A Novel Homozygous Nonsense Pathogenic Variant of the CPAMD8 Gene Associated With Congenital Microcoria

ABSTRACT

Congenital microcoria (MCOR) is a rare inherited ocular disorder. Here, we describe a novel nonsense variant in the CPAMD8 gene in a patient with MCOR. We conducted a comprehensive clinical examination of a patient diagnosed with MCOR and performed whole‐exome sequencing to identify potential pathogenic variants. Additionally, bioinformatics prediction tools were employed to assess the impact of the identified variant on protein structure and function. The patient presented with hallmark features of MCOR, such as bilaterally constricted pupils and a poor response to mydriatic agents. A novel homozygous nonsense variant, c.2679C>G (p.Tyr893*), was identified in the CPAMD8 gene. Protein modeling revealed that the variant results in complete truncation of the C‐terminal domain of CPAMD8, disrupting its functional domains and potentially affecting its biological activity. Furthermore, electrostatic potential energy analysis demonstrated increased surface asymmetry of the protein, suggesting that the variant may interfere with protein–molecule interactions. Previous studies have suggested a strong association between MCOR and deletions in the 13q32.1 region of chromosome 13; however, the specific pathogenic genes involved have remained unclear. In this study, we show that the nonsense variant c.2679C>G (p.Tyr893*) in CPAMD8 is associated with MCOR, providing new insights into the genetic basis of the disease.

A novel CPAMD8 nonsense mutation c.2679C>G (p.Tyr893*) was identified in a patient with congenital microcoria, leading to reduced mRNA expression and predicted protein truncation.

1. Introduction

Congenital microcoria (MCOR) (MIM 156600) is a rare autosomal dominant genetic disorder characterized by a pupil diameter of less than 2 mm, with little or no response to mydriatic drugs [1]. MCOR is commonly associated with ocular conditions such as juvenile‐onset glaucoma, axial myopia, and astigmatism, which may further lead to visual dysfunction or blindness [2]. To date, the pathogenesis of MCOR is still unclear and may involve genetic factors, the absence or incomplete development of the dilator pupillae muscle, and abnormalities in neuroregulatory function [3].

In the late 1990s, researchers conducted a whole‐genome linkage analysis on a five‐generation family with MCOR, mapping the disease locus to the chromosome 13q31‐32 region [4]. Subsequent studies of six MCOR‐affected families from France, Japan, and Mexico revealed deletions of varying sizes in the 13q32.1 region, potentially involving the GPR180 and TGDS genes [5]. However, the specific pathogenic variant associated with MCOR remains unidentified.

Recently, molecular biology has made remarkable progress in the exploration of disease‐related genes for Mendelian disorders. Whole‐exome sequencing (WES) has proven to be a powerful tool for the identification of single‐gene diseases, enabling the efficient discovery of potential pathogenic genes [6]. In this study, WES was performed in patients with MCOR to identify potential pathogenic genes.

2. Materials and Methods

2.1. Subjects and Clinical Investigation

A patient with MCOR from the Department of Ophthalmology of the First Hospital of Harbin Medical University was recruited for this study (Figure 1A). The patient was unmarried and raised by adoptive parents, and information regarding the biological parents of the patient could not be obtained. To ensure the accuracy of the study, a detailed clinical history and comprehensive ophthalmic examinations, including visual acuity, slit‐lamp biomicroscopy, intraocular pressure (IOP), optometry, corneal endothelial microscopy, ultrasound biomicroscopy (UBM), IOLMaster measurements, and optical coherence tomography (OCT), were conducted on the participant. The study adhered to the Declaration of Helsinki and was approved by the Ethics Committee of the First Affiliated Hospital of Harbin Medical University. Written informed consent was obtained from the study participant.

FIGURE 1.

(A) Pedigree of the patient. (B) Slit‐lamp photographs of the anterior segments: B1—right eye; B2—left eye. Both eyes present constricted pupils. (C) UBM images of the anterior segment structures. (D) Intraoperative images during cataract surgery in the left eye: D1—preoperative view demonstrating a persistently small pupil; D2—intraoperative use of iris hooks to mechanically enlarge the pupil for surgical access.

2.2. Sample Collection and Whole‐Exome Sequencing

A 3 mL peripheral blood sample was collected into EDTA‐containing glass tubes. Genomic DNA was extracted using a Thermo Fisher Invitrogen kit following the manufacturer's instructions. The extracted DNA was then subjected to WES. During sequencing, the xGen Exome Research Panel V1.0 and the NovaSeq 6000 platform were utilized. The short‐read sequence data were aligned to the hg19 human reference genome using the Burrows–Wheeler Aligner, and variant calling was performed with GATK, according to best practice guidelines [7]. Variant annotation was conducted with ANNOVAR [8]. As MCOR is rare in the Chinese population, only variants with a frequency of less than 0.5% were selected. The variants were subsequently interpreted using disease and phenotypic databases, such as Online Mendelian Inheritance in Man, ClinVar, the Human Gene Mutation Database, and the Human Phenotype Ontology.

2.3. Pathogenicity Prediction and Conservativeness Analysis

In accordance with the guidelines of the American College of Medical Genetics and Genomics (ACMG), we utilized multiple prediction tools, such as combined annotation‐dependent depletion (CADD) [9], SpliceAI [10], and MutationTaster2021 [11], to evaluate potential pathogenic variants. Furthermore, conservation analysis of the variant sites was performed by comparing amino acid sequences across different species and applying the GERP++ score, Clustal Omega, and Weblogo.

2.4. Protein Homology Modeling

To explore the effects of variants on the spatial structure of proteins, we constructed models of CPAMD8‐WT and CPAMD8‐Y893*. Since the x‐ray crystal structure of the whole CPAMD8 protein is not available in the PDB database, we used the SWISS‐MODEL platform for model construction [12]. Finally, the protein structures were visualized using PyMOL (v2.5.0).

2.5. Sanger Sequencing and qRT‐PCR Validation

To validate the WES findings, Sanger sequencing was performed using genomic DNA extracted from the proband's peripheral blood. PCR amplification was carried out using primers flanking exon 22 of CPAMD8 (forward: 5′‐CACAAACACATGTACAAGTGCATG‐3′; reverse: 5′‐ACACGGCCTTACCTCAACCATC‐3′), followed by bidirectional Sanger sequencing. To evaluate CPAMD8 mRNA expression, total RNA was isolated from peripheral blood mononuclear cells using TRIzol reagent (Invitrogen), followed by reverse transcription. Quantitative real‐time PCR (qRT‐PCR) was then performed using gene‐specific primers (forward: 5′‐CCATCTGGGTCGTTCTGTCC‐3′; reverse: 5′‐GACTCCTTCCGCCTCAACC‐3′). GAPDH served as the internal control. Relative gene expression levels were calculated using the 2^−ΔΔCt method. Three independent technical replicates were performed for each sample.

3. Results

3.1. Clinical Description

A 38‐year‐old patient presented to our clinic with decreased vision in the left eye for more than 3 months, while the right eye had undergone cataract surgery 1 year prior. Ophthalmic examination revealed an uncorrected visual acuity of 0.6 in the right eye and 0.12 in the left eye. The best‐corrected visual acuity in the right eye was 1.0, with a refraction of +0.25 DS/−2.50 DC × 120. The IOP was 16 mmHg in the right eye and 18 mmHg in the left eye. Both corneas were clear with no keratic precipitates, and the peripheral anterior chamber depth was 1/2 of the central thickness. The pupil diameter in both eyes was approximately 1 mm and irregular in shape (Figure 1B). Lens opacity grading using the Lens Opacities Classification System III revealed a nuclear opalescence of 3, a nuclear color of 3, a cortical opacity of 2, and no posterior subcapsular opacity in the left eye. Owing to poor pupillary dilation, an iris hook was used during cataract surgery in the left eye (Figure 1D). UBM indicated a thin dilator pupillae (Figure 1C). Gonioscopic examination using a Goldmann three‐mirror lens revealed open iridocorneal angles in all quadrants of both eyes, without pigmentation, peripheral anterior synechiae, or other structural abnormalities. The endothelial cell density was 2469 cells/mm² in the right eye and 2646 cells/mm² in the left eye. IOLMaster measurements revealed an axial length of 22.77 mm in the right eye and 23.76 mm in the left eye. OCT revealed no significant abnormalities in the fundus.

3.2. Pathogenicity Assessment of the c.2679C>G Variant of the CPAMD8 Gene

A novel stop‐gain pathogenic variant, NM_015692.5:c.2679C>G (p.Tyr893*), was identified in exon 22 of CPAMD8. This variant results in a substitution of tyrosine at site 893 with a stop codon, potentially leading to premature truncation of the CPAMD8 protein and/or nonsense‐mediated CPAMD8 mRNA decay. According to the ACMG, this variant is classified as pathogenic (P), with supporting evidence from the PVS1, PM3_Supporting, and PM2_Supporting criteria. Pathogenicity is further supported by multiple prediction tools, such as CADD and MutationTaster, both of which indicate a high likelihood of deleterious effects.

Furthermore, the NM_015692.5:c.2679C>G variant is absent from all population databases, supporting its rarity. Structural domain analysis of the CPAMD8 protein revealed multiple key functional regions that likely interact to maintain its biological function (Figure 2A). The Y893* nonsense variant may result in loss of function at this site and in the surrounding region, potentially affecting the protein's biological activity. Finally, multiple sequence alignment of the p.Y893* site across various species using Clustal Omega and Weblogo software indicated that this site is highly conserved (Figure 2B,C).

FIGURE 2.

Conservation analysis of the CPAMD8 gene. (A) Schematic representation of the CPAMD8 protein domains. (B) Multiple sequence alignment of CPAMD8 across different species. (C) Conservation plot of amino acid residues surrounding Y893.

3.3. Impact of the CPAMD8‐Y893* Variant on Protein Structure and Electrostatic Potential Energy

The protein models of CPAMD8‐WT and CPAMD8‐Y893* were constructed using SWISS‐MODEL, and their structures and electrostatic potential energy were analyzed by PyMOL. The results revealed that the nonsense variant at the Y893 site, resulting in a significant truncation of the C‐terminal region of CPAMD8‐Y893*, led to structural defects that may affect the stability and function of the protein (Figure 3A). Additionally, electrostatic potential energy analysis revealed that the variant enhanced the asymmetry of the surface electrostatic potential distribution of the protein (Figure 3B). These changes suggest that the variant may weaken the intermolecular interaction capacity of CPAMD8, potentially affecting its biological activity.

FIGURE 3.

Structural comparison, electrostatic surface potential analysis, and validation of the variant of CPAMD8. (A) Predicted 3D structural models of wild‐type CPAMD8 (left) and mutant CPAMD8‐Y893* (right). (B) Electrostatic surface potential of wild‐type CPAMD8 (left) and CPAMD8‐Y893* (right). (C) Sanger sequencing chromatogram showing the c.2679C>G variant. (D) qRT‐PCR analysis revealing significantly decreased CPAMD8 expression in the patient compared with controls.

3.4. Sanger Sequencing and Expression Validation

Sanger sequencing confirmed the presence of the homozygous nonsense variant c.2679C>G (p.Tyr893*) in CPAMD8 (Figure 3C). To assess the potential impact of this variant on transcript levels, qRT‐PCR analysis was implemented and revealed significantly lower CPAMD8 mRNA expression in the patient than in controls (p < 0.05, Figure 3D), which is consistent with a loss‐of‐function effect via nonsense‐mediated decay.

4. Discussion

MCOR is a rare genetic disorder characterized by the inability of the iris to dilate, resulting from defective development of the dilator pupillae muscle [13]. This condition is caused by a submicroscopic rearrangement in the chromosome 13q32.1 region. However, owing to the significant heterogeneity of clinical manifestations and genetic backgrounds, molecular diagnosis remains challenging [5]. In this study, we identified a novel homozygous nonsense variant, c.2679C>G (p.Tyr893*), in CPAMD8 in a patient with MCOR.

CPAMD8 is a member of the complement 3/α2‐macroglobulin family and is expressed primarily in tissues of neural crest origin, including the lens, iris, and cornea in utero, as well as in the ciliary body and corneal epithelium in the adult eye [14]. Variants in CPAMD8 have been associated with a spectrum of anterior segment disorders, including anterior segment dysplasia [15], glaucoma [16], and Morgagnian cataracts [17]. In patients with anterior segment dysplasia, the compound heterozygous variant of CPAMD8 (c.4549‐1G>A, p[Gly1050Val]) has been strongly linked to corectopia of the pupils and iris hypoplasia [18]. However, to date, no studies have directly established an association between the CPAMD8 variant and the occurrence of MCOR.

In this study, we reported a patient with typical MCOR who presented with a pupil diameter of approximately 1 mm in both eyes, sluggish light reflexes, and no response to mydriatic drugs. UBM further confirmed the abnormal structure of a thinner dilator pupillae muscle. We subsequently identified a homozygous nonsense variant, c.2679C>G (p.Tyr893*), in the CPAMD8 gene by WES. Multiple pathogenicity prediction tools supported the potential pathogenicity of this variant. Sanger sequencing further validated the presence of this variant. To investigate the functional consequences of the variant, qRT‐PCR analysis revealed significantly lower CPAMD8 mRNA levels in the patient than in the controls, suggesting degradation of the mutant transcript via nonsense‐mediated decay. This result supports a loss‐of‐function mechanism, in line with the predicted truncation of the protein at the C‐terminus (Y893*), disrupting key functional domains.

Notably, studies have shown that MCOR is closely associated with deletions in the 13q32.1 region of chromosome 13, that the CPAMD8 gene is located within the 13q32 region of the chromosome, and that a nonsense variant usually leads to premature termination of protein translation, which may result in functional loss or damage. These findings provide further genomic support for its involvement in this disease. In summary, we report a novel homozygous nonsense variant in CPAMD8 associated with MCOR. These findings contribute new insights into the genetic basis of MCOR and may inform future molecular diagnostics, genetic counseling, and potential therapeutic research. Subsequently, we will expand the sample size and perform genomic analysis in more MCOR patients to verify whether the CPAMD8‐Y893* variant is prevalent in other cases.

Author Contributions

Jing‐Fan Gao designed the study and drafted the manuscript. Jing‐Rao Wang and Shu Wang prepared the original data. Xin Jin and Hong Zhang participated in the revision of the manuscript. Hong Zhang reviewed the entire manuscript and provided significant comments. All authors reviewed the manuscript and approved the final version.

Ethics Statement

Ethics approval was provided by the Ethical Committee of the First Affiliated Hospital of Harbin Medical University.

Consent

Informed consent was obtained from all participants.

Conflicts of Interest

The authors declare no conflicts of interest.

Gao J.‐F., Jin X., Wang J.‐R., Wang S., and Zhang H., “A Novel Homozygous Nonsense Pathogenic Variant of the CPAMD8 Gene Associated With Congenital Microcoria,” Clinical Genetics 109, no. 3 (2026): 571–575, 10.1111/cge.70067.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.