The host RNA helicase DDX6 restricts avian influenza virus replication by targeting viral NP and modulating ISG15

Abstract

The H7N9 subtype of avian influenza virus (AIV) poses a significant and ongoing threat to public health. As a critical structural and functional component, the viral nucleoprotein (NP) is abundantly expressed during the early stages of AIV replication; however, its interactions with host proteins and their functional consequences remain largely uncharacterized. This study aimed to identify the NP-host interaction and elucidate the mechanisms by which these interactions modulate AIV replication. Here, we employed mass spectrometry and identified the DEAD-box helicase 6 (DDX6) as a novel NP-interacting partner, an association found to be regulated by an interferon-stimulated gene (ISG15). The NP-DDX6 interaction was robustly validated by co-immunoprecipitation, immunofluorescence co-localization, bimolecular fluorescence complementation, and molecular docking assays. Functional investigations revealed that DDX6 acts as a potent negative regulator of AIV replication. Mechanistically, DDX6 not only impaired the nuclear import of NP and suppressed viral polymerase activity, but also stimulated the production of interferon (IFN)-α/β. This IFN-I induction, in turn, triggers the expression of downstream antiviral effectors such as ISG15. Furthermore, we uncovered that DDX6 fine-tunes this pathway by playing a sophisticated dual regulatory role: it enhances the pool of free, antiviral ISG15 monomers while concurrently reducing ISGylation via two deubiquitinases (USP16/USP18). Collectively, these findings not only establish DDX6 as a crucial host factor with potent antiviral activity but also enrich our understanding of host-virus interaction networks.

Introduction

Avian influenza virus (AIV), a member of the Orthomyxoviridae family, is an enveloped negative-sense RNA virus classified within the influenza A virus genus. Its genome comprises eight segmented gene fragments encoding various structural and non-structural proteins (Webster, et al., 1992). Through natural evolution driven by frequent mutations and genetic recombination, AIV continuously overcomes species barriers, facilitating infection and transmission among humans and other mammals (Song, et al., 2020). The H7N9 subtype exemplifies this phenomenon and represents a significant threat to public health. Notably, H7N9 demonstrates enhanced cross-species transmission capabilities compared to other AIV subtypes, posing considerable infection risks with high pathogenicity and pandemic potential (Qi, et al., 2013). Viral pathogenicity is primarily governed by the polymerase complex proteins: polymerase basic protein 1 (PB1), polymerase basic protein 2 (PB2), and polymerase acidic protein (PA) (Rolling, et al., 2009). Moreover, the nucleoprotein (NP) is crucial for regulating the transition from transcription to replication by the viral RNA polymerase (Vreede, et al., 2011). Additionally, NP possesses nuclear localization signals (NLS) that facilitate the nuclear import of viral ribonucleoprotein complexes (vRNP) (Portela and Digard, 2002).

The innate immune system serves as the primary defense against AIV, mounting a rapid response upon pathogen invasion. Following infection, host pattern recognition receptors identify pathogen-associated molecular patterns, triggering downstream signaling cascades that induce the production of interferons (IFNs) and pro-inflammatory cytokines (Medzhitov and Janeway, 1997). This activation subsequently stimulates the expression of interferon-stimulated genes (ISGs) and recruits innate immune cells to the infection site. Among these ISGs, ISG15 is a key mediator of IFN-induced antiviral responses in the host (McCarthy, et al., 2019). ISG15 exerts its antiviral functions through two distinct mechanisms. First, it mediates the ISGylation of viral proteins, thereby altering their stability or subcellular localization. Importantly, this modification has been shown to effectively inhibit influenza virus replication, particularly through the targeting of the NP—which has been identified as a known substrate for ISGylation (Zhao, et al., 2010; Zhao, et al., 2016). Second, ISG15 functions as an immunomodulatory cytokine when secreted extracellularly by granulocytes, thereby modulating immune responses (D'Cunha, et al., 1996).

DEAD-box (DDX) RNA helicases are ATP-dependent enzymes that unwind double-stranded RNA and remodel complex ribonucleoprotein structures (Tanner and Linder, 2001). Within antiviral immunity, specific DDX helicases play a pivotal role in orchestrating the type I interferon signaling pathway. DDX6, for instance, interacts with RIG-I to enhance IFN-β gene expression, thereby suppressing influenza B virus replication (Núñez, et al., 2018). Conversely, pro-viral roles for DDX helicases have also been documented under specific conditions. During HIV-1 infection, DDX6 contributes to viral RNA transport and virion assembly, promoting viral genome packaging and release (Reed, et al., 2012). Although H7N9 AIV exhibits widespread host distribution, the molecular mechanisms by which it evades host immune responses remain incompletely characterized. Emerging evidence suggests that host RNA-binding proteins likely serve as critical regulators during viral replication, representing potential targets for viral subversion. Given the significant role of host antiviral factors, such as the potent ISG15 system, in restricting influenza virus infection, exploring how viral proteins like NP—which has been identified as a known substrate for ISGylation—interact with or counteract these host defenses is of great interest. Nevertheless, systematic studies on NP-interacting host proteins, particularly helicases, are limited. In this study, we employed established A549-ISG15 overexpression and knockout cell lines for mass spectrometry-based proteomic analysis, leading to the identification of DDX6 as an NP-interacting DDX helicase. We further elucidated the functional impact of DDX6 on H7N9 AIV replication. These findings will advance our understanding of innate immune responses to AIV infection and provide a theoretical foundation for developing novel avian influenza control strategies.

Materials and methods

Virus, cells, and antibodies

The H7N9 subtype AIV strain A/Chicken/Eastern China/JTC11/2013, isolated from chickens, was maintained in our laboratory. Following amplification in 9-day-old specific-pathogen-free (SPF) embryonated eggs (Merial, China), the virus was preserved at -80°C for subsequent experiments. Cell culture was performed using human embryonic kidney 293 (HEK293T), Madin-Darby canine kidney (MDCK), and human lung carcinoma (A549) cell lines. These cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, USA) enriched with 10% fetal bovine serum (FBS; Gibco, New Zealand). Additionally, genetically modified A549 cell lines—specifically, the ISG15-overexpressing variant (A549-ISG15) and the ISG15 gene knockout line (A549-ISG15KO)—were developed and supplied by our laboratory. The following primary and secondary antibodies were used in this study: anti-NP, anti-PA, anti-PB1, and anti-PB2 (all from GeneTex, USA); anti-ISG15 and anti-HA tag (Beyotime Biotech, China); anti-ACTB, anti-β-Tubulin, and anti-Histone H3 (TransGen Biotech, China); and HRP-conjugated goat anti-mouse and goat anti-rabbit secondary antibodies (TransGen Biotech, China); and Alexa Fluor 488- and 594-conjugated goat anti-rabbit and goat anti-mouse secondary antibodies (TransGen Biotech, China).

Immunoprecipitation (IP) and mass spectrometry analysis

A549, A549-ISG15, and A549-ISG15KO cells were seeded in 100mm cell culture dishes (Beyotime Biotech, China) and then infected with H7N9 virus at an MOI of 1, with PBS-treated cells serving as controls. At 24 hours post-infection (hpi), cells were washed three times with cold PBS and lysed in 1 mL RIPA buffer (Beyotime Biotech, China) containing 1 mM PMSF (Beyotime Biotech, China) on ice for 5 min, followed by repeated pipetting to ensure complete lysis. The lysates were centrifuged at 16,000 × g for 10 min at 4°C, and the resulting supernatants were incubated with 5 μg of mouse anti-NP antibody overnight at 4°C to form immune complexes. Meanwhile, 25 μL of Pierce Protein A/G magnetic beads were washed three times with IP lysis buffer. The immune complexes were then added to the washed beads and incubated for 1 h at room temperature with continuous mixing. After magnetic separation, unbound samples were removed and the beads were washed three times with 500 μL IP lysis buffer. Target antigens were eluted in 100 μL elution buffer for 10 min at room temperature. Following magnetic separation, the supernatants were neutralized with 10 μL neutralization buffer per 100 μL eluate, mixed with 27.5 μL 5 × SDS-PAGE loading buffer (Beyotime Biotech, China), and heated at 100°C for 8 min before analysis by SDS-PAGE. Finally, the acquired IP products were submitted to Hangzhou Jingjie biotechnology Co. LTD for subsequent sample processing and identification by mass spectrometry (Fig. 1A).

Fig. 1.

Identification of host proteins interacting with AIV NP protein by mass spectrometry. A549, A549-ISG15, and A549-ISG15KO cells were infected with H7N9 virus (MOI=1) or mock-treated. At 24 hpi, cell lysates were subjected to IP using an anti-NP antibody. The precipitated proteins were then separated by SDS-PAGE and identified by mass spectrometry. (A) Mass spectrometry screening model. The schematic representation is created with Biorender.com. (B) SDS-PAGE analysis of proteins purified by immunoprecipitation for mass spectrometry. (C) Quantification of proteins identified by mass spectrometry in each experimental group. (D) Venn diagram illustrating the overlap of proteins identified by mass spectrometry between experimental groups.

Western blot analysis

Cells were lysed in RIPA buffer supplemented with the protease inhibitor PMSF at the indicated times. The total protein concentration in the cell lysate was determined using the BCA Protein Assay Kit (Beyotime Biotech, China). For protein denaturation, samples were mixed with 5 × SDS-PAGE (Beyotime Biotech, China) loading buffer and boiled at 100°C for 10 min. Denatured proteins were separated by SDS-PAGE and subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Vazyme, China). Following blocking, the membranes were incubated with primary antibodies targeted against NP, PA, PB1, PB2, ISG15, HA^tag, ACTB, β-Tubulin, and Histone H3, followed by HRP-conjugated goat anti-mouse and goat anti-rabbit secondary antibodies, as detailed in the ‘Antibodies’ section. Protein detection was performed by incubating the membranes with a chemiluminescent substrate and visualized using a chemiluminescence imager (Tanon, China) in a dark room. Finally, the grayscale values of the protein bands were quantified using ImageJ 1.48v software (National Institutes of Health, USA).

Confocal microscopy assay

Cells cultured on circular glass coverslips (14 mm diameter; NEST, China) were subjected to DDX6-HA^tag treatment or left untreated prior to infection with AIV at the specified MOI for the designated time periods. Following infection, cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min at room temperature, and permeabilized with 0.1% Triton X-100 (Beyotime Biotech, China) for 10 min. Non-specific binding sites were blocked by incubating with 5% bovine serum albumin (BSA) for 1 h at room temperature. Subsequently, cells were incubated with primary antibodies (anti-HA^tag and anti-NP) overnight at 4°C, followed by incubation with either Alexa Fluor 488-conjugated or Alexa Fluor 594-conjugated secondary antibodies (TransGen Biotech, China) for 1 h at 37°C. Nuclear counterstaining was performed using DAPI (Beyotime Biotech, China) for 5 min, and coverslips were mounted on glass slides using mounting medium composed of PBS supplemented with 50% glycerol. The stained samples were visualized and analyzed using a confocal laser scanning microscope (Leica, Germany).

Plasmid construction

Specific amplification primers for the DDX6 and NP genes were designed based on the sequence available in GenBank (Table 1). The target gene fragments were amplified by PCR using cDNA from A549 cells and AIV as template and cloned into the pCAGGS-HA^tag and pCAGGS vectors, which had been double-digested with XhoI/XbaI and EcoRI, using homologous recombination technology to construct the eukaryotic expression plasmids pCAGGS-DDX6-HA^tag and pCAGGS-NP. Concurrently, the DDX6 gene fragment was cloned into the pBIFC-VN173 vector double-digested with XhoI and EcoRI to obtain the pBIFC-VN173-DDX6 plasmid, while the NP gene fragment was cloned into the pBIFC-VC155 vector double-digested with XhoI and EcoRI to generate the pBIFC-VC155-NP plasmid.

Table 1.

Primer sequences used in this study.

Primers	Sequence (5’-3’)
pCAGGS-DDX6-F	CATTTTGGCAAAGAATTCatgagcacggccagaac
pCAGGS-DDX6-R	AAGATCTGCTAGCTCGAGTCAAGCGTAGTCTGGGACGTCGTATGGGTAaggtttctcatcttc
pCAGGS-NP-F	GGCGTGTGACCGGCGGCTCTAGatggcgtctcaaggca
pCAGGS-NP-R	ATGCATCGATGAGCTCGAATTCtcaattgtcatactcctctgc
pBIFC-VN173-DDX6-F	GCTTGCGGCGCGAATTCAatgagcacggccagaac
pBIFC-VN173-DDX6-R	GGTGGCGATGGATCTTCTAGAaggtttctcatcttctcaggc
pBIFC-VC155-NP-F	CCATGGAGGCCCGAATTCAAatggcgtctcaaggcaccaa
pBIFC-VC155-NP-R	ACGCCGGACGGGTACCTCGAGTTattgtatactcctctgca
qPCR-ISG15-F	CCACTGAAGGGCATCTTGGG
qPCR-ISG15-R	TCTCTTGCTCAGTGTCCTTGC
qPCR-RIG-I-F	TGTGCTCCTACAGGTTGTGGA
qPCR-RIG-I-R	CACTGGGATCTGATTCGCAAAA
qPCR-MAVS-F	CAGGCCGAGCCTATCATCTG
qPCR-MAVS-R	GGGCTTTGAGCTAGTTGGCA
qPCR-IRF3-F	AGAGGCTCGTGATGGTCAAG
qPCR-IRF3-R	AGGTCCACAGTATTCTCCAGG
qPCR-IRF7-F	CCCAGCAGGTAGCATTCCC
qPCR-IRF7-R	GCAGCAGTTCCTCCGTGTAG
qPCR-IFNα-F	GCTTGGGATGAGACCCTCCTA
qPCR-IFNα-R	CCCACCCCCTGTATCACAC
qPCR-IFNβ-F	ATGACCAACAAGTGTCTCCTCC
qPCR- IFNβ-R	GGAATCCAAGCAAGTTGTAGCTC
qPCR-GAPDH-F	CGCAGATCACCCAGAAGATCG
qPCR-GAPDH-R	TTCGTCGCATTTGTCCACCA

Coimmunoprecipitation (co-IP) assay

To investigate the interaction between AIV NP and DDX6, co-IP assays were performed. Briefly, 293T cells cultured in 6-well plates were transfected with pCAGGS-DDX6-HAtag, pCAGGS-NP, or empty pCAGGS vector for 24 h using Polyfect Transfection Reagent (QIAGEN, Germany) according to the manufacturer’s instructions. Cells were washed with ice-cold PBS, lysed in RIPA buffer, and precleared with normal mouse IgG. The precleared supernatants were incubated with anti-AIV NP, anti-HA, or normal IgG antibodies at 4°C for 1 h. Meanwhile, 25 μL of Pierce Protein A/G magnetic beads were washed three times with IP lysis buffer and incubated with the immune complexes for 1 h at room temperature with continuous mixing. After magnetic separation, the beads were washed three times with 500 μL IP lysis buffer, and target antigens were eluted in 100 μL elution buffer for 10 min at room temperature. The eluates were neutralized with 10 μL neutralization buffer per 100 μL eluate, mixed with 27.5 μL 5 × SDS-PAGE loading buffer (Beyotime Biotech, China), heated at 100°C for 8 min, and analyzed by SDS-PAGE.

Bimolecular fluorescence complementation (BiFC) analysis

A549 cells were seeded uniformly in 12-well plates and subjected to transfection assays following forming confluent monolayers. Four experimental groups were established as follows: 1) co-transfection with pBIFC-VN173-DDX6 and pBIFC-VC155-NP; 2) co-transfection with pBIFC-VN173-DDX6 and pBIFC-VC155 empty vector; 3) co-transfection with pBIFC-VN173 empty vector and pBIFC-VC155-NP; and 4) co-transfection with pBIFC-VN173 empty vector and pBIFC-VC155 empty vector serving as the negative control. At 24 hours post-transfection (hpt), cells were examined under a fluorescence microscope for fluorescence signal detection. The presence of fluorescence signals indicated a positive protein-protein interaction between DDX6 and NP.

Nucleotide homology analysis

To evaluate the conservation of NP gene sequences among different AIV genotypes, we selected NP sequences from H5N1, H7N9, and H9N2 viruses to evaluate the genetic relatedness. Detailed information on these strains is provided in Supplementary Material (Table S1). A systematic homology analysis of these nucleotide sequences was conducted using BioAider V1.532 software (Institute of Microbiology, China). Multiple sequence alignment was performed to precisely quantify the degree of sequence similarity. These data provide insights into their evolutionary relationships and taxonomic classification. Data visualization was generated using Chiplot software (https://www.chiplot.online).

Molecular docking analysis

To investigate the interaction mechanism between DDX6 and NP proteins, a computational biology approach was employed for prediction and analysis. Initially, the structure of the DDX6-NP protein complex was predicted using AlphaFold3 (https://alphafold.ebi.ac.uk/) to obtain its three-dimensional conformation. Subsequently, the predicted complex structure was subjected to in-depth analysis using the molecular visualization software PyMOL v2.3.4 to identify and enumerate the amino acid residue pairs forming hydrogen bonds at the protein-protein interface. To further assess the strength of the interaction, the binding affinity of the predicted multimeric structure was calculated using the PRODIGY web server. This analysis yielded the theoretical binding free energy (ΔG) between DDX6 and NP by evaluating interface contact types and residue contributions.

Nuclear and cytoplasmic protein extraction

A549 cells in 6-well plates were transfected with pCAGGS-DDX6-HA^tag or co-transfected with pCAGGS-DDX6-HA^tag and pCAGGS-NP for 24 h, then infected with AIV at 1 MOI. Cytoplasmic and nuclear proteins were extracted at 4 and 8 hpi, respectively, using a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime Biotech, China). NP protein expression levels were analyzed by Western blotting, with β-Tubulin and Histone H3 serving as cytoplasmic and nuclear markers, respectively.

Polymerase activity assay

Viral polymerase activity was assessed through a luciferase reporter assay. The vRNP complex components (PB2, PB1, PA, and NP) from the H7N9 AIV strain JTC11 were individually cloned into pCAGGS expression vectors. 293T cells were co-transfected with PB2, PB1, PA, NP, and DDX6 expression plasmids (200 ng each), along with the firefly luciferase reporter plasmid p-Luci (300 ng) and Renilla luciferase internal control plasmid (20 ng). At 24 hpt, cell lysates were harvested and firefly and Renilla luciferase activities were measured using a GluMax 96 microplate luminometer (Promega).

Viral replication determination

To assess the impact of DDX6 on viral replication, A549 and A549-DDX6 cells were seeded in 6-well plates and infected with AIV at an MOI of 0.01. After 1.5 h of adsorption, the cell supernatant was removed and cells were washed three times with PBS. Cells were then maintained at 37°C in essential medium supplemented with 0.5% FBS. Virus-containing supernatants were collected at 12, 24, 36, 48, and 60 hpi. Viral titers were determined and expressed as TCID₅₀/mL in MDCK cells. The TCID₅₀ values were calculated using the Reed-Muench method.

RNA extraction and real‑time quantitative PCR (RT‑qPCR)

A549 cells were seeded in 12-well plates and transfected with either pCAGGS-DDX6-HA^tag or siRNA-DDX6 for 24 h. Following transfection, cells were infected with AIV at an MOI of 1 for the indicated time periods. Total cellular RNA was extracted using TransZol Up Reagent (TransGen Biotech, China) and subsequently reverse transcribed into cDNA using PrimeScript RT Reagent (Takara, Japan). The mRNA expression levels of ISG15, USP16, USP18, RIG-I, MAVS, IRF3, IRF7, IFN-α, and IFN-β genes were quantified by RT-qPCR using specific primers (Table 1). For each reaction, 2 µL of cDNA template was amplified using the SYBR Green dye method (TransGen Biotech, China) according to the manufacturer’s instructions. Relative gene expression was calculated using the 2^-ΔΔCT method (Livak and Schmittgen, 2001), and results were expressed as log10 fold changes relative to the control group.

To assess the impact of DDX6 on viral replication, viral mRNA levels were quantified by absolute quantitative PCR. Briefly, A549 cells overexpressing or knocking down DDX6, as well as wild-type cells, were infected with H7N9 virus (MOI = 0.1). Samples were harvested at 24 and 36 hpi for total RNA extraction. Viral NP mRNA levels were detected by absolute qPCR using the following primers and probe: forward, 5’-ACCAGAAGATKTGTCMTTCCAGGG-3’; reverse, 5’-TACTCCTCCGCATTGTCTCCGAAG-3’; probe, 5’-AAGGCAACGAACCC-3’. The cycling conditions were as follows: initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 30 s. A standard curve was generated using a pCAGGS-NP plasmid of known concentration for quantification.

Statistical analyses

Data are expressed as mean ± standard deviation (SD) from three independent replicates in a representative experiment. Statistical significance was determined using either one-way or two-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparisons test or Šídák’s/Tukey’s multiple comparisons test, with p values less than 0.05 considered significant. All statistical analyses were performed using GraphPad Prism 7.00 software (San Diego, CA).

Results

Identification and analysis of NP-interacting host proteins by mass spectrometry

ISG15 is a critical interferon-stimulated gene that exerts broad antiviral functions, largely through the conjugation to and modulation of host and viral proteins (Scholte, et al., 2017). To identify the host proteins that interact with the viral NP protein and are regulated by this process, A549, A549-ISG15, and A549-ISG15KO cells were seeded in 100mm cell culture dishes. The A549-ISG15KO cell line was verified to be stably knocked out (Fig. S1A). Upon reaching confluency, cells were infected with H7N9 AIV at an MOI of 1, followed by collection of cell samples for immunoprecipitation using NP antibody-coupled magnetic beads. The analysis revealed differential protein bands among the three cell types, suggesting the presence of ISG15-regulated NP-interacting host proteins (Fig. 1B). For comprehensive identification, the entire gel block was excised and subjected to LC-MS/MS mass spectrometry analysis. Mass spectrometry analysis identified a total of 860 interacting proteins across all experimental groups, with 606 proteins detected in the A549 control group, 757 in the A549 infection group, 810 in the A549-ISG15 infection group, and 805 in the A549-ISG15KO infection group (Fig. 1C). Inter-group comparison revealed that 563 proteins were common to all groups, while unique interacting proteins were identified as follows: 7 in the A549 control group, 6 in the A549 infection group, 14 in the A549-ISG15 infection group, and 25 in the A549-ISG15KO infection group (Fig. 1D). Through systematic scoring and ranking of these interacting proteins, we observed that DDX family proteins exhibit extensive interactions with NP. Notably, DDX6 protein accounted for 25.5% of interactions following ISG15 knockout, whereas this proportion decreased to 13.7% after ISG15 overexpression, indicating that the interaction between DDX6 and NP is most significantly regulated by ISG15 (Table 2). Based on this finding, DDX6 was selected as the target for subsequent interaction validation studies.

Table 2.

Proteomic analysis of NP-interacting proteins by Mass Spectrometry.

Gene	Mw (kDa)	Score	Total	A549/mock	A549/AIV	A549-ISG15/AIV	A549-ISG15-/-/AIV
DDX1	82.432	178.03	46.6%	17.4%	46.6%	44.6%	42.7%
DDX6	54.417	25.185	25.5%	2.3%	17.6%	13.7%	25.5%
DDX39B	48.991	8.0332	15.7%	2.8%	13.3%	13.3%	10.3%
DHX9	140.958	17.404	9%	3.6%	6.6%	6.6%	9%
DHX15	90.933	6.9975	8.8%	2.5%	7%	5.5%	8.8%
G3BP1	52.164	127.51	43.6%	14.2%	43.6%	36.9%	41%
MCM7	81.308	17.772	14.5%	5.7%	14.5%	10.6%	14.5%
MOV10	113.671	26.8	9.4%	0.9%	5.7%	7.6%	8.7%
SNRNP200	244.508	13.054	4.2%	0.4%	2.8%	1.3%	3.6%

Validation of the interaction between DDX6 and NP proteins

To comprehensively verify the interaction between DDX6 and NP proteins, we conducted systematic validation using three complementary techniques: co-IP, fluorescence co-localization, and BIFC assays, based on the mass spectrometry identification results. Following co-transfection of pCAGGS-DDX6-HA^tag and pCAGGS-NP eukaryotic expression plasmids into 293T cells, immunoprecipitation experiments performed with anti-NP antibodies revealed that DDX6 protein was specifically detected in the co-transfection group, whereas no signal was observed in the control group (Fig. 2A). Fluorescence co-localization analysis further demonstrated significant co-localization of DDX6 (green fluorescence) and NP (red fluorescence) in the co-transfected cells, while the control group showed no corresponding fluorescence signals (Fig. 2B). Additionally, BIFC experiments revealed that cells co-transfected with pBIFC-VN173-DDX6 and pBIFC-VC155-NP produced specific fluorescent signals, whereas no fluorescence was detected in any of the control groups (Fig. 2C). Collectively, these experimental results provide robust evidence confirming the significant interaction between DDX6 and NP proteins.

Fig. 2.

Verification of the interaction between NP and DDX6. (A) Co-IP assay confirming the interaction between NP and DDX6. 293T cells were co-transfected with pCAGGS-NP and pCAGGS-DDX6-HA^tag plasmids. After 24 h, cell lysates were incubated with anti-NP, anti-HA, or control IgG antibodies. The resulting immune complexes were captured with Protein A/G magnetic beads, washed, eluted, and then resolved by SDS-PAGE. (B) Immunofluorescence analysis of protein co-localization. Cells grown on coverslips were infected with AIV, fixed, permeabilized, and blocked. They were then incubated with primary antibodies overnight at 4°C, followed by fluorescent secondary antibodies. Nuclei were counterstained with DAPI, and samples were visualized by confocal microscopy. Scale bar: 100 μm. (C) BiFC analysis of NP-DDX6 interaction. A549 cells were co-transfected with plasmids encoding DDX6-VN173 and NP-VC155, along with the indicated negative controls. At 24 hpt, fluorescence signals were detected by fluorescence microscopy, indicating a protein-protein interaction. Scale bar: 250 μm.

Bioinformatic analysis of NP conservation and DDX6-NP interaction

To elucidate the molecular basis of the interaction between DDX6 and the viral NP protein, we first evaluated the conservation of NP gene sequences across different AIV genotypes. Homology analysis revealed that the identities among H7N9 strains ranged from 96.50% to 100.00%. The homology between H7N9 and H9N2 was 87.61%–94.75%, which was higher than that between H7N9 and H5N1 (85.99%–89.97%). Furthermore, the sequence identities within H9N2 and H5N1 strains were 88.55%–99.06% and 87.54%–99.73%, respectively, while the identity between H5N1 and H9N2 ranged from 86.26% to 91.11% (Fig. 3A). These results indicate that the NP gene is relatively conserved both within and between different AIV subtypes, implying that the interaction with DDX6 might be a conserved mechanism.

Fig. 3.

Bioinformatic analysis of NP conservation and DDX6-NP interaction. (A) Similarity analysis of NP genomic sequences from H5N1, H7N9, and H9N2 strains. A heatmap was constructed using five strains of each subtype. The color gradient indicates the percentage of sequence similarity ranging from 85% to 100%. (B) The overall 3D structure of the DDX6-NP complex was predicted using AlphaFold3. DDX6 is shown in blue, and NP is shown in orange. The interface region where the two proteins interact is highlighted. Detailed view of the interaction interface. Amino acid residues forming hydrogen bonds are shown as sticks and labeled. The hydrogen bonds are represented by dashed lines.

Based on this conservation, we employed AlphaFold3 to predict the structure of the DDX6-NP complex. The resulting model revealed a stable binding interface between the two proteins (Fig. 3B). To visualize and analyze the interaction details, the predicted complex was rendered using PyMOL v2.3.4, where DDX6 is depicted in blue and NP in orange. A detailed analysis of the interface identified a network of hydrogen bonds crucial for complex formation. Specifically, seven residues on the NP protein (Thr430, Arg261, Val155, Gln149, Gly490, Asn492, and Glu494) were found to form hydrogen bonds with seven corresponding residues on DDX6 (Trp72, Asp100, Lys94, Ser132, Arg134, Lys294, and Gln293). To quantitatively assess the binding affinity, the PRODIGY tool was used to calculate the binding free energy of the complex. The analysis yielded a binding free energy (ΔG) of -12.7 kcal/mol, indicating a strong and spontaneous interaction between DDX6 and NP.

DDX6 impairs NP nucleation process

AIV completes its replication cycle within the nucleus, where the nucleoprotein (NP) serves as a key mediator of viral nuclear import and is essential for the viral life cycle. To investigate the effect of DDX6 on the biological function of NP, we first assessed the impact of DDX6 overexpression on NP nuclear import efficiency. Nuclear-cytoplasmic fractionation assays revealed that NP was detectable in the nucleus 4–8 hpi, confirming successful nuclear translocation. However, DDX6 overexpression led to a marked reduction in nuclear NP levels (by approximately 50%) and a corresponding increase in cytoplasmic NP content (nearly one-fold) (Fig. 4A). These results indicate that DDX6 inhibits the nuclear import of NP.

Fig. 4.

DDX6 regulates the biological functions of AIV. (A) Characterization of the nuclear import of the AIV NP protein. A549 cells were transfected with pCAGGS-DDX6-HA^tag, alone or with pCAGGS-NP, for 24 h, then infected with AIV (MOI=1). Cytoplasmic and nuclear proteins were extracted at 4 and 8 hpi. NP levels were analyzed by Western blotting using β-Tubulin (cytoplasmic marker) and Histone H3 (nuclear marker). (B) Determination of polymerase protein levels. 293T cells were co-transfected with H7N9 vRNP components (PB2, PB1, PA, NP), DDX6, and a control plasmid. At 24 hpt, protein expression in cell lysates was analyzed by Western blotting. (C) Measurement of polymerase activity. 293T cells were co-transfected with H7N9 vRNP components (PB2, PB1, PA, NP), DDX6, a firefly luciferase reporter, and a Renilla luciferase control. At 24 hpt, luciferase activity was measured to assess viral polymerase function. Statistical significance was determined using one-way ANOVA followed by Dunnett’s multiple comparisons test. (D) Measurement of virus titer in supernatant. A549 and DDX6-overexpressing A549 cells were infected with AIV (MOI=0.01). After adsorption, cells were maintained in medium containing 0.5% FBS. Virus-containing supernatants were collected at the indicated time points, and viral titers were determined by TCID₅₀ assay in MDCK cells. Statistical significance was determined using two-way ANOVA followed by Šídák's multiple comparisons test. *P<0.05, **P<0.01.

DDX6 suppresses viral polymerase activity and replication ability

Given that NP is a core component of the vRNP complex—the fundamental unit of viral replication that incorporates viral RNA and the polymerase proteins (PB1, PB2, PA)—and that vRNP function is critically dependent on polymerase activity, we further evaluated the effect of DDX6 on polymerase activity. Using a dual-luciferase reporter assay system, we co-transfected cells with plasmids expressing the polymerase subunits, NP, DDX6, along with a firefly luciferase reporter plasmid and a Renilla luciferase internal control plasmid. Western blot analysis confirmed that all proteins were expressed effectively, although a reduction in PB1 expression levels was observed (Fig. 4B). The results demonstrated that DDX6 overexpression significantly suppressed viral polymerase activity (Fig. 4C). To further investigate the effect of DDX6 on AIV replication, we infected normal A549 cells and DDX6-overexpressing A549 (A549-DDX6) cells with AIV, collecting cell supernatants at 12, 24, 36, 48, and 60 hpi for viral titer determination. TCID₅₀ assays revealed that AIV completed the replication process within the observation period in cells, with peak replication observed at 48 hpi. Notably, the DDX6-overexpressing cells exhibited significantly reduced viral replication compared to normal cells, with statistically significant differences at 36, 48, and 60 hpi (Fig. 4D). Concurrently with the DDX6 overexpression model, we established a DDX6 knockdown cell model and confirmed the significant knockdown efficiency via qPCR (Fig. S1B). Furthermore, absolute qPCR analysis revealed that DDX6 overexpression significantly reduced viral mRNA levels, whereas DDX6 knockdown significantly increased them at 36 hpi (Fig. S2). These findings confirm that DDX6 inhibits viral polymerase activity, thereby impairing AIV replication.

ISG15 serves as a key target in DDX6-regulated AIV replication process

Mass spectrometry analysis revealed that DDX6 is significantly regulated by ISG15, a crucial interferon-stimulated gene known to play key antiviral roles in various viral infections. Since our previous experiments demonstrated that DDX6 inhibits AIV replication, we investigated whether DDX6 exerts its antiviral effects through ISG15 modulation. Dynamic analysis of ISG15 gene expression in DDX6-overexpressing A549 cells showed that DDX6 continuously upregulates ISG15 mRNA levels, with a 300-fold increase observed at 24 hpt compared to the control group (Fig. 5A). Considering that ISG15 primarily functions in its monomeric form while ISGylation modification suppresses its activity, we further examined ISG15 monomer and ISGylation levels in AIV-infected normal versus DDX6-overexpressing A549 cells. The results demonstrated that DDX6 overexpression significantly increased ISG15 monomer protein expression while markedly reducing ISGylation modification levels, with a corresponding decrease in viral protein expression (Fig. 5B).

Fig. 5.

DDX6 activates the ISG15-mediated immune response. (A) Dynamic analysis of ISG15 mRNA levels. A549 cells were transfected with pCAGGS-DDX6-HA^tag for the indicated time points. ISG15 mRNA levels were quantified by RT-qPCR and normalized to the control group using the 2^⁻ΔΔCT method. Statistical significance was determined using one-way ANOVA followed by Dunnett’s multiple comparisons test. (B) Analysis of ISG15 monomer and ISGylation levels. ISG15 monomer and ISGylation levels were examined in AIV-infected A549 cells with or without DDX6 overexpression. At the indicated time points, total protein was extracted, and target proteins were analyzed by Western blotting. (C and D) Measurement of USP mRNA expression. A549 cells were transfected with pCAGGS-DDX6-HA^tag or siRNA-DDX6 for 24 h, then infected with AIV (MOI=1). At the indicated time points, USP16 and USP18 mRNA levels were quantified by RT-qPCR. Relative expression was calculated using the 2^⁻ΔΔCT method and presented as log10 fold change versus the control. Statistical significance was determined using one-way ANOVA followed by Dunnett’s multiple comparisons test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

As ISGylation is regulated by ubiquitin-specific proteases, we employed relative fluorescence quantitative PCR to assess the expression of USP16 and USP18 deubiquitinases in DDX6-overexpressing and knockdown cells. The qPCR results revealed that DDX6 overexpression and knockdown respectively upregulated and downregulated USP16 and USP18 mRNA levels, indicating that DDX6 modulates ISG15 ISGylation through activation of these deubiquitinases (Figs. 5C and 5D). Collectively, these findings confirm that DDX6 enhances ISG15’s antiviral activity by upregulating ISG15 monomer levels while targeting USP16 and USP18 to inhibit ISGylation modification, ultimately suppressing AIV replication.

Type I interferon is a key upstream mediator of DDX6-induced regulation of ISG15

As ISG15 is a classic downstream effector of type I interferons (IFN-I), we hypothesized that DDX6 might function by modulating IFN-I production. To validate this, we measured the mRNA levels of RIG-I, MAVS, IRF-3, IRF-7, IFN-α, and IFN-β by qPCR in H7N9 AIV-infected A549 cells with or without DDX6 overexpression and knockdown. We found that DDX6 overexpression significantly enhanced the mRNA expression of IFN-α and IFN-β, while the expression of RIG-I, MAVS, IRF-3, and IRF-7 remained largely unchanged. Conversely, DDX6 knockdown had no significant effect on the expression of these genes (Fig. 6). These results indicate that DDX6 activates ISG15 by enhancing IFN-I production at the transcriptional level.

Fig. 6.

DDX6 activates the upstream signaling molecules of ISG15. A549 cells were transfected with either a pCAGGS-DDX6-HA overexpression plasmid or DDX6-targeting siRNA for 24 h. The transfected cells were infected with AIV for 24 h. Total RNA was then extracted, reverse-transcribed into cDNA, and subjected to RT-qPCR to quantify the mRNA levels of RIG-I, MAVS, IRF3, IRF7, IFN-α, and IFN-β. Statistical significance was determined using one-way ANOVA followed by Dunnett’s multiple comparisons test. ****P<0.0001, ns>0.05.

Discussion

Consistent with the study’s primary objective of systematically identifying host factors that interact with the H7N9 NP protein and influence viral replication, we utilized LC-MS/MS to successfully pinpoint DDX6 as a key binding partner of NP, with this interaction being regulated by ISG15. Our results demonstrate that DDX6 employs a dual antiviral strategy: it not only binds to NP to inhibit its nuclear translocation and attenuate viral polymerase activity but also enhances IFN-I production. Furthermore, DDX6 selectively modulates distinct functional states of ISG15—upregulating ISG15 monomers while downregulating ISGylation—to effectively restrict AIV replication. These findings are particularly significant given that the H7N9 AIV, since its emergence in the Yangtze River Delta in 2013, has remained a persistent threat to public health with continuous evolution in poultry (Yang, et al., 2017). While NP is abundantly expressed as an immediate-early protein and is a known substrate for ISGylation (Rajik, et al., 2009; Zhao, Sridharan, Chen, Baker, Wang and Krug, 2016), research on its specific host-protein interactions has been limited. This study thus contributes to a better understanding of H7N9 pathogenesis by identifying DDX6 as a novel host regulator involved in the host-virus interplay.

The H7N9 subtype AIV was first identified as a novel recombinant virus in China’s Yangtze River Delta region in 2013. This virus exhibits the capability to infect avian species, mammals, and even humans, posing a significant threat to public health security. Although human infections have markedly decreased in recent years, the virus continues to evolve within poultry populations, thereby sustaining a potential risk for cross-species transmission (Chang, et al., 2023; Zhang, et al., 2018). During infection, AIV hijacks host cellular machinery to facilitate replication, while the host mobilizes antiviral factors for defense, establishing a dynamic and complex interplay. As a critical component of the viral ribonucleoprotein complex, NP is abundantly expressed as an immediate-early protein during the AIV replication cycle within host cells; however, research focusing on NP-host protein interactions remains relatively limited. ISG15 is a crucial effector molecule in the host’s antiviral immune response, mediating its effects predominantly through a post-translational modification pathway known as ISGylation (McCarthy, Everett, Graham, Steinbach and Crooke, 2019; Zhao, Hsiang, Kuo and Krug, 2010). Notably, NP has been identified as a substrate that is readily modified by ISGylation (Zhao, Sridharan, Chen, Baker, Wang and Krug, 2016). In light of this, we utilized LC-MS/MS technology to systematically screen for key host proteins that interact with NP and influence viral replication, with a particular focus on those potentially regulated by ISG15.

Mass spectrometry analysis revealed numerous host proteins in H7N9 AIV-infected samples that interact with NP and are subject to ISG15 regulation. Bioinformatic Pfam analysis highlighted an enrichment of host proteins with helicase properties, among which DEAD-box helicase family members constituted the most significant proportion. Identified helicases primarily include members of the DEAD-box (DDX) family (DDX1, DDX6, and DDX39B) as well as members of the DEAH-box (DHX) family (DHX9 and DHX15). Helicases play a crucial regulatory role in various viral infection processes. Studies have demonstrated that DDX5 and DDX17 interact with γ-herpesvirus proteins to promote viral lytic reactivation, thereby enhancing viral replication efficiency (Sandhu and Damania, 2025). In PRRSV infection, DDX3X facilitates viral replication by modulating ferroptosis (Mao, et al., 2024). Similarly, RNA helicases are critically involved in influenza virus infections; for example, DDX19 forms RNA-dependent complexes with IAV polymerase, promoting viral mRNA nuclear export and boosting replication (Diot, et al., 2016). Notably, the IAV NP protein has been shown to interact with DDX5 and suppress the host’s antiviral innate immune response via the METTL3-METTL14/YTHDF2 pathway, modulating IAV replication (Zhao, et al., 2022). In the present study, DDX6 was selected as the primary focus given its significant regulation by ISG15 and high ranking among candidates. DDX6 is known to participate in multiple stages of viral infection. It facilitates HIV-1 RNA transport and viral particle assembly, thereby promoting viral packaging and release (Reed, Molter, Geary, McNevin, McElrath, Giri, Klein and Lingappa, 2012). During PEDV infection, DDX6 expression is downregulated by ER stress, which induces autophagy by suppressing ATG degradation and mTOR phosphorylation, thereby alleviating ER stress and promoting cell survival (Xu, et al., 2022). Conversely, during influenza B virus infection, DDX6 binds to RIG-I and enhances the induction of antiviral signaling (Núñez, Budt, Saenger, Paki, Arnold, Sadewasser and Wolff, 2018). However, the specific role of DDX6 in regulating AIV replication remains to be elucidated.

In this study, the interaction between DDX6 and the H7N9 AIV NP protein was rigorously confirmed through Co-IP, fluorescence co-localization, and BiFC assays. Consistent with reports that DDX helicase family members bind to influenza NP to modulate viral replication—such as the interaction between the N-terminal domain of DDX5 and NP (Zhao, Zhao, Liu, Huang, Lu and Ping, 2022) —we demonstrate for the first time that DDX6, another member of this family, directly targets NP. Furthermore, molecular docking simulations visualized a robust binding affinity (ΔG = -12.7 kcal/mol) and an extensive hydrogen bond network, providing compelling computational evidence for this direct interaction. These findings align with the prevailing view that viruses exploit host RNA helicases to facilitate their own replication (Diot, Fournier, Dos Santos, Magnus, Komarova, van der Werf, Munier and Naffakh, 2016; Mao, Ma, Li, Zhang, Li, Wang, Wang, Guo and Wang, 2024). Although our structural model offers a novel perspective on the molecular basis of this interaction, future experimental validation will be essential to confirm these critical contact points. Following receptor-mediated endocytosis into the host cell, AIV releases its viral RNA genome and vRNP complex into the cytoplasm, which are then rapidly transported to the nucleus. Throughout this process, the nuclear localization signals of NP proteins critically regulate vRNP nuclear transport through interactions with host cellular proteins, thereby facilitating the successful nuclear entry of the viral genome for subsequent replication (Nguyen, et al., 2023; O'Neill, et al., 1995). Multiple host proteins are known to regulate NP nuclear import; for instance, the helicase MOV10 inhibits the binding of NP to importin-α via RNA-mediated interactions, thereby suppressing NP nuclear import and attenuating polymerase activity (Zhang, et al., 2016). Drawing on these precedents, we hypothesized that DDX6 might similarly modulate NP nuclear trafficking. To test this, we examined NP distribution in cells overexpressing DDX6 and found that DDX6 significantly inhibited NP nuclear translocation. Since NP not only maintains viral genome stability but also promotes polymerase activity by interacting with vRNA and polymerase subunits, its nuclear import is pivotal for viral replication. Indeed, studies have shown that disrupting the NP-importin-α interaction, as seen with the cellular intermediate filament KRT6A, inhibits vRNP nuclear import and reduces polymerase activity (Chang, et al., 2025). Consistent with this mechanism, we postulated that DDX6 might impair viral polymerase activity by blocking NP nuclear entry. Polymerase activity assays confirmed this hypothesis, demonstrating that DDX6 suppresses polymerase function and, consequently, viral replication efficiency. Thus, DDX6 inhibits polymerase activity by sequestering NP in the cytoplasm, ultimately suppressing AIV replication. Interestingly, during minigenome co-transfection assays, we observed that DDX6 inhibits PB1 protein expression. We speculate that DDX6 may compromise the integrity of the viral polymerase complex by limiting the availability of the PB1 subunit, thereby leading to reduced viral RNA synthesis and replication efficiency. However, the underlying detailed mechanism warrants further elucidation in future studies. While this study focused on H7N9, we anticipate that the DDX6-NP interaction and the subsequent antiviral mechanism may be conserved across other influenza A subtypes, such as H5N1 and H9N2. DDX6 is a central regulator of RNA metabolism, and NP is a structurally conserved component essential for vRNP assembly across influenza A viruses. Consistent with this, our sequence alignment analysis confirmed that the NP gene exhibits a high degree of conservation, not only within the same subtype but also among different AIV subtypes. Therefore, it is plausible that DDX6 targets NP through a common mechanism to restrict viral replication. However, further comparative studies are needed to validate the broad regulatory mechanism of DDX6 against different AIV genotypes.

ISG15 is an interferon-stimulated ubiquitin-like protein that exerts broad-spectrum antiviral effects, either by covalently modifying target proteins (ISGylation) or by acting in its free form to disrupt the viral replication cycle (Zhang, et al., 2021). Guided by mass spectrometry results indicating that DDX6 is regulated by ISG15, we hypothesized that DDX6 suppresses AIV replication through this axis. We found that DDX6 promotes ISG15 transcription and monomeric expression while concurrently inhibiting ISGylation. This shift likely enhances initial antiviral signaling through monomer accumulation while preventing conjugation to target proteins. Mechanistically, ISGylation is tightly regulated by deubiquitinating enzymes such as USP16 and USP18 (Gan, et al., 2023; Hou, et al., 2021) . We confirmed that DDX6 enhances the transcription of both enzymes, suggesting that DDX6 selectively modulates ISG15’s functional states to inhibit viral replication via the upregulation of these deISGylating factors. To determine how DDX6 regulates ISG15, we investigated the upstream antiviral signaling pathway. While the canonical RIG-I/MAVS/IRF axis triggers IFN-I production to induce ISGs (Acosta, et al., 2020; Kwok, et al., 2021; Lazear, et al., 2019; Liao, et al., 2008; Ren, et al., 2011), we observed that DDX6 enhances IFN-I levels without significantly altering the mRNA expression of these core signaling components. This finding points to a regulatory mechanism downstream of transcription or involving post-translational modifications. Indeed, the activation of IRF3 and IRF7 relies heavily on phosphorylation and nuclear translocation, processes not assessed in our current study. Consequently, while DDX6 clearly potentiates the antiviral response, the precise interface at which it interacts with the upstream viral recognition cascade remains to be fully elucidated.

While DDX6 is known to be involved in various viral life cycles, our data reveal a distinct, host-protective role. A plausible mechanism is that DDX6 binds directly to IFN-α/β transcripts to increase their stability or promote nuclear export, thereby amplifying cytokine output without altering upstream signaling. This aligns with observations of other RNA helicases, such as RHA/DHX9, which modulate innate immunity by regulating mRNA stability (Aktaş, et al., 2017; Ng, et al., 2018). Importantly, this study primarily elucidates the unidirectional regulation of ISG15 by DDX6; whether ISG15 reciprocally modulates DDX6 expression or function remains an open question warranting future investigation. Furthermore, although our analysis focused on the H7N9 strain A/Chicken/Eastern China/JTC11/2013, a representative model for H7N9 virology studies, the NP gene sequence is highly conserved across different AIV genotypes. Therefore, we anticipate that DDX6’s interaction with influenza virus is likely conserved across strains given its central role in RNA metabolism. However, future studies will be conducted to investigate the interaction between DDX6 and AIVs of different genotypes or varying pathogenicity.

Conclusion

In summary, this study identifies DDX6 as a host interactor of the H7N9 AIV NP protein, regulated by ISG15. We demonstrate that DDX6 employs a dual antiviral strategy: it binds NP to inhibit nuclear translocation, thereby attenuating polymerase activity, and enhances IFN-I production as a novel post-transcriptional regulator. Furthermore, DDX6 selectively modulates ISG15 functional states by upregulating the monomer while downregulating ISGylation, creating an additional layer of restriction against AIV replication (Fig. 7). These findings underscore the critical role of DDX6 in antiviral immunity and provide new insights into host-virus interaction networks.

Fig. 7.

Schematic diagram illustrating how DDX6 inhibits AIV replication by targeting ISG15 through interaction with NP protein. Following the entry of H7N9 AIV into host cells, its NP protein interacts with the host factor DDX6, an interaction whose functional outcome is significantly modulated by ISG15. DDX6 binds to NP and inhibits its nuclear translocation, thereby attenuating viral polymerase activity and ultimately suppressing viral replication. Moreover, DDX6 stimulates IFN-α/β production, thereby activating downstream antiviral effectors like ISG15. Additionally, DDX6 exerts a dual regulatory effect on ISG15: it upregulates the expression of free ISG15 monomers while downregulating ISGylation. This dual regulatory mechanism constitutes a critical host defense strategy to restrict AIV replication. The schematic representation is created with Biorender.com.

Funding

This work is supported by the National Key Research and Development Project of China (2023YFD1800601), the National Natural Science Foundation of China (32302840), the Open Project Program of Jiangsu Key Laboratory of Zoonosis (R1808), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), the Earmarked Fund for China Agriculture Research System (CARS-40), and the 111 Project (D18007).

CRediT authorship contribution statement

Xiaolong Lu: Writing – review & editing, Writing – original draft, Funding acquisition. Chenyu Lu: Investigation, Formal analysis. Mengyang He: Data curation. Xinen Tang: Investigation. Zhuxing Ji: Methodology. Hongqi Wu: Formal analysis. Kaituo Liu: Funding acquisition, Formal analysis. Wenhao Yang: Conceptualization. Yu Chen: Supervision. Ruyi Gao: Visualization. Jiao Hu: Formal analysis. Min Gu: Software. Shunlin Hu: Funding acquisition, Formal analysis. Xiaowen Liu: Supervision, Funding acquisition. Xiaoquan Wang: Supervision, Project administration. Xiufan Liu: Project administration, Funding acquisition.

Disclosures

The authors declare that they have no conflicts of interest.

Appendix. Supplementary materials

Supplementary Material 1: Table S1. Information of AIV strains used in sequence homology analysis.

Supplementary Material 2: Fig. S1. Verification of ISG15 knockout and DDX6 knockdown efficiency. (A) The knockout efficiency of ISG15 in A549 cells was verified by Western Blot. (B) The knockdown efficiency of DDX6 in A549 cells was validated by qPCR. Statistical significance was determined using one-way ANOVA followed by Dunnett’s multiple comparisons test. ****P<0.0001.

Supplementary Material 3: Fig. S2. Analysis of viral mRNA levels following DDX6 overexpression and knockdown. A549 cells overexpressing or knocking down DDX6, as well as wild-type A549 cells, were infected with H7N9 AIV at an MOI of 0.1. Viral NP mRNA levels were quantified by absolute quantitative real-time PCR at 24 and 36 hpi. Statistical significance was determined using two-way ANOVA followed by Tukey’s multiple comparisons test. ****P<0.0001, ***P<0.001.

Supplementary Material 4: Raw mass spectrometry database.

Data availability

Data will be made available upon request.