S, Pepys J, Poto R, Spadaro G, Nappi E, et al. Biologics and airway remodeling in severe asthma. Allergy. 2022;77(12):3538–52. 10.1111/all.15473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang N, Xu J, Jiang C, Lu S. Neuro-immune regulation in inflammation and airway remodeling of allergic asthma. Front Immunol. 2022;13:894047. 10.3389/fimmu.2022.894047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Camoretti-Mercado B, Lockey RF. Airway smooth muscle pathophysiology in asthma. J Allergy Clin Immunol. 2021;147(6):1983–95. 10.1016/j.jaci.2021.03.035. [DOI] [PubMed] [Google Scholar]
- 10.Hsieh A, Assadinia N, Hackett TL. Airway remodeling heterogeneity in asthma and its relationship to disease outcomes. Front Physiol. 2023;14:1113100. 10.3389/fphys.2023.1113100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Xu T, Wu Z, Yuan Q, Zhang X, Liu Y, Wu C, et al. Proline is increased in allergic asthma and promotes airway remodeling. JCI Insight. 2023;8(16):e167395. 10.1172/jci.insight.167395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Miller RL, et al. Advances in asthma: new understandings of asthma’s natural history, risk factors, underlying mechanisms, and clinical management. J Allergy Clin Immunol. 2021;148(6):1430–41. 10.1016/j.jaci.2021.10.001. [DOI] [PubMed] [Google Scholar]
- 13.Schoettler N, Strek ME. Recent advances in severe asthma: from phenotypes to personalized medicine. Chest. 2020;157(3):516–28. 10.1016/j.chest.2019.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Shi N, Zhang J, Chen SY. DOCK2 promotes asthma development by eliciting airway epithelial-mesenchymal transition. Am J Respir Cell Mol Biol. 2023;69(3):310–20. 10.1165/rcmb.2022-0273OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhou Y, Huang X, Yu H, Shi H, Chen M, Song J, et al. TMT-based quantitative proteomics revealed protective efficacy of Icariside II against airway inflammation and remodeling via inhibiting LAMP2, CTSD and CTSS expression in OVA-induced chronic asthma mice. Phytomedicine. 2023;118:154941. 10.1016/j.phymed.2023.154941. [DOI] [PubMed] [Google Scholar]
- 16.Feng KN, Meng P, Zou XL, Zhang M, Li HK, Yang HL, et al. IL-37 protects against airway remodeling by reversing bronchial epithelial-mesenchymal transition via IL-24 signaling pathway in chronic asthma. Respir Res. 2022;23(1):244. 10.1186/s12931-022-02167-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Banno A, Reddy AT, Lakshmi SP, Reddy RC. Bidirectional interaction of airway epithelial remodeling and inflammation in asthma. Clin Sci (Lond). 2020;134(9):1063–79. 10.1042/CS20191309. [DOI] [PubMed] [Google Scholar]
- 18.Hackett TL. Epithelial-mesenchymal transition in the pathophysiology of airway remodelling in asthma. Curr Opin Allergy Clin Immunol. 2012;12(1):53–9. 10.1097/ACI.0b013e32834ec6eb. [DOI] [PubMed] [Google Scholar]
- 19.Pain M, Bermudez O, Lacoste P, Royer PJ, Botturi K, Tissot A, et al. Tissue remodelling in chronic bronchial diseases: from the epithelial to mesenchymal phenotype. Eur Respir Rev. 2014;23(131):118–30. 10.1183/09059180.00004413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Bassoy EY, Towne JE, Gabay C. Regulation and function of interleukin-36 cytokines. Immunol Rev. 2018;281(1):169–78. 10.1111/imr.12610. [DOI] [PubMed] [Google Scholar]
- 21.Elias M, Zhao S, Le HT, Wang J, Neurath MF, Neufert C, et al. IL-36 in chronic inflammation and fibrosis - bridging the gap? J Clin Invest. 2021;131(2):e144336. 10.1172/JCI144336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Shen LF, Chen HH, Guo Y. The role of interleukin 36γ in the epithelial-mesenchymal transition process of chronic rhinosinusitis: a pilot study. Clin Otolaryngol. 2023;48(2):347–55. 10.1111/coa.13993. [DOI] [PubMed] [Google Scholar]
- 23.Ramadas RA, Ewart SL, Medoff BD, LeVine AM. Interleukin-1 family member 9 stimulates chemokine production and neutrophil influx in mouse lungs. Am J Respir Cell Mol Biol. 2011;44(2):134–45. 10.1165/rcmb.2009-0315OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhang M, Zhou JX, Huang CQ, Feng KN, Zou XL, Cen JM, et al. IL-38 alleviates airway remodeling in chronic asthma via blocking the profibrotic effect of IL-36γ. Clin Exp Immunol. 2023. 10.1093/cei/uxad099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bae CH, Choi YS, Na HG, Song SY, Kim YD. Interleukin (IL) 36 gamma induces mucin 5AC, oligomeric mucus/gel-forming expression via IL-36 receptor-extracellular signal regulated kinase 1 and 2, and p38-nuclear factor kappa-light-chain-enhancer of activated B cells in human airway epithelial cells. Am J Rhinol Allergy. 2018;32(2):87–93. 10.1177/1945892418762844. [DOI] [PubMed] [Google Scholar]
- 26.Meng P, Chen ZG, Zhang TT, Liang ZZ, Zou XL, Yang HL, et al. IL-37 alleviates house dust mite-induced chronic allergic asthma by targeting TSLP through the NF-κB and ERK1/2 signaling pathways. Immunol Cell Biol. 2019;97(4):403–15. 10.1111/imcb.12223. [DOI] [PubMed] [Google Scholar]
- 27.He H, Cao L, Wang Z, Wang Z, Miao J, Li XM. Sinomenine relieves airway remodeling by inhibiting epithelial-mesenchymal transition through downregulating TGF-β1 and Smad3 expression in vitro and in vivo. Front Immunol. 2021;12:736479. 10.3389/fimmu.2021.736479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Feng KN, Meng P, Zhang M, Zou XL, Li S, Huang CQ, et al. IL-24 contributes to neutrophilic asthma in an IL-17A-dependent manner and is suppressed by IL-37. Allergy Asthma Immunol Res. 2022;14(5):505–27. 10.4168/aair.2022.14.5.505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chen J, Zhou H, Wang J, Zhang B, Liu F, Huang J, et al. Therapeutic effects of resveratrol in a mouse model of HDM-induced allergic asthma. Int Immunopharmacol. 2015;25(1):43–8. 10.1016/j.intimp.2015.01.013. [DOI] [PubMed] [Google Scholar]
- 30.Moheimani F, Roth HM, Cross J, Reid AT, Shaheen F, Warner SM, et al. Disruption of β-catenin/CBP signaling inhibits human airway epithelial–mesenchymal transition and repair. Int J Biochem Cell Biol. 2015;68:59–69. 10.1016/j.biocel.2015.08.014. [DOI] [PubMed] [Google Scholar]
- 31.Song Y, Wang Z, Jiang J, Piao Y, Li L, Xu C, Piao H, Li L, Yan G. DEK-targeting aptamer DTA-64 attenuates bronchial EMT-mediated airway remodeling by suppressing TGF-β1/Smad, MAPK and PI3K signaling pathway in asthma. J Cell Mol Med. 2020;24(23):13739-13750. 10.1111/jcmm.15942. Epub 2020 Oct 30. Erratum in: J Cell Mol Med. 2022;26(15):4388. 10.1111/jcmm.17487. [DOI] [PMC free article] [PubMed]
- 32.Chung KF, Wenzel SE, Brozek JL, Bush A, Castro M, Sterk PJ, Adcock IM, Bateman ED, Bel EH, Bleecker ER, Boulet LP, Brightling C, Chanez P, Dahlen SE, Djukanovic R, Frey U, Gaga M, Gibson P, Hamid Q, Jajour NN, Mauad T, Sorkness RL, Teague WG. International ERS/ATS guidelines on definition, evaluation and treatment of severe asthma. Eur Respir J. 2014 Feb;43(2):343-73. 10.1183/09031936.00202013. Epub 2013 Dec 12. Erratum in: Eur Respir J. 2014 Apr;43(4):1216. Dosage error in article text. Erratum in: Eur Respir J. 2018 Jul 27;52(1):1352020. 10.1183/13993003.52020-2013. Erratum in: Eur Respir J. 2022 Jun 9;59(6):1362020. 10.1183/13993003.62020-2013.
- 33.Samitas K, Carter A, Kariyawasam HH, Xanthou G. Upper and lower airway remodeling mechanisms in asthma, allergic rhinitis and chronic rhinosinusitis: the one airway concept revisited. Allergy. 2018;73(5):993–1002. 10.1111/all.13373. [DOI] [PubMed] [Google Scholar]
- 34.Peng H, Sun F, Jiang Y, Guo Z, Liu X, Zuo A, et al. Semaphorin 7a aggravates TGF-β1-induced airway EMT through the FAK/ERK1/2 signaling pathway in asthma. Front Immunol. 2023;14:1167605. 10.3389/fimmu.2023.1167605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Heijink IH, Postma DS, Noordhoek JA, Broekema M, Kapus A. House dust mite-promoted epithelial-to-mesenchymal transition in human bronchial epithelium. Am J Respir Cell Mol Biol. 2010;42(1):69–79. 10.1165/rcmb.2008-0449OC. [DOI] [PubMed] [Google Scholar]
- 36.Pu Y, Liu Y, Liao S, Miao S, Zhou L, Wan L. Azithromycin ameliorates OVA-induced airway remodeling in Balb/c mice via suppression of epithelial-to-mesenchymal transition. Int Immunopharmacol. 2018;58:87–93. 10.1016/j.intimp.2018.03.016. [DOI] [PubMed] [Google Scholar]
- 37.Yang W, Dong HP, Wang P, Xu ZG, Xian J, Chen J. IL-36γ and IL-36Ra reciprocally regulate colon inflammation and tumorigenesis by modulating the cell-matrix adhesion network and Wnt signaling. Adv Sci. 2022;9(10):e2103035. 10.1002/advs.202103035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Todorović V, Su Z, Putman CB, Kakavas SJ, Salte KM, McDonald HA, et al. Small molecule IL-36γ antagonist as a novel therapeutic approach for plaque psoriasis. Sci Rep. 2019;9(1):9089. 10.1038/s41598-019-45626-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kovach MA, Che K, Brundin B, Andersson A, Asgeirsdottir H, Padra M, et al. IL-36 cytokines promote inflammation in the lungs of long-term smokers. Am J Respir Cell Mol Biol. 2021;64(2):173–82. 10.1165/rcmb.2020-0035OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Baker JR, Fenwick PS, Koss CK, Owles HB, Elkin SL, Fine J, et al. IL-36 receptor agonist and antagonist imbalance drives neutrophilic inflammation in COPD. JCI Insight. 2022;7(15):e155581. 10.1172/jci.insight.155581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Aoyagi T, Newstead MW, Zeng X, Nanjo Y, Peters-Golden M, Kaku M, et al. Interleukin-36γ and IL-36 receptor signaling mediate impaired host immunity and lung injury in cytotoxic Pseudomonas aeruginosa pulmonary infection: role of prostaglandin E2. PLoS Pathog. 2017;13(11):e1006737. 10.1371/journal.ppat.1006737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Huang N, Liu K, Liu J, Gao X, Zeng Z, Zhang Y, et al. Interleukin-37 alleviates airway inflammation and remodeling in asthma via inhibiting the activation of NF-κB and STAT3 signalings. Int Immunopharmacol. 2018;55:198–204. 10.1016/j.intimp.2017.12.010. [DOI] [PubMed] [Google Scholar]
- 43.Zhang C, Zhu X, Hua Y, Zhao Q, Wang K, Zhen L, et al. YY1 mediates TGF-β1-induced EMT and pro-fibrogenesis in alveolar epithelial cells. Respir Res. 2019;20(1):249. 10.1186/s12931-019-1223-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary material 1: SF 1. The RNA level of IL-36R agonists in the lung tissues of asthma mice. a RNA level of IL-36γ in the lung tissues of asthma mice. b RNA level of IL-36α in the lung tissues of asthma mice. The data are presented as the means ± standard deviations. * represent a difference between any sample relative to the PBS group; *** p < 0.001.
Supplementary material 2: SF 2. The expression of IL-36R and IL-1RAcP in BEAS-2B cells determined by agarose gel electrophoresis.
Supplementary material 3: SF 3. IL-36Ra inhibited EMT and cell migration induced by IL-36 in BEAS-2B cells. a Western blot analysis of fibronectin, E-cadherin, vimentin, and alpha-smooth muscle actinin BEAS-2B cells stimulated with 100 ng/ml IL-36R agonist for 48 h in the presence or absence of IL-36Ra. b, c Number of migrated cells was analyzed by transwell assay. Data are presented as the mean ± standarddeviation from three replicate experiments. *vs. the control group, # vs. IL-36R agonist group, **, ## p < 0.01, ***, ### p < 0.001.
Supplementary material 4: SF 4.The representative image about BALF Giemsa staining for each group of mice.
Supplementary material 5: SF 5. The gating strategies of flow cytometry. a Gating strategies of eosinophils and neutrophils. b Gating strategies of Th2 lymphocytes.
Data Availability Statement
No datasets were generated or analysed during the current study.








