Epididymal transcriptional networks underlying sperm motility differences in Chinese indigenous chicken breeds

Abstract

This study characterized phenotypic distinctions between high- and low-motility sperm from 40-week-old Yufen1 roosters and the alteration in epididymal transcriptional networks underlighting sperm motility. Temperature challenge tests (4 °C and 37 °C) revealed that high-viability sperm maintained significantly better survival rates at both temperatures compared to low-viability samples, and high-motility sperm consistently exhibited lower morphological abnormality rates across temperature conditions (P < 0.05), which was further confirmed by extended fertilization windows (P < 0.05) and produced more fertilized eggs (P < 0.05) compared to the low-motility group. Transcriptomic analysis of the epididymis showed 723 differentially expressed genes between the low- and high- motility groups, with functional enrichment indicating significant alterations in lipid metabolism pathways and ATP synthesis-related processes. Accordingly, genes related to fat deposition such as acyl-CoA synthetase bubblegum family member 1 (ACSBG1), glycerate kinase (GLYCTK), and CDP-diacylglycerol synthase 1 (CDS1) were downregulated (all P < 0.05), whereas the mRNA level of β-oxidation gene acyl-coenzyme A thioesterase 6 (ACOT6) was increased (P < 0.05) in the high motility group as compared to the low motility group. In addition, when compared to the low motility group, the high motility semen exhibited decreased levels of both reactive oxygen species (ROS) and malondialdehyde in seminal plasma (both P < 0.05). In conclusion, the maintenance of sperm motility is associated with lipid metabolism remodeling, where these metabolic adaptations enhance ATP production while simultaneously reducing ROS generation in Yufen1 roosters.

Introduction

The reproductive potential of a rooster is determined by semen quality, including semen volume, sperm motility, sperm density, and other critical parameters [1]. Once the spermatozoa, which are usually characterized by nonfunctional gametes, leave the testis and enter the epididymis, they acquire both motility and fertilization capacity during their epididymal transit [2, 3]. In this process, spermatozoa undergo critical biochemical and morphological modifications essential for transforming inactive gametes into functionally mature sperm, especially membrane lipid reorganization, transition to oxidative phosphorylation for motility, and acrosome maturation. It was well known that avian sperm could increase their motility and acquire indispensable capabilities for fertilization in the epididymis [4–6]. Therefore, understanding the relationship between epididymal function and sperm motility, a crucial parameter for evaluating rooster fertility, is important in poultry production.

Transcriptional gene regulation exerts a crucial role in sperm motility, especially for sperm plasma membrane. For example, comparing the mRNAs alterations between the high and low sperm motility subjects found that some genes such as phosphatidylethanolamine binding protein 4 (PEBP4), proline dehydrogenase (PRODH), and signal transducer and activator of transcription 6 (STAT6) probably participated in the regulation of sperm viability in chicken [7]. PEBP4, as a serine protease, was found to interfere with sperm membrane integrity during epididymal transit in buffalo [8, 9]. This may account for the subfertility of bulls in the presence of low PEBP4 transcript levels [10, 11], and the low sperm motility groups exhibited a decreased abundance of PEBP4 expression was also decreased in chickens [7]. In addition, PRODH play an important role in protection sperm membrane from lipid peroxidation and excessive production of reactive oxygen species (ROS), thus its expressions were downregulated in low-fertility buffalo sperm [12]. Activation of the STAT6, a key pathway for restraining the growth testicular tissue, was noticed to reduce the count and motility of sperm [13]. The data from epididymal transcriptome analyses revealed that the differentially expressed genes between high and low mobility semen of roosters were closely related to cytokine-cytokine receptor interaction and peroxisome proliferator-activated receptor (PPAR) signaling pathway [4], suggesting that lipid metabolism, energy homeostasis, and inflammation might exert a key role in sperm maturation, motility, and male fertility. Moreover, transcriptome analysis of the testes identified that kinesin family member C1 (KIFC1) may be involved in sperm motility of male chickens [14]. Evidence from Japanese shrimp also confirmed that KIFC1 was related to the meiosis and acrosome formation of spermatocytes, and its inhibition could result in apoptosis of sperm cells [15]. However, information highlighting the alteration of epididymal transcriptome profiling in response to sperm motility still requires further research, especially for Chinese indigenous chicken breeds.

Yufen1 chickens are an indigenous Chinese breed known for their fast feathering and dual-purpose (meat and egg) utility. While some traits including population structure, Columbian plumage color, and genetic diversity, have been characterized in recent study [16, 17], further research is needed to illustrate the relationship between epididymal transcriptome and sperm motility. In the current study, as shown in Fig. 1A, we divided sperm with identical high motility from 40-week-old Yufen1 breeder roosters into low and high motility groups based on the basis of their performance at different temperatures. A hatching trial was conducted to confirm the fertilization activity of different semen. Transcriptomic analyses were used to investigate the potential roles of key epididymal genes in maintaining sperm motility. These findings enhance our understanding of seminal biochemistry, providing valuable insights for optimizing semen extenders and improving fertility in breeding roosters.

Fig. 1.

Experimental scheme in this study (A). Body weight (B), sperm motility (C), malformation rate (D), and longest fertilization days between the high- and low-motility groups (E). Mean values with unlike letters were notably at P < 0.05 (Student’s t-test, n = 10 or 100)

Materials and methods

Trial animals and sample preparation

All experimental protocols in this study strictly followed the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Henan Agricultural University (approval number 19–0068).The breeding roosters of Yufen1 used in this experiment were sourced from the poultry genetic resources farm at Henan Agricultural University. A total of 530 40-week-old roosters and 200 age-matched hens of the same genetic lineage, all exhibiting normal development, were selected for the present study. The diet was prepared to meet the nutritional requirements of Yufen1 chickens (Table 1). Semen samples were collected from 147 healthy roosters of the same generation with the same high sperm motility (sperm motility ≥ 0.8) by back and abdomen massage. Semen samples were stored at 4 ℃ for 5 days and 37 ℃ for 2 h, respectively, and semen motility was detected by computer-assisted sperm analyzer (Sperm Class Analyzer, Barcelona, Spain). Based on sperm motility consistency, Individuals with high motility (sperm motility ≥ 0.6) and low motility (sperm motility ≤ 0.1) at these two temperatures were defined as the high motility group (HMG) and the low motility group (LMG), respectively, for subsequent experiments. Additionally, 6 roosters each from the high- and low-motility groups were euthanized according to animal welfare standards, and testicular, epididymis, and vas deferens were collected for determination of length and weight. Roosters were euthanized with intravenous penthobarbital (50 mg/kg) [18]. Epididymis samples were stored in liquid nitrogen for sequencing and determination of gene expression.

Table 1.

Ingredients and nutrient composition of the basal diet (as-fed)

Ingredients	Proportion (%)	Calculated analysis	Proportion (%)
Corn	32.95	AME (KJ/kg)	2620
Wheat	30.0	CP	16.30
Soybean meal (46% CP)	12.01	Calcium	3.60
Wheat bran	3.7	Total phosphorus	0.52
Shotcrete corn husk	2.5	Available phosphorus	0.30
Corn gluten powder	1.5	Lysine	0.88
DDGS a	3.5	Methionine + cystine	0.67
Sodium chloride	0.24	Threonine	0.61
Limestone	8.6
CaHPO4	0.43
Chicken Bone Meal	2.0
Soybean oil	0.57
Premix b	2.0
Total	100.0

^a DDGS, distillers dried grains with soluble; AME, apparent metabolism energy; CP, crude protein

^b Provided per kilogram of diet: Cu (CuSO₄·5H₂O), 8 mg; Fe (FeSO₄·7H₂O), 80 mg; Zn (ZnSO₄·7H₂O), 80 mg; Mn (MnSO₄·H₂O), 80 mg; Se (NaSeO₃), 0.3 mg; I (KI), 0.7 mg; vitamin A, 2,700 IU; vitamin D, 3,400 IU; vitamin E, 10 IU; vitamin K, 0.5 mg; thiamine, 2.0 mg; riboflavin, 5.0 mg; pyridoxine, 3.0 mg; vitamin B₁₂, 0.007 mg; calcium pantothenate, 10.0 mg; folate, 0.5 mg; biotin, 0.1 mg; nicotinic acid 30 mg

Membrane integrity and malformation rate of sperm

The integrity of sperm membrane was analyzed by Hypoosmotic swelling test (HOST), according to a previous method [19]. Semen was incubated with a hypoosmotic solution (1: 10, v/v) contained 7.35 g/L of sodium citrate and 13.51 g/L of fructose at 37 °C for 30 min. After incubation, 10 µL of mixture was placed on a pre-warmed slide under a coverslip and observed under 400× magnification for counting the frequency of sperm tails swell.

Sperm morphology abnormalities that defined as malformation rate were evaluated using gentian violet staining. Herein, semen samples were diluted 1:100 in pre-warmed physiological saline (37 °C) and thoroughly mixed. Ten microliter aliquots were smeared onto glass slides, fixed with anhydrous ethanol for 2–3 min, and stained with 10 µL gentian violet solution for 3 min. After air-drying, sperm morphology was assessed by examining 200 spermatozoa per sample under 400× magnification to quantify morphological abnormalities.

Hatching trial

To evaluate in vivo vitality maintenance between high- and low-viability spermatozoa, semen samples with graded vitality levels (selected under different temperature conditions) were adjusted to uniform density for artificial insemination. Each trial rooster was paired with ten hens in a crossover design, where high- and low-viability sperm samples were reciprocally inseminated into different hen cohorts. Fertilized eggs were collected daily for 20 d beginning 72 h post-insemination, with each batch clearly labeled. A 30-d washout period separated consecutive insemination trials. All eggs from the same batch were incubated under standard conditions (37.8 °C, 50% relative humidity) for 7 d before candling. Embryonic viability was assessed by recording both clearly fertilized eggs (including early embryonic mortality) and unfertilized eggs.

RNA-seq analysis

Total RNA was extracted from epididymis samples and subjected to the determination of the quantity and quality by NanoDrop ND-1000 (NanoDrop, Wilmington, DE, USA). cDNA was synthesized from qualified RNA (Concentration and RIN value more than 50 ng/µ and 7.0, respectively) using Reverse Transcriptase (Invitrogen SuperScript™ II, CA, USA). Subsequently, sequencing libraries were generated on an Illumina NovaSeq 6000 platform (Novogene Biotechnology Co., Ltd, Beijing, China). Low-quality sequences that are more than 20% of low quality (Q-value ≤ 20) were removed from the raw data. Reads were aligned to the reference genome (GRCg6a) by using HISAT2 software. DEGs between high- and low-motility groups were analyzed by DESeq2 software. The genes with the parameter of FDR below 0.05 and absolute fold change (log2(FC)) ≥ 2 were considered as significant DEG. GO and KEGG analysis of DEGs was performed via the database for annotation, visualization, and integrated discovery (DAVID). The related raw data were deposited to the NCBI database (No. PRJNA1269231).

Gene expression

RNA was prepared from the epididymis samples using TriZol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). After the examination of quality and quantity, the RNA was reverse transcribed into cDNA using a cDNA Reverse Transcription Kit (Takara, Dalian, China). Subsequently, RT-qPCR analyses were performed using the ABI 7900 Sequence Detection System (Applied Biosystems, CA, USA). The primers were designed using online Primer 3 and are listed in Table 2. The relative mRNA abundance of the targeted gene was adjusted for the expression of β-actin.

Table 2.

The RT-PCR primers

Gene	Gene ID	Primer	Primer sequences (5’ to 3’)	Product length, bp
TFAP2B	XM_040696783.2	Reverse	gaggtgttctgctctgtccc	120
		Forward	cagggatgcgttcagacact
ACOT6	XM_004941669.5	Reverse	ttgctgctctttctctgcca	111
		Forward	ttgggtggcgctgtagaaat
ACSBG1	XM_046899236.1	Reverse	ttgatgaggatgggtggctg	118
		Forward	ggcacattttcacctccagc
CDS1	XM_420571.8	Reverse	ttcaggctgtgttgggatgg	102
		Forward	atcctccaaacggcccaatt
GLYCTK	XM_046900128.1	Reverse	agagttagacatcccgggct	85
		Forward	caggatgcagaccggtttct
β-actin	NM_205518.2	Reverse	aatggctccggtatgtgcaa	112
		Forward	ggcccataccaaccatcaca

TFAP2B transcription factor AP-2 beta, ACOT6 acyl-coenzyme A thioesterase 6, ACSBG1 acyl-CoA synthetase bubblegum family member 1, CDS1 CDP-diacylglycerol synthase 1, GLYCTK glycerate kinase

Reactive Oxygen Species (ROS) and malondialdehyde (MDA) determination

The ROS level of seminal plasma was measured by an Assay Kit (Beyotime Biotechnology, Shanghai, China). After diluting using phosphate buffer saline (BPS, 1: 10), semen samples were incubated with 10 µM of 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA), a permeable fluorescent probe, at 37 ℃ for 30 min. After rinsing with BPS, the samples were photographed under a fluorescence microscope (IX50, Japan) at 484 nm excitation and 525 nm emission. The MDA content in seminal plasma was determined according to the kit instructions (Nanjing Jiancheng Bioengineering Institute, China).

Statistical analysis

All the statistical results are presented as the means and standard deviations. Data were checked for normality and equal variance using the Shapiro-Wilk and Levene’s tests, respectively. When the data were recognized as normally distributed and exhibited homogeneity of variance, one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test or Student’s t-test was performed to test for differences between groups. P ≤ 0.05 and 0.05 < P < 0.1 was considered statistically significant and of tendency, respectively.

Results

Membrane integrity, malformation rate, and longest fertilization days

When dividing sperm samples (from 40-week-old Yufen1 roosters of similar body weight) with initially identical high motility into low- and high-motility groups (Fig. 1A, B), we observed significant inter-individual variation in sperm viability (P < 0.05). Following 1:1 dilution to standardize sperm density, temperature challenge tests (4 °C and 37 °C) revealed that high-viability sperm maintained significantly better survival rates at both temperatures compared to low-viability samples (Fig. 1C). Notably, high-motility sperm consistently exhibited lower morphological abnormality rates across temperature conditions (P < 0.05; Fig. 1D). Reproductive trials demonstrated that hens inseminated with high-motility sperm showed significantly extended fertilization windows (P < 0.05) and produced more fertilized eggs (P < 0.05) compared to the low-motility group (Fig. 1E, F).

Reproductive organs

The alteration in testicular, epididymal, and vas deferens response to the high and low groups were showed in Table 3. The results revealed that the left testicular weight of individuals with low motility semen was significantly lower (P < 0.05) than that of the high motility group, whereas no significant differences were detected in other gonadal tissues (P > 0.05).

Table 3.

Development of reproductive organs of rooster with high and low sperm motility

Item	Low	High	P-value
Left testicular weight, g	11.08 ± 2.68b	14.62 ± 2.18a	0.03
Right testicular weight, g	10.66 ± 2.75	13.84 ± 3.47	0.11
Left testicular length, mm	44.25 ± 6.19	45.50 ± 3.55	0.68
Right testicular length, mm	44.33 ± 4.17	46.25 ± 4.31	0.45
Left testicular width, mm	25.42 ± 2.76	27.00 ± 2.10	0.29
Right testicular width, mm	23.50 ± 2.72	26.42 ± 3.26	0.12
Left testicular thickness, mm	16.17 ± 1.57	17.25 ± 1.33	0.23
Right testicular thickness, mm	16.42 ± 1.46	16.50 ± 2.88	0.95
Left epididymal weight, mm	0.34 ± 0.08	0.36 ± 0.11	0.67
Right epididymal weight, g	0.24 ± 0.05	0.26 ± 0.06	0.61
Left epididymis length, mm	22.50 ± 2.66	23.17 ± 3.36	0.71
Right epididymis length, mm	20.17 ± 2.21	22.42 ± 2.29	0.11
Left vas deferens length, cm	12.79 ± 1.22	13.07 ± 0.96	0.67
Right vas deferens length, cm	12.37 ± 0.78	12.53 ± 1.47	0.82

Data are expressed as mean ± standard deviation. Statistical significance showed as different letters were assessed by one-way analysis of variance followed by Tukey’s post hoc test (P < 0.05, n = 6)

Alterations in epididymal transcription profile

To evaluate the roles of epididymal function in motility, the epididymis from the high- and low-motility group were acquired for RNA-seq and RT-qPCR analysis. According to Fig. 2, the expression of transcription factor AP-2 beta (TFAP2B), acyl-coenzyme A thioesterase 6 (ACOT6), acyl-CoA synthetase bubblegum family member 1 (ACSBG1), CDP-diacylglycerol synthase 1 (CDS1), and glycerate kinase (GLYCTK) was consistent between the transcriptome data and RT-qPCR results, which confirmed the consistency and accuracy of the transcriptome data.

Fig. 2.

Verification of transcriptome analysis (RNA-seq) and RT-PCR using transcription factor AP-2 beta (TFAP2B)(A), acyl-coenzyme A thioesterase 6 (ACOT6)(B), acyl-CoA synthetase bubblegum family member 1 (ACSBG1)(C), CDP-diacylglycerol synthase 1 (CDS1)(D), glycerate kinase (GLYCTK)(E). Mean values with unlike letters were notably at P < 0.05 (Student’s t-test, n = 3–6)

As showed in Fig. 3, the distribution of gene expression density showed that the value of log10(FPKM) was between − 3 and 3, and the gene expressions were higher in high motility group than that in low motility group (Fig. 3A). The epididymal samples in the high motility group formed a distinct cluster from those in the low motility group (Fig. 3B). A total of 723 differential expressed genes (DEGs) were identified between the low- and high- motility groups, based on the criteria of false discovery rate (FDR) < 0.05 and log₂FC > 2, in which 263 and 460 genes were upregulated and regulated in high motility group compared with low motility group (Fig. 3C). These alterations in transcriptional profile of epididymis were also visualized in the heatmap (Fig. 3D). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of differential genes showed that sperm motility was related to lysosome, linoleic acid metabolism, arachidonic acid metabolism, and Tol-like receptor signaling pathway (Fig. 3E). In addition, sixteen GO terms were notably associated with DEGs, including 2 Biological Process terms, 3 Cellular Component terms, and 3 Molecular Function term, which were linked to lysosome, lipid metabolism and ATP synthesis, such as ATP synthesis coupled electron transport, respirasome, respirasome chain complex Ⅳ, and NADH dehydrogenase activity (Fig. 3F).

Fig. 3.

Epididymal transcriptomics profile of high- and low-motility groups. Distribution of gene expression density (A), Principal coordinates analysis (PCoA) (B), histogram (C), and heat map (D) visualized the differentially expressed genes (DEG). Kyoto Encyclopedia of Genes and Genomes (KEGG)-enrichment analysis of DEGs (E). Gene Ontology (GO) analysis of the whole transcriptome (F). Genes with log2(FC) ≥ 2 and false discovery rate < 0.05 were considered as significant DEGs

ROS and MDA in seminal plasma

The levels of ROS and MDA in seminal plasma were examined based on the Go term analysis and showed in Fig. 4A and B. When compared to the low motility group, the high motility semen exhibited decreased levels of both ROS and MDA in seminal plasma (P < 0.05).

Fig. 4.

Epididymal gene expression and oxidative alteration in high- and low-motility groups. Reactive oxygen species (ROS) (A) and malondialdehyde (MDA) contents in seminal plasma (B). The gene expressions related to fatty acid β-oxidation gene acyl-coenzyme A thioesterase 6 (ACOT6) (C) and fat deposition, including acyl-CoA synthetase bubblegum family member 1 (ACSBG1) (D), glycerate kinase (GLYCTK) (E), and CDP-diacylglycerol synthase 1 (CDS1) (F). Mean values with unlike letters were notably at P < 0.05 (Student’s t-test, n = 6–10)

Genes related to lipid metabolism

As presented in Fig. 3C-F, three genes related to fat deposition, i.e., ACSBG1, GLYCTK, and CDS1, were downregulated (all P < 0.05), whereas the mRNA level of β-oxidation gene ACOT6 was increased (P < 0.05) in the high motility group as compared to the low motility group (Fig. 4C-F).

Discussion

Semen quality serves as a critical indicator of rooster breeding capacity, directly influencing both egg fertilization rates and subsequent offspring production performance. It was reported that reduced sperm motility, one of primary clinical manifestation of male subfertility, resulted in approximately 80% of low-fertility breeder males in poultry production systems [20]. Therefore, sperm motility was considered as a pivotal indicator of male fertility [21] and a critical biomarker for assessing sperm quality, fertilization potential, and semen preservation efficacy [22]. This parameter is biologically essential for successful sperm transport through the female reproductive tract and subsequent penetration of sperm storage tubules [23], explaining the evolutionary advantage of males producing highly motile sperm [1]. During epididymal transit, sperm acquire both motility and fertilization capacity [2, 3], demonstrating the epididymis’s crucial role in functional maturation. In this study, we characterized viability phenotypes of initially high-motility semen following temperature-challenged storage. Transcriptomic analysis revealed that sustained high motility appears mechanistically linked to enhanced lipid metabolism and ATP production pathways within the epididymis.

The epididymis of birds plays a critical role in sperm maturation and the development of progressive motility [5], in which spermatozoa undergo membrane lipid reorganization, transition to oxidative phosphorylation for motility, and acrosome maturation [24]. Quantifying epididymal transcript profiles in roosters exhibiting divergent sperm motility can elucidate regulatory mechanisms and provide insights into epididymal function. After removal of low-quality reads, a total of 723 DEGs were identified between the low- and high-motility semen groups, which were related to lysosome, Toll-like receptor signaling pathway, lipid metabolism, and ATP synthesis based on the KEGG and GO analysis. Presented data of epididymal transcriptome analyses also confirmed that differentially expressed genes between high and low mobility semen of roosters were closely related to cytokine-cytokine receptor interaction and PPAR signaling pathway [4]. It is well established that sperm mobility is directly dependent on ATP availability, which fuels the dynein ATPase activity in the axoneme. This might explain the enrichment of ATP synthesis, coupled electron transport, respirasome, respirasome chain complex Ⅳ, and NADH dehydrogenase activity in this study. Moreover, the gene changes in the epididymis were noticed to enrich the pathway of fat cell differentiation. These findings implied that lipid metabolism might be a key regulator for maintaining sperm viability. ACSBG1 is a key regulator of lipid metabolism, mediating the activation of long-chain fatty acids (LCFAs) [25]. CDS2 participates in the synthesis of phosphatidylinositol and phosphatidylglycerol, its depletion caused the formation of lipid droplets and depressed adipocyte differentiation [26]. GLYCTK could mediate the glycerate kinase activity and affect fat deposition [27]. Nevertheless, ACOT6 was identified as a target gene of the PPARα and facilitates β-oxidation of fatty acids [28]. The downregulated expressions of ACSBG1, GLYCTK, and CDS1, as well as the increased mRNA levels of ACOT6 in the high motility group, suggested that the improved sperm activity may be associated with the decrease in fat deposition and the enhancement in β-oxidation of fatty acids, which provided energy for the vitality of sperm.

ATP production and ROS generation in sperm are intrinsically linked through mitochondrial oxidative phosphorylation. While mitochondrial respiration generates ATP essential for motility, it also produces ROS as byproducts, and elevated ROS levels can disrupt ATP synthesis through oxidative damage to mitochondrial proteins and DNA, creating a paradoxical relationship where energy production may compromise sperm function [29]. Indeed, ROS production plays a crucial role in regulating sperm motility and fertilization capacity when maintained at controlled levels [30, 31], whereas excessive ROS probably induces sperm abnormalities, membrane damage, DNA fragmentation, and enzyme inactivation, ultimately impairing fertility [32]. This significantly greater level of ROS in the low motility group after storage at different temperatures might decrease sperm motility in the present study. Additionally, higher ROS levels can impair the acrosome reaction of sperm, reducing their ability to fuse with the oocyte membrane, resulting in a decrease in the longest fertilization days and the number of fertilized eggs after artificial insemination. Of note, the high polyunsaturated fatty acid content in avian sperm membranes makes them particularly vulnerable to oxidative stress [33, 34], which is prone to induce lipid peroxidation and MDA production in poultry semen [35, 36]. Moreover, a decline in fertility is possible due to factors including lipid peroxidation of the plasma membrane of the sperm [37, 38]. Membrane phospholipids containing polyunsaturated fatty acids (PUFAs) are most sensitive to peroxidation, which, upon oxidation, produces unsaturated aldehydes such as 4-HNE and MDA [39]. It was reported that a relatively high MDA content impacts the structure of the lipid membrane, resulting in decreased sperm quality and fertility [40]. In this study, the higher MDA content in the low motility group after preservation at different temperatures might be the result of ROS attacking membrane PUFAs, leading to reduced membrane fluidity and increased permeability. This may be manifested in the modification of mitochondrial inner membrane proteins (e.g., respiratory chain complexes and ATP synthase), inhibition of the electron transport chain, reduction in ATP synthesis, and promotion of reduced sperm motility or apoptosis.

Conclusions

This study has several weaknesses, primarily concerning statistical power. The transcriptomic analysis was constrained by unequal variances and non-normal distributions, likely due to limited sample sizes. These technical challenges may have led to either overestimation or underestimation of the functional significance of identified genes and pathways in sperm motility regulation. Future studies with larger sample sizes will be necessary to validate these findings. Despite these limitations, the present study provides preliminary evidence that lipid metabolism is associated with the maintenance of sperm motility in Yufen1 chickens by combining a temperatum-stimulated exercise test, hatching test, and epididymal transcriptomic analysis. The observed metabolic shifts appear to enhance ATP generation while reducing ROS production, suggesting a potential mechanistic pathway worthy of further investigation.

Authors’ contributions

Conceptualization: GS, XK. Data curation: JL. Formal analysis: JZ, GS, DL, YG. Methodology: JL, JZ, GS, DL. Financial support: YT, DL. Project Management: YG, XK. Software: JL, DL. Validation: JL, PL. Visualization: JL, JZ. Investigation: JL, PL. Writing - original draft: JL, DL. Writing - review & editing: JL, DL, YG, XK.

Funding

The work was supported by the Special Program for Serving Industrial Development under the Key Scientific Research Projects of Henan Province Higher Education Institutions (25CY015) and the Science and Technology Innovation 2030 Maior Projects (2023ZD04052). 

Data availability

The datasets generated and/or analyzed in the current study are available in the NCBI database, (No. PRJNA1269231). It is also available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

All experimental protocols in this study strictly followed the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Henan Agricultural University, with approval numbers 19-0068.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.