A macrophage-mimetic nanocarrier co-loaded with geraniol and FK13-a1 for MRSA-induced acute lung injury

ABSTRACT

Current clinical strategies for Methicillin-resistant Staphylococcus aureus (MRSA)-induced acute lung injury (ALI) predominantly focus on single-approach interventions such as anti-inflammatory therapy. However, due to the complex, multi-pathway pathological network underlying the disease, targeting a single pathway often yields suboptimal therapeutic outcomes. Consequently, there is a pressing need to develop innovative drug delivery systems capable of systematically addressing this intricate pathological process. Geraniol, a naturally derived monoterpene alcohol, exhibits multiple pharmacological activities including antimicrobial, antioxidant, and organ-protective effects, while the antimicrobial peptide (AMP) FK13-a1 demonstrates broad-spectrum antibacterial, anti-inflammatory, and immunomodulatory functions. Recognizing their complementary mechanisms of action, we innovatively propose a synergistic therapeutic strategy combining geraniol with FK13-a1. To enhance targeting precision, we engineered a biomimetic delivery system by coating nanomaterials with macrophage membranes via tyramine linkage, enabling specific homing to pulmonary inflammatory sites. Guided by this design concept, we successfully fabricated the biomimetic nanodrug Tyr-MM@PLGA/G+F and conducted systematic characterization using multiple analytical techniques. Through established in vitro and in vivo infection models, we evaluated the therapeutic efficacy of this nanosystem. Results demonstrated that Tyr-MM@PLGA/G+F actively targets ALI lesion sites, achieving precise co-delivery and synergistic action of geraniol and FK13-a1 at the pathological foci, thereby significantly enhancing treatment outcomes. This study not only validates the remarkable efficacy of this composite nanosystem against ALI but also provides novel insights and experimental evidence for targeted therapy of this condition.

GRAPHICAL ABSTRACT

1. Introduction

Infection-induced acute lung injury (ALI) remain critical challenges in critical care medicine (Abraham and Singer 2007; Singer et al. 2016; Zhang et al. 2023), with MRSA infections exacerbating mortality rates up to 50% through unique pathogenic mechanisms (Randolph et al. 2019; Wang et al. 2022). Despite advances in antibiotic development, MRSA exhibits multidrug resistance, particularly to β-lactams and vancomycin (20–30% treatment failure rates) (Yu et al. 2016; Li et al. 2017), while its toxins induce a paradoxical ‘cytokine storm’ coupled with immunosuppression (Liu et al. 2021). Conventional therapies further face limitations in restoring alveolar barrier integrity and achieving sufficient lung tissue antibiotic penetration (e.g. daptomycin's 15-20% lung-to-plasma ratio) (Han et al. 2023). These mechanistic barriers underscore the urgent need for innovative strategies integrating pathogen clearance, inflammation modulation, and tissue repair.

Geraniol, a natural monoterpene alcohol (C₁₀H₁₈O) widely found in essential oils of rose, geranium, and other plants, possesses antimicrobial, anti-inflammatory, and antioxidant properties (Froz et al. 2024; Pandur et al. 2024). Recent studies indicate its therapeutic potential in sepsis-associated lung injury: it inhibits the NF-κB pathway, reducing the release of pro-inflammatory cytokines such as Tumor Necrosis Factor-αpha (TNF-α) and Interleukin-6 (IL-6), and modulates neutrophil extracellular trap formation, thereby attenuating inflammatory cascades (Ma et al. 2023). Additionally, geraniol activates the AMPK/SIRT1 pathway, enhances mitochondrial respiratory chain function, improves membrane potential and respiratory control ratio, reduces oxidative stress, increases ATP levels in lung tissue, and promotes energy metabolism recovery (Chen et al. 2016; Gandhi et al. 2024).

AMPs, as promising next-generation anti-infective agents, exert bactericidal effects by physically disrupting bacterial cell membranes, significantly reducing the risk of resistance development (Asghar et al. 2025; Del Olmo and Andreu 2025; Thomas et al. 2025). Due to their high affinity for negatively charged bacterial membranes and low toxicity toward eukaryotic cells, AMPs demonstrate favorable selectivity and safety profiles. FK13-a1, a 13-amino-acid peptide derived from the hydrophobic core of human AMP LL-37, exhibits strong membrane-lytic activity against Gram-positive bacteria (including MRSA), showing significant antimicrobial potential (Rajasekaran et al. 2017; Zhu et al. 2024).

Recent advances in bioinspired nanotechnology have led to the development of macrophage membrane (MM)-coated nanoparticles as novel drug delivery platforms (Sultana et al. 2025; Wei et al. 2025; Zhou et al. 2025). These carriers mimic macrophage biological behavior by retaining surface proteins (e.g. integrins, CD47). They achieve targeted delivery to inflammatory lungs via interactions with Vascular Cell Adhesion Molecule-1 (VCAM-1) and other adhesion molecules, while avoiding immune clearance through CD47-mediated ‘don't eat me’ signals, thereby prolonging systemic circulation (Wu et al. 2022; Qu et al. 2024; Sheng et al. 2025).

As promising biological agents in the field of targeted drug delivery, targeting peptides are being increasingly applied in the treatment and diagnosis of various diseases. Due to their high specificity, peptide-mediated drug delivery enables precise targeted drug transport, significantly optimizing the pharmacological distribution of drugs in vivo and enhancing therapeutic efficacy (Wu et al. 2023). Peptides capable of self-assembling into nanostructures, as well as peptide-drug conjugates, not only demonstrate superior stability but also exhibit significantly improved performance in drug delivery. Inflammatory sites are characterized by massive infiltration of activated neutrophils and macrophages, which highly express and secrete myeloperoxidase (MPO). MPO catalyzes the conversion of hydrogen peroxide (H₂O₂) and chloride ions (Cl⁻) into hypochlorous acid (HOCl). The phenolic ring of tyramine (Tyr) is susceptible to chlorination and oxidation by HOCl. In nanomedicine design, after modifying the carrier surface (e.g. cell membrane) with Tyr, once the carrier reaches the inflammatory site via systemic circulation, locally high concentrations of HOCl specifically trigger a chemical reaction in Tyr. This reaction reduces the surface hydrophilicity of the carrier (e.g. macrophage membrane) and increases its hydrophobicity (Nie et al. 2023). The enhanced hydrophobicity promotes non-specific interactions between the carrier and the cell membranes or extracellular matrix at the inflammatory site, thereby significantly improving the carrier's adhesion and retention in the lesion area.

In this study, we designed and developed a novel membrane-biomimetic nanodrug delivery platform, Tyr-MM@PLGA/G+F, and evaluated its therapeutic efficacy against ALI by MRSA using a mouse model. The system employs PLGA as the drug carrier, with the core co-loaded with hydrophilic antimicrobial peptides and lipophilic geraniol, while the exterior is coated with Tyr-modified macrophage membranes for biomimetic encapsulation. Leveraging the inflammatory responsiveness of Tyr and the inflammatory homing capability of macrophage membranes, the platform significantly enhances the targeted accumulation of antimicrobial peptides and geraniol in the lungs. Through systematic assessment of bacterial load, dynamic changes in inflammatory factors, oxidative stress levels, and immune-related indicators, the study demonstrated that the platform possesses synergistic antibacterial, anti-inflammatory, and immunomodulatory effects. This research provides new strategies and experimental evidence for the treatment of ALI by pathogenic infections.

2. Material and methods

2.1. Cell lines and reagents

The murine monocyte-macrophage leukemia cell line (RAW264.7) was purchased from Huatuo Biological Technology Co., Ltd. DSPE-PEG-Tyr (purity ≥ 95%, MW: 2000) was obtained from Pengshuo Biological Technology Co., Ltd. The antimicrobial peptide FK13-a1 (purity 96.87%) was synthesized and purified by GL Biochem (Shanghai) Ltd. PLGA (50:50 LA:GA) was purchased from Ji'nan Daigang Biotechnology Co., Ltd.; polyvinyl alcohol 1788 (PVA) and dichloromethane were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Anti-CCR2, anti-TNFR2, anti-CD68 and interleukin-10 (IL-10) antibodies were sourced from Huidan Biotechnology Co., Ltd. (Hangzhou). Lipopolysaccharide (LPS) was acquired from Sigma-Aldrich (USA). The CCK-8 assay kit was supplied by Shanghai Shangbao Biotechnology Co., Ltd. The bicinchoninic acid (BCA) protein assay kit, Cell Membrane Protein and Cytoplasmic Protein Extraction Kit and the Nitric Oxide (NO) Assay Kit were purchased from Beyotime Biotechnology Co., Ltd. Enzyme-Linked Immunosorbent Assay (ELISA) kits for TNF-α, iInterleukin-1 βeta (IL-1β) and IL-6 were obtained from Jiangsu Meimian industrial Co., Ltd. Hematoxylin and eosin (H&E) staining solution, as well as assay kits for catalase (CAT), MPO, malondialdehyde (MDA), superoxide dismutase (SOD), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and creatinine (CR), were all procured from Nanjing Jiancheng Bioengineering Institute Co., Ltd. Primers, Evo M-MLV RT Premix kit, and SYBR Green Pro Taq HS Premix qPCR master mix were provided by Accura Biotechnology Co., Ltd. Antibodies against CD3, CD45, CD4, CD8, CD25, CD127, CD11b, Ly-6C, and Ly-6G were purchased from BioLegend.

2.2. Animals

Male Balb/c mice of specific pathogen-free (SPF) grade were purchased from the Guangdong Medical Laboratory Animal Center.

Justification for use of animals: Male Balb/c mice were selected for this study due to their well-established ‘Th2 immune bias,’ which enables the development of a more stable and reproducible inflammation model with controllable mortality, facilitating effective observation within a defined experimental window. The use of male individuals aimed to exclude potential interference from the female estrous cycle on immune responses, thereby ensuring the reliability of experimental outcomes.

Animal housing and welfare: The animals were housed in standard individually ventilated cages (with no more than 8 mice per cage) under controlled environmental conditions (temperature: 22 ± 2 °C, humidity: 50 ± 10%, and a 12-hour light/dark cycle). All mice had free access to standard laboratory feed and filtered drinking water, and the cages were equipped with nesting materials, chewing blocks, and plastic tunnels for environmental enrichment.

Humane endpoints: To minimize suffering, the research team conducted frequent daily monitoring of the animals' conditions using validated pain assessment scales. Clear humane endpoints were established (e.g. weight loss exceeding 20%, severe distress behaviors, or inability to eat or drink independently), and euthanasia was promptly performed if any endpoint was reached.

Anesthesia and euthanasia: For procedures requiring anesthesia, isoflurane inhalation was used, while cervical dislocation was employed for euthanasia at the experimental endpoint.

2.3. Material construction

2.3.1. Extraction of macrophage membranes and synthesis of MM-Tyr

RAW264.7 cells were cultured in DMEM complete medium, which was prepared by mixing 10% FBS and 1% penicillin/streptomycin (P/S). The cells were incubated at 37 °C in a 5% CO₂ environment. When the cell density reached approximately 80%, the original medium was discarded, and the cells were washed three times with PBS buffer to facilitate complete detachment from the culture vessel walls. The resulting cell suspension was then collected. The extraction of the cell membrane suspension was performed using the Beyotime Cell Membrane Protein and Cytoplasmic Protein Extraction Kit. Specifically, the cell suspension was washed twice with ice-cold PBS and centrifuged at 500 g for 5 min at 4 °C to collect the pellet. An appropriate amount of ice-cold Membrane Protein Extraction Reagent A containing PMSF was added to the pellet, followed by incubation on ice for 15 min. The mixture was then transferred to a pre-chilled glass homogenizer and manually homogenized with 50 strokes. The homogenate was centrifuged at 700 g for 10 min at 4 °C to collect the supernatant. This supernatant was further centrifuged at 14,000 g for 30 min at 4 °C. After discarding the supernatant, the resulting pellet was resuspended in ice-cold PBS to obtain the cell membrane suspension.

DSPE-PEG-Tyr was dissolved in PMSF and then added to the extracted cell membrane suspension. The mixture was incubated at 4 °C for 12 hours to ultimately obtain MM-Tyr.

2.3.2. Preparation of PLGA/G+F nanoparticles

An appropriate amount of geraniol and PLGA was measured and dissolved in dichloromethane solvent under thorough stirring to ensure complete dissolution. FK13-a1 was dissolved in a PVA aqueous solution and slowly dripped into the PLGA and geraniol mixed solution. The mixture was sonicated to form a milky primary water-in-oil (W/O) emulsion. Subsequently, under continuous stirring, the primary W/O emulsion was gradually dripped into the PVA aqueous solution and sonicated again on ice to further emulsify the mixture, ultimately forming a water-in-oil-in-water (W/O/W) double emulsion. The W/O/W double emulsion was stirred at room temperature until the dichloromethane completely evaporated. After evaporation, the mixture was centrifuged, and the precipitate was washed to obtain PLGA/G+F nanoparticles.

2.3.3. Construction of Tyr-MM@PLGA/G+F

The prepared PLGA/G+F nanoparticles were mixed with MM-Tyr and extruded using a liposome extruder. The resulting product was collected to obtain the membrane biomimetic nanomaterial Tyr-MM@PLGA/G+F.

2.4. Drug loading efficiency measurement

A UV spectrophotometer was used to measure the characteristic absorption peaks of the antimicrobial peptide FK13-a1 at 280 nm and geraniol at 208.9 nm to plot standard curves. The absorbance (OD) was plotted on the y-axis, and the concentration (C, μg/mL) was plotted on the x-axis for linear regression to generate the standard curves. After the emulsification process described in PLGA nanoparticles, the supernatant collected by centrifugation was used to calculate the drug loading efficiency. The standard curve method was employed to determine the drug loading efficiency, with the calculation formula as follows:

$$\mathrm{Drug}\mathrm{Loading}\mathrm{Efficiency}(\%)=(a\times \mathrm{OD}+b)\times 100\%/C$$

2.5. Transmission Electron Microscopy (TEM)

For TEM analysis, 10 μL of each sample was placed on a copper grid for 5–10 min, and excess liquid was absorbed using filter paper. After drying, the samples were observed using an HT7700 transmission electron microscope.

2.6. Particle size and zeta potential

The size distribution and surface potential of the prepared nanoparticles were analyzed using Dynamic light scattering (DLS, Malvern Zetasizer Nano ZS90). The specific procedures are as follows: Size measurement: After setting the parameters, approximately 1 mL of the diluted sample was pipetted into a clean sizing cuvette, which was then placed into the sample chamber for measurement. Zeta potential measurement: After configuring the parameters, approximately 1 mL of the diluted sample was slowly injected into the sample inlet at the bottom of the zeta potential cell using a pipette. Once the sample overflowed from the opposite outlet and air bubbles were confirmed to be absent, both ends were sealed with rubber stoppers. The exterior was gently wiped dry before proceeding with the measurement.

2.7. Western Blot (WB)

Total proteins were extracted from macrophage and nanoparticle membrane samples using ice-cold RIPA lysis buffer, followed by incubation on ice for 30 min with intermittent vortexing. The lysates were centrifuged at 14,000g for 15 min at 4 °C, and the supernatants were collected for protein quantification using the BCA assay. Equal amounts of protein samples (40 μg) were mixed with 5 × loading buffer and denatured by boiling in a water bath for 10 min. The denatured protein samples along with a pre-stained protein marker were loaded into the wells of an SDS-PAGE gel. Electrophoresis was performed in 1 × electrophoresis buffer: initially at a constant voltage of 80 V for approximately 30 min until the samples entered the separating gel, followed by a constant voltage of 120 V until the bromophenol blue indicator reached the bottom of the gel. Prior to transfer, PVDF membranes were activated in methanol for 15 sec and equilibrated in transfer buffer. A ‘sandwich’ structure was assembled in the order of cathode to anode: sponge-3 layers of filter paper-gel-PVDF membrane- 3layers of filter paper-sponge. The assembled sandwich was placed in a transfer tank filled with pre-cooled transfer buffer, and transfer was carried out at a constant current of 400 mA for 120 min in an ice bath (or a 4 °C cold room). After transfer, the membranes were incubated in 5% skim milk/TBST blocking buffer with shaking at room temperature for 1 h. Subsequently, the membranes were incubated overnight at 4 °C with shaking in primary antibodies (anti-CCR2, anti-TNFR2, and anti-CD68) diluted at 1:1000. Following three washes with TBST buffer (5 min each), the membranes were incubated with HRP-conjugated secondary antibody diluted at 1:1000 for 90 min at room temperature, followed by another three washes with TBST buffer (5 min each). Finally, ECL chemiluminescent substrate solutions A and B were mixed at a 1:1 ratio and evenly applied to the membrane surface. After incubation for 1–2 min, signals were captured using a chemiluminescence imaging system.

2.8. Antibacterial assays

2.8.1. Minimum Inhibitory Concentration (MIC)

A single colony of the test strain was inoculated to prepare a bacterial culture, which was then adjusted to a concentration of 1 × 10⁶ colony-forming units (CFU)/mL using mueller-hinton broth (MHB). The drug solution was subjected to gradient dilution via a two-fold serial dilution method. Subsequently, 100 μL of each drug concentration was thoroughly mixed with an equal volume of the bacterial suspension and incubated overnight at 37 °C in a constant-temperature incubator. After incubation, 10 μL of 0.5% 2,3,5-triphenyltetrazolium chloride staining solution was added to each well, followed by further incubation at 37 °C for 2 hours. The results were interpreted based on color development within the wells: red or pink coloration indicated active bacterial metabolism (i.e. bacterial growth), while colorless wells signified growth inhibition.

2.8.2. Minimum Bactericidal Concentration (MBC)

100 µL of bacterial suspension from each well that showed no visible bacterial growth in the MIC test was collected and evenly spread onto the surface of freshly prepared Mueller-Hinton agar plates. The plates were then incubated overnight at 37 °C in a constant-temperature incubator. After incubation, bacterial colony growth on the plates was observed, and the lowest drug concentration at which no single colony was observed was determined as the minimum bactericidal concentration of the drug.

2.8.3. Fractional Inhibitory Concentration (FIC)

Based on the results of the MIC assay, the two test drugs were separately prepared as stock solutions at serial dilution concentrations of 4×, 2×, 1×, 0.5×, 0.25×, and 0.125× MIC. A checkerboard microbroth dilution method was employed, in which solutions of the two drugs at varying concentrations were added to a 96-well plate in orthogonal combinations, with each well inoculated to a final bacterial concentration of 5 × 10⁵ CFU/mL. After overnight incubation at 37 °C, the lowest drug concentration at which no visible bacterial growth was observed was used as the endpoint for assessment. FIC index was calculated using the formula:

$$\mathrm{FIC}\mathrm{idex}=(\mathrm{MIC}\mathrm{of}\mathrm{drug}A\mathrm{in}\mathrm{combination}/\mathrm{MIC}\mathrm{of}\mathrm{drug}A\mathrm{alone})+(\mathrm{MIC}\mathrm{of}\mathrm{drug}B\mathrm{in}\mathrm{combination}/\mathrm{MIC}\mathrm{of}\mathrm{drug}B\mathrm{alone}).$$

The combined effect was evaluated according to the following criteria: FIC ≤ 0.5 indicated synergy, 0.5 < FIC ≤ 1 indicated an additive effect, 1 < FIC ≤ 2 indicated indifference, and FIC > 2 indicated antagonism.

2.9. Cell viability after LPS treatment

RAW264.7 cells in the logarithmic growth phase were seeded into a 96-well plate at a density of 5 × 10³ cells per well and pre-cultured. The cells were then divided into the following groups: normal control group, blank control group, model group (treated with LPS), and experimental groups (treated with PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F). The normal control and blank control groups were replenished with 100 μL of complete medium without LPS, while the model and experimental groups were replenished with 100 μL of complete medium containing 10 ng/mL LPS. After incubation at 37 °C with 5% CO₂ for 4 hours, the medium was discarded, and the cells were washed three times with PBS. Subsequently, the normal control, blank control, and model groups were replenished with 100 μL of regular complete medium, while the experimental groups were replenished with 100 μL of complete medium containing the corresponding nanoformulations (with final concentrations of geraniol and FK13-a1 at 50 μg/mL and 18.65 μg/mL, respectively). The cells were further cultured for 24 hours. Finally, 10 μL of CCK-8 solution was added to each well under light-protected conditions. After incubation for 60 minutes, the absorbance at a wavelength of 450 nm was measured using a microplate reader.

2.10. Measurement of NO and inflammatory factor concentrations

RAW264.7 cells were seeded in 96-well plates at a predetermined density. After adherence, cells were divided into the following groups: normal control group (complete medium), model group (LPS treatment only), and experimental group (co-treatment with LPS and the drug). Following 24 hours of intervention, the cell culture supernatant was collected.

The NO concentration was measured using a nitric oxide assay kit, following the manufacturer's instructions. A standard curve was constructed as follows: 50 µL of supernatant was mixed with 50 µL of Griess Reagent I and 50 µL of Griess Reagent II. The absorbance was measured at a wavelength of 540 nm, and the NO concentration was calculated based on the standard curve.

The concentrations of inflammatory cytokines (TNF-α, IL-1β, IL-6) were determined using ELISA kits. The procedure was as follows: 50 µL of serially diluted standard solutions was added to the standard wells, while a mixture of 10 µL of supernatant and 40 µL of sample diluent was added to the sample wells. Subsequently, 100 µL of horseradish peroxidase-labeled detection antibody was added to each well except the blank wells. After sealing, the plate was incubated at 37 °C for 60 minutes. The liquid was discarded, and the wells were patted dry and washed five times. Then, 50 µL of Substrate A and 50 µL of Substrate B were sequentially added to each well, followed by incubation at 37 °C in the dark for 15 minutes. Finally, 50 µL of stop solution was added, and the absorbance was measured at 450 nm. The concentrations of each cytokine were calculated based on their respective standard curves.

2.11. Inflammatory phase-responsive properties

To simulate the characteristics of an inflammatory environment, this study involved co-incubating Tyr-MM@PLGA/G+F with a reaction system containing 1 mmol/L H₂O₂ and 10 μg/mL MPO for 8 hours. Control groups consisting of PLGA/G+F and MM@PLGA/G+F materials were treated under identical conditions. Observation and imaging were performed using SEM.

2.12. Establishment of MRSA-induced ALI model and drug administration

Bacterial suspension preparation: MRSA strains stored at −80 °C were inoculated into MHB liquid medium and cultured with shaking at 37 °C and 200 rpm for 12–16 hours to reach the logarithmic growth phase. Bacterial cells were collected by centrifugation at 4 °C and 4000 g for 10 minutes, washed three times with PBS, and finally resuspended in PBS to adjust the bacterial concentration to 2.0 × 10¹⁰ CFU/mL (viable bacterial counts were determined using the gradient dilution method: serially diluted bacterial suspensions were spread onto MHA agar plates, incubated at 37 °C for 24 hours, and the original suspension concentration was calculated based on colony counts).

Animal grouping and modeling: After one week of acclimatization under standard environmental conditions, mice were randomly divided into five groups, each consisting of 18 mice: normal control group (Normal), MRSA infection model group (Model), and three treatment groups (PLGA/G+F group, MM@PLGA/G+F group, and Tyr-MM@PLGA/G+F group). For modeling, except for the Normal group, all other groups were intranasally administered 50 μL of MRSA bacterial suspension (containing 1 × 10⁹ CFU per mouse); the Normal group received an equal volume of sterile PBS as a control.

Administration regimen: Four hours after modeling, drugs were administered via tail vein injection. The Normal and Model groups received 100 μL of sterile PBS, while each treatment group received 100 μL of the corresponding nano-formulation (dosage per mouse: geraniol 50 mg/kg, FK13-a1 18.65 mg/kg).

Sample collection: Twenty-four hours after the last administration, mice were anesthetized and euthanized. Whole blood, heart, liver, spleen, lung, and kidney tissues, as well as bronchoalveolar lavage fluid (BALF), were collected for subsequent analysis. The specific assays performed are as follows:

Blood samples were used to determine the proportions of neutrophils, CD4⁺ T cells, CD8⁺ T cells, and Regulatory T cells (Tregs) in peripheral blood, as well as to measure serum levels of liver function markers (ALT, AST) and kidney function markers (BUN, Cr). BALF was used to measure total protein content and the concentrations of the inflammatory cytokines TNF-α, IL-1β, and IL-6. Lung tissue was used to assess bacterial load, mRNA expression levels of the inflammatory cytokines TNF-α, IL-1β, and IL-6, perform H&E staining, determine the proportions of neutrophils, CD4⁺ T cells, CD8⁺ T cells, and Tregs in lung tissue, and measure oxidative stress markers (SOD, MPO, CAT activity, and MDA content). Spleen tissue was used for H&E staining and to determine the proportions of neutrophils, CD4⁺ T cells, CD8⁺ T cells, and Tregs in spleen tissue. Heart, liver, and kidney tissues were used for H&E staining.

2.13. In vivo imaging

The specific procedure for liposome labeling was as follows: Under light-protected conditions, 1 mL of PLGA raw material at a concentration of 1 mg/mL was transferred into a centrifuge tube, followed by the addition of 200 μL of DiR dye at a concentration of 100 μM. The mixture was thoroughly vortexed for 1 minute and then allowed to incubate for 10 minutes. After incubation, 10 mL of sterile PBS buffer was added to dilute the mixture. Purification was then performed via centrifugation at 8000 rpm for 30 minutes at 4 °C to remove unbound dye. Finally, the resulting pellet was resuspended in 200 μL of PBS.

After the mouse model was successfully established, the animals were randomly and equally divided into three groups: the PLGA/G+F group, the MM@PLGA/G+F group, and the Tyr-MM@PLGA/G+F group. Four hours after intranasal instillation of MRSA bacterial solution, each group of mice was administered the corresponding DiR-fluorescent-labeled liposomal formulation—namely PLGA/G+F, MM@PLGA/G+F, or Tyr-MM@PLGA/G+F—via injection. Subsequently, the fluorescence intensity in various organs was monitored using the NightOWL II LB 983 in vivo imaging system.

2.14. Survival rate and body weight monitoring

The modeling methods, experimental reagents, drug doses, and administration routes were all conducted in accordance with the section ‘2.12 Establishment of MRSA-Induced ALI Model and Drug Administration.’ Following modeling and drug intervention, a one-week survival observation experiment was performed on mice, during which the survival status and body weight changes of each group were recorded daily.

2.15. Lung wet/dry weight ratio

The lung tissues were gently rinsed with sterile saline to remove surface impurities and residual blood. After blotting with filter paper to absorb excess moisture, the tissues were placed on clean weighing paper and precisely weighed using a microbalance to obtain the wet weight (W). Subsequently, the lung tissues were dried in an oven at 60 °C for 24 h, after which they were weighed again to determine the dry weight (D). Finally, the wet/dry weight ratio (W/D) of the lung tissues was calculated.

2.16. Lung bacterial load

After weighing, lung tissues were homogenized in PBS at a ratio of 0.1 g tissue per 0.9 mL PBS. The homogenates were serially diluted (10³to 10⁷), and 100 µL of each dilution was spread onto luria-bertani (LB) agar plates. After incubation at 37 °C for 24 hours, bacterial colonies were counted. The bacterial load in the lung tissue homogenates was calculated based on the dilution factors.

2.17. H&E staining

The tissue (heart, liver, spleen, lung, and kidney) samples were fixed in 4% neutral buffered formalin for 48 hours, followed by rinsing under running water for over 12 hours. They were then dehydrated using a preheated automatic tissue processor according to a programmed gradient series (70% ethanol I: 30 min; 70% ethanol II: 30 min; 80% ethanol: 2 h; 90% ethanol: 2 h; 95% ethanol: 1 h; 100% ethanol I: 30 min; 100% ethanol II: 30 min). After dehydration, the tissues were transferred into completely melted paraffin for embedding. Prior to sectioning, the flotation bath was pre‑heated to 42 °C, and the paraffin blocks were cooled on a chilling plate. The cooled blocks were trimmed and sectioned horizontally or vertically to obtain intact ribbons, which were floated flat on the water bath. The flattened sections were picked up onto glass slides, dried, and stored temporarily in slide boxes.

Paraffin sections were sequentially dewaxed and hydrated by complete immersion in the following solutions: xylene I and II for 15 min each, absolute ethanol I and II for 10 min each, 95%, 85%, and 75% ethanol for 5 min each, and finally ddH₂O for 5 min. After dewaxing, hematoxylin staining was performed by applying the stain to cover the tissue, incubating at room temperature for 5–10 min, and rinsing under running water for 10–15 min. Differentiation was carried out using 1% hydrochloric acid ethanol for 1–3 s, followed immediately by a 10 min water rinse. Eosin staining was then applied for 1–3 min at room temperature, after which sections were differentiated in 95% ethanol until the background became appropriately clear (approximately 3–5 s). Subsequently, dehydration and clearing were performed by quickly immersing the sections in 95% ethanol I and II for 30 s each, absolute ethanol I and II for 1 min each, and xylene I and II for 2 min each. Finally, one drop of neutral balsam was placed on the tissue and a coverslip was applied for mounting, avoiding air bubbles.

2.18. BALF protein quantification

The collected BALF was centrifuged, and the protein concentration in the supernatant was determined using a BCA protein assay kit. BCA working solution was prepared by mixing reagent A and reagent B at a 50:1 ratio. A standard curve was generated according to the manufacturer's protocol. For sample measurement, 2 µL of supernatant was combined with 18 µL of standard diluent and 200 µL of BCA working solution in each well of a microplate. After incubation at 37 °C for 30 minutes, the absorbance was measured at 570 nm using a microplate reader. The protein concentration in BALF was then calculated based on the standard curve.

2.19. Quantitative real-time PCR (qRT-PCR)

The lung tissues were homogenized in a pre-cooled homogenizer using TRIzol reagent. After centrifugation, the supernatant was mixed with chloroform, vigorously shaken, and centrifuged. The aqueous phase was collected, combined with isopropanol, and centrifuged to precipitate RNA. The pellet was washed with ethanol, air-dried, and dissolved in RNase-free water for concentration measurement. Reverse transcription was performed using the Evo M-mLV RT Premix kit, followed by qRT-PCR analysis with SYBR Green Pro Taq HS Premix on a real-time PCR system.

In a pre-cooled homogenizer, tissue was homogenized using TRIzol reagent. After centrifugation, the supernatant was mixed with chloroform, vigorously vortexed, and centrifuged again. The aqueous phase was collected, mixed with isopropanol, and centrifuged to precipitate RNA. The precipitate was washed with ethanol, air-dried, and dissolved in nuclease-free water for concentration measurement. Reverse transcription was then performed using the Evo M-MLV RT Premix kit. For each well, 2 μL of DNA Clean Reaction Mix Ver.2 and 4 μL of 5 × Evo M-MLV RT Reaction Mix Ver.2 were added, along with 1 μg of total RNA, and nuclease-free water was used to bring the total volume to 20 μL per well. Reverse transcription was carried out under the following conditions: 37 °C for 15 min and 85 °C for 5 sec to obtain cDNA. Subsequently, qRT-PCR was performed using the SYBR Green Pro Taq HS Premix kit. For each well, 10 μL of 2X SYBR Green Pro Taq HS Premix, 1 μL of cDNA sample, 0.4 μL of 10 μM forward primer (Primer F), 0.4 μL of 10 μM reverse primer (Primer R), and 0.4 μL of 4 μM ROX Reference Dye were added, and nuclease-free water was used to adjust the total volume to 20 μL per well. A two-step PCR protocol was followed, and amplification with fluorescence signal detection was conducted on a RT-PCR system to achieve accurate quantitative analysis of target gene expression.

2.20. Immunofluorescence (IF)

Paraffin sections were subjected to deparaffinization following the sequence below (ensuring complete immersion in organic solvents): xylene I and II for 15 min each, absolute ethanol I and II for 10 min each, followed by immersion in 95%, 85%, and 75% ethanol for 5 min each, and finally ddH₂O for 5 min. After deparaffinization, antigen retrieval was performed. Either sodium citrate buffer (pH 6.0) or EDTA buffer (pH 9.0) was selected, and the buffer was heated to boiling using a microwave oven on medium–high heat, maintained for 8 min, and then allowed to cool naturally to room temperature. The samples were incubated with 5% goat serum matching the source of the secondary antibody for 1 h at room temperature for blocking. The diluted primary antibody was applied onto the samples and incubated overnight at 4 °C. The next day, the sections were warmed at room temperature for 20 min, washed three times with PBS, and then incubated in the dark with a fluorescently labeled secondary antibody for 1 h at room temperature. After washing three times with PBS, the samples were stained with DAPI for 8 min and washed again three times with PBS. Excess liquid was removed from the surface of the samples, an antifade mounting medium was applied, and coverslips were carefully placed. Microscopic observation was carried out using a fluorescence microscope. he primersused for qRT-PCR analysis are listed in Table 1.

Table 1.

Primer information.

Primer	Sequence 5´-3´
IL-1β (F)	TCCAGGATGAGGACATGAGCAC
IL-1β (R)	GAACGTCACACACCAGCAGGTTA
TNF-α (F)	ACTCCAGGCGGTGCCTATGT
TNF-α (R)	GTGAGGGTCTGGGCCATAGAA
IL-6 (F)	CCACTTCACAAGTCGGAGGCTTA
IL-6 (R)	TGCAAGTGCATCATCGTTGTTC
β-actin (F)	TGACAGGATGCAGAAGGAGA
β-actin (R)	GCTGGAAGGTGGACAGTGAG

2.21. Flow cytometry

The lung tissue was dissected into approximately 0.2 cm² pieces using a surgical scalpel, digested with type I collagenase at 37 °C for 30 minutes, and then gently ground through a 200-mesh sieve followed by washing with 15 mL PBS to collect the cell suspension. The suspension was centrifuged at 300 g for 5 minutes, and the supernatant was discarded. Next, 2 mL of 1x red blood cell lysis buffer was added for room temperature lysis for 2–3 minutes, followed by the addition of 10 mL PBS to terminate the reaction and repeated centrifugation. Finally, the cells were resuspended in cell staining buffer, filtered through a 200 - mesh sieve, and adjusted to a concentration of 1 × 10⁷cells/mL. Analysis was performed using a Sony ID700 flow cytometer according to the kit instructions.

The preparation of single-cell suspensions from spleen tissue followed a similar protocol to that of lung tissue, with the exception that type IV collagenase was used during the digestion step. After obtaining the suspension, antibody incubation was performed directly, followed by sample analysis.

For whole blood samples, target antibodies were first added and incubated at room temperature in the dark for 30 minutes. Then, 2 mL of 1× red blood cell lysis buffer was added for 5–10 minutes at room temperature. After washing with PBS, centrifugation at 300 g was performed to remove lysed products, and this step was repeated until the sample became clear. Finally, the samples were resuspended in cell staining buffer, centrifuged at 500 g, and adjusted for analysis. CD4⁺ T cells, CD8⁺ T cells, neutrophils, monocyte/macrophages, and Tregs were detected using a Sony ID7000 flow cytometer.

2.22. Statistical analysis

All data are presented asmean ± standard deviation (SD) from at least three independent experiments. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by Tukey, s post hoc test. All statistical analyses were conducted with GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA, USA). The significance thresholds were defined as follows: Compared with the Model group,*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; compared with the Tyr-MM@PLGA/G + F group, ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001; ns: Not statistically significant.

3. Results

3.1. Synthesis and characterization of nanoparticles

To verify the synthesis of the targeted peptide and the construction of Tyr-MM@PLGA/G+F, multiple characterization methods were employed.

First, Figure 1A confirms the successful synthesis of DSPE-PEG-Tyr. The presence of phenolic hydroxyl groups and benzene rings led to four absorption bands of the benzene ring's C=C bond stretching vibration near 1600 cm⁻¹, 1580 cm⁻¹, 1500 cm⁻¹, and 1450 cm⁻¹, with the peak at 1500 cm⁻¹ being the strongest, followed by 1600 cm⁻¹. The solid material caused the absorption peak of the hydroxyl group to shift to 3500 - 3200 cm⁻¹ with a wide and strong shape.

Figure 1.

Physicochemical characterization of Tyr-MM@PLGA/G+F nanoparticles. (A) FTIR spectroscopy confirming the successful conjugation of targeting peptides. (B) Transmission electron microscopy revealing nanoparticle morphology. (C) Zeta potential measurements demonstrating surface charge characteristics. (D) Dynamic light scattering showing hydrodynamic diameter distributions. (E) Western blot verification of characteristic membrane protein retention. (F) Quantitative analysis of dual-drug (geraniol/FK13-a1) encapsulation efficiency.

Transmission electron microscopy was then used to observe the construction of Tyr-MM@PLGA/G+F, as shown in Figure 1B. PLGA/G+F had a good morphology, appearing as a regular circle. In the MM@PLGA/G+F group, a distinct capsid structure was visible, and after adding the targeted peptide, fine point - like particles were present due to the membrane build - up of DSPE - PEG - Tyr on the surface.

Zeta potential measurements in Figure 1C reveal the surface charge alterations resulting from the synthesis process. During synthesis, 0.2% CS was added as the outer aqueous phase, making the material positively charged due to protonated amino groups in a neutral solution. However, after introducing the negatively - charged macrophage cell membrane and surface - modifying with DSPE-PEG-Tyr, the net charge became approximately - 1.5, increasing the material's electronegativity as expected.

Figure 1D shows a ~14 nm increase in PLGA/G+F nanoparticle size post membrane coating, with additional enlargement after targeting peptide attachment.

Finally, blotting characterization confirmed that surface markers CD68, CCR2, and TNFR2 of the macrophage cell membrane were retained in the extracted membrane (Figure 1E). Further analysis of MM@PLGA/G+F and Tyr-MM@PLGA/G+F showed that the nanomaterials successfully inherited the macrophage cell membrane and preserved its surface functional proteins.

3.2. Drug loading rate

In order to accurately assess the contents of Geraniol and FK13-a1 in Tyr-MM@PLGA/G+F, we collected the supernatants obtained from the synthesis of PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F after centrifugation. The supernatants were diluted and brought into the standard curve to obtain the dosage of the drug involved in the supernatant. Indirectly calculate the drug concentration in nanomaterials. Figure 1F reveals that the drug loading rates of different groups of materials for Geraniol and FK13-a1 do not change much. Among them, the drug loading rates of Tyr-MM@PLGA/G+F for Geraniol and FK13-a1 are 78% and 26%, respectively.

3.3. Antibacterial activity of Tyr-MM@PLGA/G+F in vitro

FK13-a1 and Geraniol both exhibit antibacterial activity (Rajasekaran et al. 2017; Kermanian et al. 2025). Against MRSA, the MIC and MBC values of the two agents were determined, along with their combined antibacterial efficacy. As shown in Table 2, the MIC and MBC of FK13-a1 were 8 μg/mL and 16 μg/mL, respectively, while those of Geraniol were 340 μg/mL and 690 μg/mL. The FIC index for their combination was 0.3125, indicating a synergistic antibacterial effect. In addition, the formulation demonstrated excellent synergistic antibacterial activity against Pseudomonas aeruginosa.

Table 2.

Antibacterials effects of drugs.

Bacterial	Geraniol		FK13-a1		Geraniol + FK13-a1
	MIC (μg/mL)	MBC (μg/mL)	MIC (μg/mL)	MBC (μg/mL)	FIC
MRSA	340	690	8	16	Synergy
E.coli	429	858	320	1280	Additive Effect
Pseudomonas aeruginosa	142.5	862	8	64	Synergy

Furthermore, a 24-hour time-kill curve assay was employed to further evaluate the antibacterial performance of Tyr-MM@PLGA/G+F. Figure 2A shows that under drug intervention, the Geraniol alone group did not reach an effective inhibitory concentration, leading to relatively rapid bacterial growth, although some inhibitory effect was still evident. Both FK13-a1 alone and the combination of FK13-a1 with Geraniol exerted significant inhibitory effects, maintaining the absorbance values near those of the medium-only control group (No MRSA). When the drugs were encapsulated into PLGA, both Geraniol and FK13-a1 exhibited a sustained release profile, which resulted in a slight increase in absorbance; however, significant inhibitory effects were still maintained. Among all tested groups, Tyr-MM@PLGA/G + F demonstrated the best antibacterial efficacy.

Figure 2.

In vitro antibacterial and anti-inflammatory effects of Tyr-MM@PLGA/G+F nanoparticles. (A) Time-kill curves against MRSA over 24 hours. (B) Viability of RAW264.7 macrophages (CCK-8 assay). (C) Nitric oxide (NO) production in culture supernatants. (D) Pro-inflammatory cytokine levels (a. TNF-α, b. IL-6, and c. IL-1β) quantified by ELISA. (E) IL-10 expression analyzed by immunofluorescence staining.

3.4. Anti-inflammatory activity of Tyr-MM@PLGA/G+F in vitro

Infection-induced inflammatory response is a crucial immune defense mechanism of the organism (Pereira and Leite 2016; Al-Barazie et al. 2018; Xu et al. 2018). However, an overactivated immune system can trigger a cascade reaction due to the massive and rapid release of a large number of inflammatory mediators, leading to severe consequences such as multiple organ dysfunction and even death (Lv et al. 2017; Li et al. 2021). Therefore, controlling the inflammatory response is of vital importance for the treatment of infections. In our study, we utilized lipopolysaccharide (LPS) and ATP to induce the differentiation of RAW264.7 cells into the M1 phenotype, which results in the production of substantial amounts of pro-inflammatory factors including NO, TNF-α, IL-6, and IL-1β. While these factors are instrumental in resisting pathogen invasion, they can also cause cellular damage. Cell Counting Kit-8 (CCK-8) assay demonstrated that, compared with the model group, Tyr-MM@PLGA/G+F significantly increased the survival rate of RAW264.7 cells, as shown in Figure 2B, which might be attributed to the anti-inflammatory effects of FK13-a1 and Geraniol. Our results from NO kit detection and enzyme-linked immunosorbent assay (ELISA) indicated that, in RAW264.7 cells treated with Tyr-MM@PLGA/G+F, the expressions of NO, TNF-α, IL-6, and IL-1β were significantly reduced compared to the model group (Figure 2C, 2D).

Furthermore, immunofluorescence analysis was employed to evaluate the effect of Tyr-MM@PLGA/G+F on the expression of the anti-inflammatory cytokine IL-10 in macrophages. Figure 2E demonstrated a significant upregulation of IL-10 in macrophages following Tyr-MM@PLGA/G+F treatment, strongly suggesting its ability to polarize macrophages from a pro-inflammatory to an anti-inflammatory phenotype. Other treatment groups also exhibited notable improvements in IL-10 expression. These findings collectively suggest that Tyr-MM@PLGA/G+F possesses anti-inflammatory properties.

3.5. Evaluation of the targeted anti-inflammatory effect of Tyr-MM@PLGA/G+F in vivo and in vitro

MRSA-induced ALI is a complex biological process involving the interaction of various inflammatory cells and molecules. It is characterized by a significant infiltration of inflammatory cells, such as neutrophils and macrophages, along with excessive secretion of MPO and reactive ROS. To study this, we constructed an in vitro model to simulate pulmonary inflammation and used SEM for morphological analysis. Figure 3A presents SEM images demonstrating that the materials PLGA/G+F and MM@PLGA/G+F, which did not carry targeted peptides, did not exhibit significant aggregation. However, the material carrying the antimicrobial peptide tyrosine exhibited significant aggregation in the inflammatory environment.

Figure 3.

Targeting capability of Tyr-MM@PLGA/G+F. (A) In vitro SEM imaging of inflammatory cell-nanoparticle interactions. (B) In vivo targeting efficacy to inflamed lungs in the injury model.

To investigate the lung-targeting potential of PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F, the macrophage membrane was labeled using DIR. The labeled PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F were then intravenously injected into mouse model. After 24 hours, the distribution status was assessed by observing the fluorescence distribution in the mice. Following the intravenous injection, live fluorescence imaging was performed on the mice 24 hours later. As shown in Figure 3B, PLGA/G+F is primarily distributed in the liver, with only a small amount present in the lung tissue, consistent with previous studies. When MM was added to form MM@PLGA/G+F, the substance accumulated more in the lung tissue damaged by MRSA-induced sepsis, as expected. When the inflammatory targeting peptide Tyr was introduced to form Tyr-MM@PLGA/G+F, the targeting effect guided most of the Tyr-MM@PLGA/G+F to the lungs, achieving optimal therapeutic results.

3.6. The influence of survival indicators on mice with lung injury models

Figure 4A illustrates the experimental timeline for MRSA-induced ALI modeling, including drug administration and tissue collection procedures. MRSA-infected mice developed significant morbidity, as evidenced by reduced survival (Figure 4B) and substantial weight loss (Figure 4C). During the four-day observation period, the survival rate dropped sharply to only 10%. During this time, the body weight of the mice decreased significantly, and their activity ability also weakened noticeably. In contrast, the treatment groups administered intravenously with PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F showed different manifestations. The survival rates were 40% for PLGA/G+F-treated mice and 60% for those receiving MM@PLGA/G+F. The Tyr-MM@PLGA/G+F group performed most prominently, with a survival rate as high as 70%. In terms of body temperature and weight, all treatment groups showed a trend of rising to normal levels around the third or fourth day. Overall, in the MRSA-induced ALI model mouse experiment, Tyr-MM@PLGA/G+F demonstrated the best effect, effectively improving the survival rate of mice.

Figure 4.

Survival metrics and pulmonary injury severity in MRSA-induced ALI. (A) Experimental workflow for MRSA-sepsis lung injury model. (B) Kaplan-Meier survival curves. (C) Longitudinal body weight changes. (D) Lung wet/dry weight ratio (pulmonary edema indicator). (E) Protein concentration in bronchoalveolar lavage fluid (BALF). (F, G) Histopathological scoring of lung tissues (H&E staining). (H, I) Pulmonary bacterial load (CFU/ml tissue).

3.7. The W/D weight ratio of the lungs and the total protein content in alveolar lavage fluid

The breathing of the mice in the model group was abnormal to varying degrees, and there were respiratory disorders. Through the analysis of the W/D ratio of lung tissue (Figure 4D), it can be known that the ratio of the model group is significantly higher than that of the other groups. This data discrepancy strongly indicates that it is highly likely that the mice in the model group have experienced relatively significant lung tissue edema. In contrast, after treatment with Tyr-MM@PLGA/G+F, the edema of lung tissue in mice was significantly improved, indicating that Tyr-MM@PLGA/G+F shows a good effect in alleviating lung tissue edema. In this study, quantitative analysis was conducted on the total protein content in BALF. Figure 4E shows that in the experimental group treated with Tyr-MM@PLGA/G+F, the total BALF protein level decreased significantly compared with the model group. The change in this key data strongly indicates that this compound drug has achieved remarkable results in improving lung injury and regulating vascular permeability. Specifically, the total protein content of BALF is an important biomarker for measuring the integrity of the alveola-capillary barrier. A decrease in its concentration directly reflects that the drug has a protective effect on the intercellular connections of pulmonary microvascular endothelial cells.

3.8. H&E staining and histopathological scoring of lung tissue

Based on the lung tissue pathology scoring criteria, which evaluates multiple aspects including the degree of inflammatory cell infiltration, the integrity of alveolar structure, and the status of pulmonary interstitial edema, we conducted a comprehensive statistical analysis of the lung tissue sections from mice. As shown in Figure 4F and 4G, compared to the un-treated control group, all treatment groups showed significant improvements in reducing lung damage. Notably, the Tyr-MM@PLGA/G+F treatment group performed exceptionally well. In terms of inflammatory cell infiltration, the control group exhibited a significant accumulation of inflammatory cells in the lungs, whereas the number of inflammatory cells was markedly reduced in the Tyr-MM@PLGA/G+F group. When examining the alveolar structure, the control group showed extensive collapse and fusion of alveoli, while the alveolar structure in the Tyr-MM@PLGA/G+F group was relatively intact, with a significant improvement in the collapse and fusion phenomena. Regarding pulmonary interstitial edema, the interstitium in the control group was significantly widened, with a substantial amount of fluid leakage, whereas the interstitial edema in the Tyr-MM@PLGA/G+F group was markedly reduced. Overall, the Tyr-MM@PLGA/G+F treatment group significantly reduced lung damage, demonstrating a more effective outcome compared to other treatment groups.

3.9. Analysis of bacterial load changes after treatment

Aseptic techniques were used to extract lung tissue, which was then prepared into a homogenate using a tissue grinder to ensure the full release of bacteria. After performing gradient dilutions, plate coating, and colony counts, it was found that each milliliter of lung tissue homogenate contained a certain amount of bacterial load (CFU/ml). Figure 4H and 4I clearly demonstrate that 24 hours after infection, MRSA had proliferated significantly in the lung tissue of mice, reflecting the invasive effects of MRSA on the lungs. Among these treatments, PLGA/G+F had limited effectiveness in reducing bacterial load, but MM@PLGA/G+F and Tyr-MM@PLGA/G+F effectively reduced the bacterial load, with Tyr-MM@PLGA/G+F approaching normal levels.

3.10. Changes in inflammatory factors at different levels

The ELISA method was used to detect changes in the levels of inflammatory cytokines, including IL-1β, IL-6, and TNF-α, in the BALF of each group of mice. As shown in Figure 5A–5C, compared to the normal control group, the levels of pro-inflammatory factors IL-1β, IL-6, and TNF-α in the ALV of the model group mice were significantly elevated. In contrast, mice with lung injury treated with PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F exhibited significantly reduced levels of these inflammatory factors in BALF, demonstrating potent anti-inflammatory effects.

Figure 5.

In vivo anti-inflammatory effects of Tyr-MM@PLGA/G+F. (A–C) Levels of IL-1β, IL-6, and TNF-α in bronchoalveolar lavage fluid (BALF). (D–F) mRNA expression of IL-1β, IL-6, and TNF-α in lung homogenates (qRT-PCR). (G) TNF-α protein expression in lung tissue sections (immunohistochemistry).

To investigate the gene-level expression changes of inflammatory factors, we used qRT-PCR to measure the mRNA levels of relevant inflammatory factors. As shown in Figure 5D–5F, compared to the Normal group, the mRNA levels of pro-inflammatory factors IL-1β, IL-6, and TNF-α in the Model group were significantly elevated. Specifically, in the Tyr-MM@PLGA/G+F group, compared to the Model group, the mRNA levels of pro-inflammatory factors TNF-α, IL-1β, and IL-6 were significantly reduced. This qRT-PCR result is highly consistent with the previous ELISA results, indicating that Tyr-MM@PLGA/G+F effectively inhibits the mRNA expression of inflammatory factors, thereby regulating the inflammatory response at the gene transcription level.

In the immunofluorescence detection process, we used specific fluorescent markers to label the pro-inflammatory factor TNF-α, allowing for a clear observation of their expression in tissue sections (Figure 5G). The results from the detection show that, compared to the model group, the membrane biomimetic nanomaterials PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F all played a positive role in reducing the expression of the pro-inflammatory factor TNF-α. Notably, the reduction was particularly significant with Tyr-MM@PLGA/G+F. Under a microscope, the lung tissue of the model group exhibited a strong fluorescence signal for TNF-α, indicating high expression levels. In contrast, the fluorescence intensity in the treatment group with Tyr-MM@PLGA/G+F was significantly reduced, clearly demonstrating its effective suppression of inflammatory responses. Collectively, these results demonstrate that Tyr-MM@PLGA/G+F exhibits significant anti-inflammatory properties.

3.11. The impact of drugs on immune function

To comprehensively evaluate the immunomodulatory effects of Tyr-MM@PLGA/G+F in MRSA-infected mice, this study employed flow cytometry to dynamically monitor the frequency changes of immune cell subsets. The results demonstrated that Tyr-MM@PLGA/G+F effectively suppressed the pathological elevation of neutrophils in the lungs, spleen, and peripheral blood induced by MRSA (Figure 6A, 6E, 6I), and significantly reduced the infiltration of alveolar macrophages, indicating its regulatory role in curbing the overactivation of innate immunity.

Figure 6.

Immunomodulatory effects of Tyr-MM@PLGA/G+F in vivo. (A–D) Proportion of neutrophils, CD4⁺T cells, CD8⁺T cells and Treg cells in lung cell flow. (E–H) Proportion of neutrophils, CD4⁺T cells, CD8⁺T cells and Treg cells in spleen cell flow. (I–L) Proportion of neutrophils, CD4⁺T cells, CD8⁺T cells and Treg cells in blood cell flow.

Severe infectious diseases are often accompanied by impaired adaptive and innate immune functions, leading to an immunosuppressive state that increases the risk of secondary infections and patient mortality. One of the key mechanisms underlying this phenomenon is lymphopenia caused by increased lymphocyte apoptosis (Hotchkiss et al. 1999; Zhang et al. 2021; Luperto and Zafrani 2022). Studies have shown that in infections such as SARS-CoV-2, both CD4⁺ and CD8⁺ T cells are reduced in number and functionally impaired (Lucas et al. 2020). Roquilly et al. further revealed that in bacterial or viral pneumonia models, the diminished antigen-presenting capacity of local dendritic cells and their production of TGF-β could recruit a large number of peripherally induced regulatory T cells (Tregs), thereby leading to secondary immunosuppression and increasing susceptibility to recurrent infections (Roquilly et al. 2017).

Based on this mechanistic background, this study systematically analyzed the proportions of CD4⁺ T cells, CD8⁺ T cells, and Tregs in the lungs (Figure 6B–6D), spleen (Figure 6F–6H), and blood (Figure 6J–6L). The results showed that Tyr-MM@PLGA/G+F significantly reversed the depletion of CD4⁺ and CD8⁺ T cells and reduced the proportion of immunosuppressive Tregs in MRSA-induced ALI mice. These findings indicate that Tyr-MM@PLGA/G+F plays a crucial role in immune regulation during MRSA-induced lung injury by modulating the balance of T cell subsets, thereby helping to ameliorate the immunosuppressive state and restore immune homeostasis in ALI mice.

3.12. Evaluation of the therapeutic effects on oxidative stress and liver and kidney injuries

During the oxidative stress process, a significant amount of oxygen free radicals is produced, which often leads to tissue and organ damage. This phenomenon plays a crucial role in the pathogenesis of ALI and is considered a key factor in the development of lung damage and failure (Kumar 2020; Yao et al. 2022; Sun et al. 2023). To investigate this, the study used a kit method to detect changes in oxidative stress indicators in lung tissue. The results are shown in Figure 7A–7D. Compared with the normal control group, the model group mice showed significantly increased levels of MPO activity and MDA content in their lung tissue, while the activities of antioxidant enzymes, such as CAT and SOD, were markedly reduced. After treatment with PLGA/G+F, MM@PLGA/G+F, and Tyr-MM@PLGA/G+F, the oxidative stress indicators in the lung tissue of the mice decreased, and the activity of antioxidant enzymes improved. Overall, in improving the oxidative stress status of MRSA-induced ALI, Tyr-MM@PLGA/G+F demonstrated stronger effects compared to other groups, effectively regulating the oxidative-stress balance in lung tissue, which is of great significance for alleviating MRSA-induced ALI.

Figure 7.

Therapeutic effects of Tyr-MM@PLGA/G+F on oxidative stress and hepatorenal injury. (A–D) SOD, MPO, CAT and MDA levels in lung tissue. (E–H) ALT, AST, BUN and CAT levels in Serum.

Sepsis, a severe condition, often leads to multi-organ damage, with multi-organ failure being a significant marker of its high mortality. To investigate the therapeutic effects of Tyr-MM@PLGA/G+F in preventing multi-organ failure, we conducted a comprehensive biochemical analysis of the collected mouse serum and plasma. During the experiment, after the mice were induced, significant changes occurred in their bodies. Serum biomarkers reflecting liver and kidney damage were tested, results are shown in Figure 7E–7H, the levels of ALT, as an indicator of liver function, and AST, as an indicator of kidney function, along with BUN and CR, which are indicators of renal function, were significantly elevated. This clearly indicates that MRSA-induced ALI has caused damage to the liver and kidneys of the mice. However, it is noteworthy that after treatment with Tyr-MM@PLGA/G+F, the situation improved positively. The levels of these serum biomarkers in the treated mice gradually decreased. For example, the ALT levels in the untreated model group mice rose sharply after induction, while in the Tyr-MM@PLGA/G+F treated group mice, the ALT levels steadily decreased to near-normal baseline levels after a period of treatment. Similarly, AST, BUN, and CR also showed similar trends, indicating that Tyr-MM@PLGA/G+F effectively protected the organs from infection-induced damage, reducing various biochemical parameters to near-normal baseline levels, demonstrating good therapeutic effects in preventing multi-organ failure.

4. Discussion

Infection-induced ALI represents a major cause of high mortality in intensive care units, particularly when triggered by methicillin-resistant MRSA, posing significant challenges for clinical management (Singer et al. 2016; Torres et al. 2017; Wang et al. 2022; Alnimr 2023). This study successfully developed a membrane-biomimetic nanomaterial, Tyr-MM@PLGA/G+F, and systematically evaluated its antibacterial, anti-inflammatory, and immunomodulatory effects against MRSA in both in vitro and in vivo models. The results demonstrated that treatment with Tyr-MM@PLGA/G+F significantly alleviated MRSA-induced ALI. The underlying mechanisms included effective bacterial clearance, suppression of neutrophil infiltration into the lungs, reduction in pro-inflammatory cytokine and oxidative stress factor release, as well as marked improvements in pulmonary edema and vascular permeability, thereby mitigating lung tissue histopathological damage. These findings collectively indicate that Tyr-MM@PLGA/G+F holds promising potential for the treatment of MRSA-induced ALI.

Antibiotics remain the cornerstone of treating deep-seated organ infections, but the growing problem of bacterial resistance has made the search for alternative or adjuvant therapies extremely urgent (Brown and Wright 2016; Theuretzbacher et al. 2020). However, traditional physical or chemical disinfection methods (such as ultraviolet irradiation or the use of alcohol and iodine) face significant challenges in combating deep-seated infections: they are often unable to be effectively delivered to the internal site of infection, and due to their non-selective cytotoxicity—harming host cells and pathogens alike—they cause unacceptable organ toxicity, thus hindering clinical application. In this context, AMPs have garnered significant attention as a highly promising therapeutic strategy (Lei et al. 2019; Mookherjee et al. 2020). Recent research, utilizing advanced bioengineering techniques to functionally modify natural AMPs, has significantly enhanced their targeting capability and therapeutic efficacy. This demonstrates their great potential in combating deep-seated infections. For instance, Zhen Guo et al. rationally designed and functionally modified the natural AMP GL22, endowing it with self-assembling properties and pH-responsive characteristics (Guo et al. 2024). This modification enables specific activation in the acidic microenvironment of the stomach, leading to efficient eradication of Helicobacter pylori. Similarly, Xiaoguang Zhang et al. developed an ultrasound-activated short peptide, FFRK8, which achieved remarkable therapeutic outcomes characterized by ‘controllable bactericidal activity, low toxicity, and high penetration’ in rat and goat models of intervertebral disc infection (Zhang et al. 2025).

In severe infections such as pneumonia, the lungs accumulate a large number of immune cells and release excessive inflammatory factors (Chousterman et al. 2017). This process disrupts the normal structure of alveoli, leading to pulmonary edema and respiratory failure. It is noteworthy that patient mortality in such cases results not only from direct damage by the pathogen but also, more critically, from the destructive effects of the infection-triggered hyperinflammatory response on lung tissue (Meyer et al. 2021). Therefore, actively controlling inflammation has become a key therapeutic strategy alongside anti-infective treatment. Geraniol, a natural monoterpenoid widely found in essential oils of plants such as rose, lemongrass, and citronella, is not only commonly used as a fragrance but has also been demonstrated to possess multiple significant pharmacological activities. According to research by Peramaiyan Rajendran et al., geraniol effectively alleviated neuroinflammation and oxidative stress in animal models by inhibiting the NF-κB signaling pathway and exerting antioxidant effects (Rajendran et al. 2024). Based on its anti-inflammatory and antioxidant mechanisms, geraniol shows potential for treating MRSA-induced ALI.

In recent years, combined antibacterial and anti-inflammatory therapy has emerged as a key research direction for complex infectious diseases (Li et al. 2025; Wang et al. 2025; Yu et al. 2025). Geraniol not only significantly reduces the release of pro-inflammatory cytokines such as TNF-α and IL-6 but also improves mitochondrial function and mitigates oxidative stress damage via activation of the AMPK/SIRT1 pathway, thereby providing protection for lung tissue. On the other hand, FK13-a1, a short peptide derived from the human antimicrobial peptide LL-37, effectively disrupts the cell membrane structure of MRSA (Hou et al. 2013). Its physical bactericidal mechanism substantially reduces the risk of resistance development. The combination of these two agents simultaneously targets three pathological processes—infection (bactericidal effect), inflammation (control of excessive immune response), and tissue injury (antioxidant and energy repair)—potentially breaking the vicious cycle of ALI.

Stimulus-responsive nanosystems (such as pH- or ROS-sensitive platforms) have been widely explored for the treatment of ALI (Luo et al. 2021; Muhammad et al. 2022; Xia et al. 2024; Song et al. 2025), their activation mechanisms are commonly present across various inflammatory diseases, which somewhat limits targeting specificity. Based on the significantly upregulated oxidoreductase expression in the ALI microenvironment, this study innovatively designed a tyramine-based enzyme-responsive nano-drug delivery system, achieving a more disease-selective drug retention pattern. This strategy is particularly suited for the ALI microenvironment induced by MRSA, which is characterized by severe infection and excessive inflammation. By precisely responding to enzymic signals specifically elevated in the pathogenic microenvironment, our system effectively overcomes the limited targeting precision of conventional stimulus-responsive strategies.

Although current studies have demonstrated favorable targeting accumulation and therapeutic potential of such biomimetic nanosystems in deep tissue infection models, their large-scale production still faces challenges such as the stability of membrane coating processes and batch-to-batch consistency (Yao et al. 2023; Lopes et al. 2025). To advance the clinical translation of this system, future research should focus on two key directions: first, optimizing synthesis protocols to enhance production controllability and promote its development into a precise and efficient treatment for infection-associated acute lung injury; second, systematically comparing different administration routes (e.g. nebulized inhalation, intratracheal instillation) with the intravenous strategy validated in this study to clarify their respective advantages and applicable scenarios, thereby determining the optimal therapeutic window and personalized dosing regimens for different stages of infection (e.g. localized early-stage infection versus severe infection with systemic dissemination). Through the dual advancement of technological optimization and strategic exploration, the transition of this nanosystem from basic research to clinical application can be accelerated.

5. Conclusions

In this study, a biomimetic membrane-fused nanomaterial Tyr-MM@PLGA/G+F with inflammatory targeting capability was successfully developed, and its therapeutic potential was systematically evaluated in an MRSA-induced ALI murine model. The results demonstrated that this nanosystem enables precise targeted delivery and exhibits excellent multi-modal synergistic effects, including anti-inflammatory, antioxidant, pulmonary tissue repair, and immunomodulatory properties. It significantly reduced the bacterial load at the infection site, while improving survival rates and multiple key physiological parameters in the model animals. This work not only provides a translatable strategy for the clinical treatment of drug-resistant bacterial-induced severe pulmonary infections, but also offers important design concepts and experimental evidence for the development of multifunctional synergistic nanodrug systems.

Funding Statement

This work was financially supported by the National Natural Science Foundation of China (No. 82372161), the Shenzhen Science and Technology Program (No. JCYJ20220530150412027, JCYJ20250604180738049), the Shenzhen Fund for Guangdong Provincial High level Clinical Key Specialties (No. SZGSP006), the Sanming Project of Medicine in Shenzhen (No. SZSM202011008, SZSM202211016), Shenzhen Key Medical Discipline Construction Fund (No. SZXK066, SZSM202211016), Guangdong Basic and Applied Basic Research Foundation (No. 2023B1515230005).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Funding

This work was financially supported by the National Natural Science Foundation of China (No. 82372161), the Shenzhen Science and Technology Program (No. JCYJ20220530150412027, No. JCYJ20250604180738049), the Shenzhen Fund for Guangdong Provincial High level Clinical Key Specialties (No. SZGSP006), the Sanming Project of Medicine in Shenzhen (No. SZSM202011008, No. SZSM202211016), Shenzhen Key Medical Discipline Construction Fund (No. SZXK066), Guangdong Basic and Applied Basic Research Foundation (No. 2023B1515230005).

Data availability statement

The data will be provided by the authors on request.

Ethical approval

All animal procedures in this study were strictly conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals. The experimental protocols were approved by the Animal Care and Use Committee of Guangdong Pharmaceutical University (Acceptance No.: gdpulacspf2022407), and all experiments were performed in a facility accredited with a valid Institutional Animal Use License (License No.: SYXK (Yue) 2012-0125).