Abstract
Purpose
Fuchs’ endothelial corneal dystrophy (FECD) is the leading cause of corneal endothelial dystrophy. This study aimed to investigate the protective effects and mechanism of taurochenodeoxycholic acid (TCDCA) in FECD.
Methods
TCDCA levels were quantified in aqueous humor from patients with FECD and ultraviolet A (UVA)-induced FECD mice. Corneal endothelial cell (CEC) morphology and function were evaluated by optical coherence tomography (OCT) and ZO-1 staining following TCDCA treatment. In vitro, UVA-induced human corneal endothelial cells (HCECs) were treated with TCDCA, and cell viability, mitochondrial membrane potential, ATP, and reactive oxygen species (ROS) levels were measured. RNA sequencing (RNA-seq) and quantitative real-time PCR (qRT-PCR) were used to explore molecular mechanisms, and the role of Ca²⁺ signaling was validated using the inhibitor 2-APB in vivo.
Results
Analysis of FECD aqueous humor revealed significantly elevated TCDCA levels. In UVA-induced mouse model, TCDCA administration ameliorated corneal endothelial dysfunction, as evidenced by reduced corneal thickness, increased endothelial cell density, and a lower percentage of abnormal cells. Further, in vitro studies revealed a concentration-dependent effect of TCDCA, with 100 µM TCDCA significantly enhancing cell viability, reducing ROS production, restoring mitochondrial membrane potential, and promoting ATP synthesis. RNA-seq and functional studies identified that TCDCA exerts its beneficial effects on corneal endothelial function by activating the calcium signaling pathway.
Conclusions
TCDCA demonstrated a protective effect on corneal endothelial cells during the pathogenesis of FECD. Therefore, TCDCA may be a promising novel therapeutic target for attenuating the progression of FECD.
Keywords: corneal endothelial cells (CECs), Fuchs’ endothelial corneal dystrophy (FECD), taurochenodeoxycholic acid (TCDCA), mitochondrial activity, Ca2+ signaling pathway
The cornea is an avascular, transparent tissue composed of five distinct layers: the corneal epithelium, Bowman’s layer, stroma, Descemet’s membrane, and corneal endothelium (CE). The CE, located at the inner surface of the cornea, consists of a monolayer of hexagonal cells with limited regenerative capacity in vivo. Damage or loss of corneal endothelial cells (CECs) often lead to corneal edema and visual impairment.1,2 Fuchs endothelial corneal dystrophy (FECD) is a hereditary ocular disease characterized by progressive CEC loss and abnormal thickening of Descemet’s membrane, predominantly affecting the middle-aged and elderly population. As the disease advances, endothelial dysfunction results in corneal swelling and blurred vision. Currently, corneal transplantation remains the primary clinical treatment; however, donor shortages and postoperative complications limit its widespread application.3 Therefore, pharmacological strategies to repair or delay CEC damage have become a significant research focus.
TCDCA is a conjugated bile acid formed by the combination of chenodeoxycholic acid (CDCA) and taurine, and is classified as a secondary bile acid in the human body. TCDCA plays a critical role in modulating bile flow, dissolving cholesterol crystals, and regulating hepatoenteric metabolis.4,5 In recent years, TCDCA has been increasingly recognized for its diverse biological activities, including involvement in inflammatory responses,6,7 mediation of apoptosis,8 modulation of oxidative stress,2 and protection of mitochondrial function.9,10 Tauroursodeoxycholic acid (TUDCA), a C-7 epimer of TCDCA, has garnered considerable attention in ophthalmic research. Previous studies have demonstrated that TUDCA reduces apoptosis and delays retinal degeneration by inhibiting endoplasmic reticulum stress and oxidative stress, while preserving mitochondrial membrane stability.11 Additionally, TUDCA promotes corneal epithelial cell viability and restores epithelial homeostasis in dry eye conditions.12 It has also been shown to improve the barrier function of diabetic retinal endothelial cells by suppressing endoplasmic reticulum (ER) stress and reducing O-GlcNAcylation.13 Therefore, as a physiologically derived and relatively safe metabolite, TCDCA may represent a promising corneal endothelial protectant and offer a safe and effective pharmacological strategy for the treatment of FECD and other corneal endothelial disorders.
This study identified elevated TCDCA in patients with FECD aqueous humor according to metabolomics analysis and used ultraviolet A (UVA)-induced mouse model to explore TCDCA's role in CEC homeostasis. TCDCA administration prevented and reversed UVA-induced CEC damage in vivo, enhanced proliferation and mitochondrial function in vitro, and acted via Ca²⁺ signaling, with inhibition reversing its effects. These results highlight TCDCA's therapeutic potential for FECD and related disorders.
Methods
Aqueous Humor Metabolomic Analysis
The clinical samples used in this study followed the principles of the Declaration of Helsinki and was approved by the Ethics Committee of Shandong Eye Hospital with the informed consent of all patients. Aqueous humor from age-related patients with cataract (control) and patients with FECD was collected and centrifuged to remove debris (Table 3). Metabolite profiling was performed by liquid-chromatography tandem mass spectrometry (LC-MS/MS; PTM BIO, Hangzhou, China) using a high-resolution mass spectrometer. Data were processed using standardized workflows. All procedures complied with ethical and quality control standards.
Table 3.
Patient ID
| Patients | Gender | Age |
|---|---|---|
| Fuchs’ endothelial dystrophy | ||
| 1 | Female | 66 |
| 2 | Female | 69 |
| 3 | Male | 66 |
| 4 | Female | 72 |
| 5 | Male | 70 |
| 6 | Female | 61 |
| Age-related cataract | ||
| 1 | Male | 70 |
| 2 | Female | 71 |
| 3 | Female | 69 |
| 4 | Male | 63 |
| 5 | Female | 68 |
| 6 | Male | 60 |
| 7 | Female | 65 |
| 8 | Female | 69 |
Animals
Female C57BL/6 mice (7 to 8 weeks old) produced by Beijing Vital River Laboratory Animal Technology Co., Ltd. were used in the experiment. The mice were housed in a specific pathogen-free environment at the Shandong Eye Institute animal facility. All animals were treated in accordance with the guidelines established by the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Public Health Policy on Humane Care and Use of Laboratory Animals (US Public Health Review), and this study was approved by the Ethics Committee of Shandong First Medical University under the ethical approval number W2024022700029.
Cell Culture
Human corneal endothelial cells (HCECs) were cultured in flasks coated with 10 mg/mL laminin and 10 mg/mL chondroitin sulfate (Sigma-Aldrich, USA). Cells were maintained in human endothelial serum-free medium (Creative Bioarray, USA) supplemented with 3% fetal bovine serum (ExCell Bio, China) and 1% penicillin-streptomycin (Millipore, USA) at 37°C in a 5% CO₂ incubator. Upon reaching 90% confluence, the cells were passaged with trypsin and used for experiments under the same conditions.
Measurement of TCDCA Concentration
TCDCA were measured using the TCDCA-ELISA detection kit (F0351-0B, Fankewei, China) according to the manufacturer's instructions. The concentrations of TCDCA were determined in serum samples from patients with FECD and aqueous humor from UVA irradiation mice using a microplate spectrophotometer.
UVA Irradiation of Mouse Cornea and HCECs
Based on the established methodology from Professor Jurkunas’ prior research,14 a UVA-induced murine corneal endothelial damage model was established by delivering 500 J/cm² UVA (398 mW/cm², Thorlabs, m365LP1) to a 4 mm corneal area for 20 minutes and 57 seconds. Corneal morphology and central corneal thickness (CCT) were evaluated at baseline and on days 2, 4, and 6 using slit-lamp (BQ900, Haag-Streit, Switzerland) and OCT (OPTOVUE, USA); tissues were harvested on day 7. In vitro, HCECs were exposed to 365 nm UVA (14.77 mW/cm², Analytik Jena, XX-15L) at a distance of 10 cm for 55 minutes and 30 seconds (50 J/cm²) and incubated in serum-free medium for 24 hours before analysis.
Immunohistochemistry
Corneal tissues were fixed in 4% paraformaldehyde, dehydrated, embedded, sectioned, and subjected to deparaffinization, rehydration, and antigen retrieval. After blocking endogenous peroxidase and nonspecific binding with hydrogen peroxide and 5% BSA, sections were incubated overnight at 4°C with anti-Farnesoid X Receptor (FXR) antibody (1:200, Proteintech, #25055-1-AP), followed by HRP-conjugated secondary antibody (Gene Tech, China) for 2 hours at room temperature. DAB was used for visualization, and slides were counterstained with hematoxylin, dehydrated, and imaged (OLYMPUS-BX60, China).
Immunofluorescence
After enucleation, corneas were fixed in 4% paraformaldehyde for 10 minutes at room temperature, permeabilized with 0.1% Triton X-100 for 5 minutes, and blocked for 1.5 hours. Tissues were incubated overnight at 4°C with primary antibodies against ZO-1 (1:200, Thermo Fisher, #40-2200) and Na⁺/K⁺-ATPase (1:200, Millipore, #05369), followed by incubation with secondary antibodies (1:200, Abcam, #150076 and #150077) for 2 hours at room temperature. Nuclei were stained with DAPI for 5 minutes. Fluorescence images were obtained using a confocal microscope (Zeiss LSM800).
Quantitative Real-Time PCR
Total RNA was extracted from HCECs and reverse-transcribed into cDNA. The qRT-PCR was performed using SYBR Master Mix (Vazyme) on a Rotor-Gene Q system (Qiagen), with β-actin as the internal control. Experiments were run in triplicate; primer sequences are listed in Tables 1 and 23 (delohaida; Qingdao, China).
Table 1.
Human Primer Sequences Used for qRT-PCR
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| ACTIN | GGGAAATCGTGCGTGACATT | GGAACCGCTCATTGCCAAT |
| DRP1 | GCGGCAAATCAAACGTCTAGAA | TTTGTAACAGGCAACCTTTTACGA |
| MFN1 | CGTTTTTCCCTGGGCTGGT | TGGCGTTGCTGGAGTGGT |
| MFN2 | TGGAGCTCTTGGCTCAAGACTATAA | GGACTACTGGAGAAGGGTGGAAG |
| OPA1 | GCTCTGCAGGCTCGTCTCA | AGCTGGGTGCTCCTCATTACAT |
| TFAM | TTTACCGAGGTGGTTTTCATCTG | CGCTGGGCAATTCTTCTAATTAG |
| NRF1 | TCAAGTACTCTACAGGTCGGGGA | TTCCCGCCCATGCTGTTTA |
| PGC-1α | TTTTCTCGACACAGGTCGTGTT | TCTCACATACAAGGGAGAATTTCG |
| ND1 | CAAAGGCCCCAACGTTGTAG | AGAAGAGCGATGGTGAGAGCTAA |
| ND6 | CATACTCTTTCACCCACAGCACC | AGGGGGAATGATGGTTGTCTTT |
| CACNA1D | CTGGCCTGCGTTGCTGTATA | ATGACAAAGCCCACAAAGATGTT |
| PTGER3 | CCGCTCCTGATAATGATGTTGA | GGTAAACCCAAGGATCCAAGATC |
| FGF18 | GACGATGTGAGCCGTAAGCA | ACCGAAGGTGTCTGTCTCCACTA |
| PTGFR | ATGACAAAGCCCACAAAGATGTT | AGATTTGATTCCATGTTGCCATT |
| PLCG2 | GCGTCTACCCAAAGGGACAA | TGCGCCCATTGAGAGAAAA |
| BMP2 | CCCCCTACATGCTAGACCTGTATC | CACTCGTTTCTGGTAGTTCTTCCAA |
| WNT11 | AAGTTTTCCGATGCTCCTATGAAG | GATGGAGCAGGAGCCAGACA |
| CCND2 | CGCAACTGGAAGTGTGGGA | CCTCAATCTGCTCCTGGCAA |
| TCF7 | GAACATTTCAACAGCCCACATC | CAGCTCACAGTGTGGGGGA |
| FZD8 | CAAGACAGGCCAGATCGCTAAC | AGCGCTCCATGTCGATAAGG |
| CACNA2D1 | TGCAGCCAGGGATATTGAGAA | TCGAGATCATCCTTTGCATTGTAG |
| NGFR | CGACAACCTCATCCCTGTCTAT | CCACTGTCGCTGTGGAGTTTT |
| GADD45G | CCTCACTGCCGGCGTCTA | CGTTCTCGCAGCAGAAAGC |
Table 2.
Mouse Primer Sequences Used for qRT-PCR
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Actin | ACGGCCAGGTCATCACTATTG | AGAGGTCTTTACGGATGTCAACGT |
| Cacna1d | CCTTCCAGGAACAGGGAGAAA | ATTCGAAAGGCGAGGAGTTCA |
| Fgf18 | CAAGTCCTGGGCCGTAGGA | GAGCTTGCCTTTTCGGTTCA |
| Ptger3 | TGGTCGCCGCTATTGATAATG | CCAGGGATCCAAGATCTGGTT |
| Plcg2 | CTCGGACTTGGTTGTATACTGCAA | GCCCTTCTGATTGTATCGCAAT |
Live/Dead Staining
HCECs were seeded in 6-well plates (5 × 10⁵ cells/well) and irradiated with UVA at 80% confluency. After 24 hours in serum-free medium, cells were treated with TCDCA (50, 100, and 200 µM) for another 24 hours. Cell viability was assessed using a Live/Dead Double Staining Kit (Abbkine, USA) following the manufacturer's instructions. Stained cells were imaged under an inverted fluorescence microscope.
Reactive Oxygen Species Production
Intracellular reactive oxygen species (ROS) levels were measured using the ROS Assay Kit (S0033S; Beyotime, China) according to the manufacturer's instructions. After UVA irradiation and TCDCA treatment, HCECs were washed twice with PBS, and 500 µL of DCFH-DA working solution was added to each well in a 6-well plate. Cells were incubated at 37°C for 30 minutes. Fluorescent signals indicating ROS production were observed and captured using an inverted fluorescence microscope.
JC-1 Staining
Mitochondrial membrane potential (ΔWm) was assessed using the JC-1 Mitochondrial Membrane Potential Assay Kit (C2006, Beyotime, China) following the manufacturer's instructions. After UVA irradiation and treatment with TCDCA, HCECs were washed twice with PBS. Subsequently, 500 µL of JC-1 working solution was added to each well of a 6-well plate, and the cells were incubated at 37°C for 30 minutes. Fluorescence signals indicating JC-1 monomers (green) and aggregates (red) were observed and captured using an inverted fluorescence microscope.
Mitochondrial Respiration Analysis
Cellular metabolic activity was evaluated using the Seahorse XFp Analyzer with the XF Cell Mito Stress Test and Real-Time ATP Rate Assay Kits (Agilent Technologies, USA). HCECs were seeded in 8-well Seahorse plates (20,000 cells/well) and incubated with Seahorse assay medium supplemented with glucose and sodium pyruvate. Mitochondrial modulators—oligomycin, FCCP, and rotenone/antimycin A—were sequentially injected. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured and normalized to total protein content determined by BCA assay (Beyotime, China).
ATP Production
Intracellular ATP levels were measured using the ATP Assay Kit (S0027; Beyotime, China). After UVA irradiation and treatment with TCDCA, HCECs were washed twice with PBS and lysed with cell lysis buffer. According to the manufacturer's protocol, the lysates were mixed with the ATP detection working solution, and luminescence was measured using a microplate luminometer.
RNA-Seqencing
RNA was extracted from HCECs in UVA and UVA + TCDCA groups and subjected to RNA-seq using the Illumina NovaSeq 6000 platform by OE Biotech (Shanghai, China). Raw reads were processed with fastp, aligned using HISAT2, and quantified by HTSeq-count. PCA and DEG analysis (DESeq2, Q < 0.05, |fold change| > 2) were performed in R software, followed by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. For both the UVA and UVA + TCDCA groups, fifth-passage HCECs were seeded in 6-well plates at 4:00 PM on day 1 and allowed to adhere completely before receiving respective treatments the following morning.
Statistical Analysis
Data analysis was performed using SPSS 25.0 statistical software and GraphPad Prism 7 software (GraphPad Software, USA). All data are expressed as means ± standard errors (SEs). The 2-tailed t-test was used to analyze relationships between the 2 groups. Any P value < 0.05 was considered statistically significant.
Results
Involvement of TCDCA in the Pathogenesis of FECD
We first conducted metabolomic profiling of aqueous humor from eight age-related patients with cataract patients and six patients with FECD (Fig. 1A). Metabolomic analysis of the aqueous humor revealed that numerous metabolites were enriched in the bile acid metabolism pathway, among which TCDCA exhibited the most prominent alteration in abundance compared with other bile acids (Fig. 1B). Considering its endogenous origin and reported biological activities in other systems,15–17 we selected TCDCA as the target metabolite for further investigation. TCDCA levels were significantly elevated in FECD patient serum and UVA-irradiated mouse aqueous humor (Fig. 1C). To investigate its potential functional relevance in corneal endothelial cells, we examined the expression of FXR, a known receptor of TCDCA, using immunohistochemistry and immunofluorescence. FXR was found to be expressed in the corneal endothelium of both humans and mice (Figs. 1D, 1E). Collectively, these findings suggest that TCDCA may be involved in the regulation of corneal endothelial cell repair following damage.
Figure 1.
TCDCA as a potential regulator of the pathogenesis of FECD. (A) Schematic of the experimental design. (B) Differential bile acid profiles in FECD aqueous humor (n = 6). (C) TCDCA levels in human serum (n = 5) and mouse aqueous humor (n = 4). (D) FXR immunohistochemistry in human corneal endothelium (n = 3), scale bar = 100 µm. (E) FXR immunofluorescence in murine CECs (n = 3), scale bar = 180 µm. All data are expressed as mean ± SEM. ***P < 0.001 (2-tailed t-test).
Effects of Pretreatment With TCDCA on Corneal Endothelial Cells in FECD Mice
To investigate the regulatory role of TCDCA in CEC damage repair, a UVA-induced mouse model of corneal endothelial damage was established, as previously described (Fig. 2A). Mice received intraperitoneal injections of PBS or TCDCA one day prior to 500 J/cm² UVA exposure, and on days 0, 2, 4, and 6 post-irradiation. Corneal structure was assessed by slit-lamp and OCT imaging on day 7. Compared to the PBS group, the TCDCA-treated group showed significantly improved CCT and transparency (Figs. 2B, 2D). Whole-mount immunostaining for ZO-1 and Na⁺/K⁺-ATPase revealed more regular endothelial morphology in the TCDCA group (Fig. 2C). Quantitative analysis demonstrated that TCDCA significantly improved endothelial cell density, cell area, and coefficient of variation (Figs. 2E–G). Although both subconjunctival and intraperitoneal injections improved CEC morphology (Supplementary Fig. S1), intraperitoneal injection was more effective in restoring CCT and corneal transparency. These findings indicate that intraperitoneal TCDCA administration protects against UVA-induced CEC damage.
Figure 2.
Protection against UVA-induced corneal endothelial impairment by preventive administration of TCDCA. (A) Experimental timeline of TCDCA treatment and UVA-induced damage model. (B) Slit-lamp and OCT images of mouse corneas in normal, PBS, and TCDCA groups at days 0, 2, 4, and 6 (n = 3). (C) Whole-mount immunofluorescence of ZO-1 and Na⁺/K⁺-ATPase in corneal endothelium, scale bar = 50 µm. (D) CCT measurements post-UVA (n = 3). (E–G) Quantification of endothelial cell density, cell area, and coefficient of variation based on ZO-1 staining (n = 5 or 6). All data are expressed as mean ± SEM. *P < 0.5; **P < 0.01; ***P < 0.001 (2-tailed t-test).
Amelioration of Therapeutic Administration of TCDCA on UVA-Induced Corneal Endothelial Damage
Building on the preventative effects of TCDCA, we further evaluated its therapeutic potential using the same UVA-induced mouse corneal endothelial damage model. Mice received intraperitoneal injections of PBS or TCDCA on days 0, 2, 4, and 6 after UVA exposure. Corneal assessments were performed by slit-lamp and OCT imaging, and samples were collected on day 7 for analysis (Fig. 3A). Consistent with the preventative study, TCDCA treatment significantly improved CCT and corneal transparency compared to PBS (Figs. 3B, 3D). Immunofluorescence staining demonstrated that the endothelial morphology in the TCDCA group was more similar to healthy controls, with significantly increased cell density, reduced cell area, and improved coefficient of variation (Figs. 3C, 3E–G). These results indicate that intraperitoneal TCDCA administration effectively promotes repair of UVA-induced corneal endothelial damage.
Figure 3.
Improvement of TCDCA on corneal endothelial damage. (A) Experimental timeline of TCDCA treatment post-UVA exposure. (B) Slit-lamp and OCT images of mouse corneas in Normal, PBS, and TCDCA groups at days 0, 2, 4, and 6 (n = 3). (C) Whole-mount immunofluorescence of ZO-1 and Na⁺/K⁺-ATPase in corneal endothelium, scale bar = 50 µm. (D) CCT measurements in PBS and TCDCA groups (n = 3). (E–G) Quantification of cell density, average cell area, and coefficient of variation based on ZO-1 staining (n = 5 or 6). All data are expressed as mean ± SEM. *P < 0.5; ***P < 0.001 (2-tailed t-test).
Restorative Effects of TCDCA on Human Corneal Endothelial Cell Dysfunction
To verify the in vitro effects of TCDCA on regulating cellular function, we established a UVA-induced damage model in HCECs. Twenty-four hours after UVA exposure, the cells were treated with TCDCA at different concentrations and analyzed after another 24 hours. Live/dead staining revealed that UVA markedly reduced cell numbers, whereas TCDCA improved cell viability in a dose-dependent manner, with the most pronounced effect observed at 100 µM (UVA + T100; Figs. 4A, 4B). In addition, ROS assays showed that UVA exposure increased oxidative stress, which was slightly reduced in the 50 µM and 200 µM groups (UVA + T50 and UVA + T200), whereas 100 µM TCDCA significantly reduced ROS levels (Fig. 4C). Consistently, JC-1 staining demonstrated a decline in mitochondrial membrane potential following UVA irradiation, which was alleviated by TCDCA, with the most notable recovery observed in the 100 µM group (Figs. 4D–F). Collectively, these results indicate that TCDCA effectively alleviates UVA-induced damage in HCECs.
Figure 4.
TCDCA ameliorates cellular viability and mitochondrial membrane potential of HCECs following UVA-induced damage . (A) Bright-field and live/dead staining images of HCECs in the normal, UVA, UVA + T50, UVA + T100, and UVA + T200 groups (green = live cells and red = dead cells; n = 3), scale bars = 550 µm and 180 µm. (B) Quantification of viable cells per group (n = 3). (C) ROS staining of HCECs from each group (n = 3), scale bar = 460 µm. (D) JC-1 staining images showing mitochondrial membrane potential (n = 3), scale bar = 180 µm. (E, F) Quantitative analysis of JC-1 monomer (E) and aggregate (F) fluorescence intensity (n = 3). All data are expressed as mean ± SEM. *P < 0.05; **P < 0.01; ***P < 0.001 (2-tailed t-test).
Regulation of the Physiological Functions of HCECs by TCDCA Through Improvement of Mitochondrial Function
To investigate the potential biological mechanism by which TCDCA regulates CEC damage repair, we explored whether TCDCA restores the morphology and function of damaged HCECs by improving mitochondrial function, given the previously reported high bioenergetic demand of CECs. Based on the above in vitro results, 100 µM TCDCA (UVA + TCDCA) was selected as the treatment condition for subsequent experiments. First, qRT-PCR analysis showed that the expression of mitochondrial quantity- and function-related genes was significantly upregulated in the TCDCA-treated group compared to the UVA group (Figs. 5A, 5B). Next, Seahorse assays were used to evaluate mitochondrial function and cellular metabolic capacity. The results demonstrated that TCDCA treatment enhanced basal respiration, ATP production, non-mitochondrial oxygen consumption and proton leak (Fig. 5C and Supplementary Fig. S2). To further validate these findings, ATP quantification confirmed that TCDCA significantly increased ATP levels compared to the UVA group (Fig. 5D). In summary, these results indicate that TCDCA alleviates mitochondrial bioenergetic deficiency following UVA-induced damage in HCECs.
Figure 5.
Restoration of mitochondrial bioenergetic function by TCDCA. (A) Relative mRNA expression levels of mitochondrial-related genes (DRP1, MFN1, MFN2, OPA1, TFAM, NRF1, and PGC-1a) in HCECs from the UVA and UVA + TCDCA groups (n = 3). (B) Relative expression levels of mitochondrial DNA-encoded genes ND1 and ND6 (n = 3). (C) Seahorse analysis of OCR in the UVA and UVA + TCDCA groups (n = 3). (D) ATP levels in HCECs from the UVA and UVA + T100 groups (n = 3). All data are expressed as mean ± SEM. *P < 0.05; **P < 0.01; ***P < 0.001 (2-tailed t-test).
Treatment of TCDCA Significantly Altered the Transcriptomic Profile of Human Corneal Endothelial Cell Lines
Based on the above in vitro findings, we performed RNA-seq analysis on HCECs from the UVA and UVA + TCDCA groups (Fig. 6A) to explore the regulatory mechanisms by which TCDCA promotes CEC repair. A total of 477 upregulated and 1096 downregulated genes were identified (Fig. 6B). KEGG enrichment analysis revealed significant upregulation of multiple signaling pathways related to cellular functions in the UVA + TCDCA group, including the Hippo, MAPK, and Ca²⁺ signaling pathways (Fig. 6C). Previous studies have demonstrated that activation of the Hippo and MAPK signaling pathways facilitates CEC migration and proliferation.18,19 Consistent with these findings, our qRT-PCR validation (Figs. 6D, 6E) confirmed the upregulation of key components within these pathways in our experimental model. Additionally, prior research has revealed that the small GTPase Rap1A modulates store-operated calcium entry (SOCE) in lung endothelial cells, thereby influencing vascular inflammation and permeability.20 To explore this possibility, we investigated the Ca²⁺ signaling pathway, given its well-established role in regulating cell proliferation, differentiation, migration, and apoptosis.21,22 We then measured the mRNA expression of Ca²⁺ pathway-related genes, all of which were significantly upregulated in the TCDCA group (Fig. 6F). These results suggest that TCDCA may promote HCECs damage repair by activating the Ca²⁺ signaling pathway.
Figure 6.
Activation of the Ca2+ signaling pathway in TCDCA-treated HCECs. (A) Schematic of the experimental design. (B) Volcano plot of DEGs between the UVA and UVA + TCDCA groups (n = 4). (C) KEGG pathway enrichment analysis showing upregulation of the calcium signaling pathway. (D, E) The relative expression levels of genes related to the Hippo signaling pathway and the MAPK signaling pathway (n = 3). (F) The relative expression levels of genes related to the Ca2+ signaling pathway (n = 3). All data are expressed as mean ± SEM. *P < 0.05; **P < 0.01; ***P < 0.001 (2-tailed t-test).
Protection of CEC Function by TCDCA Through Activation of the Ca2+ Signaling Pathway
Based on the previous transcriptomic analysis, to rigorously confirm the relationship between TCDCA and CEC repair after damage, we introduced the Ca²⁺ signaling pathway inhibitor 2-APB and established the TCDCA + 2-APB treatment group. The experimental timeline is shown in Figure 7A. As expected, OCT and slit-lamp images showed that the CCT and corneal clarity of the TCDCA + 2-APB group were similar to those of the PBS group (Figs. 7B, 7C). To further validate these findings, whole-mount ZO-1 staining of the cornea was performed (Fig. 7D). Consistent with the imaging results, CECs in the TCDCA + 2-APB group showed the most irregular morphology, largest average cell area, and lowest cell density, comparable to the PBS group (Figs. 7E–G). These results indicate that TCDCA promotes CEC repair after damage by activating the Ca²⁺ signaling pathway.
Figure 7.
Reversal of TCDCA's therapeutic effect on CEC repair by 2-APB. (A) Experimental timeline showing intraperitoneal injections of PBS, TCDCA, and TCDCA + 2-APB with FECD model construction. (B) Slit-lamp and OCT images of mouse corneas from each group on days 4 and 6 (n = 3). (C) CCT measurements across groups on days 4 and 6 (n = 3). (D) Whole-mount ZO-1 immunofluorescence staining of CE (n = 3), scale bar = 50 µm. (E–G) Quantification of cell density, average cell area, and coefficient of variation from ZO-1 staining (n = 3). All data are expressed as mean ± SEM. ***P < 0.001 (2-tailed t-test).
Discussion
The CE maintains corneal transparency and thickness via its barrier and pump functions. However, as CECs are arrested in the G2/M phase and lack regenerative capacity in vivo, damage can lead to corneal edema and decompensation. This study explores the therapeutic potential of TCDCA, a bioactive bile acid with roles in signaling and disease,23–26 for protecting CECs against UVA-induced injury, given its recognized bioactivities in other systems.
Previous studies have demonstrated that mitochondrial dysfunction and apoptosis are key mechanisms involved in the degeneration of CECs in FECD.27 TCDCA has been reported to protect hepatocytes from Fas ligand (Fas-L)-induced apoptosis, potentially through direct effects on mitochondrial membranes.28 In our study, TCDCA improved mitochondrial membrane potential and restored bioenergetic functions in UVA-damaged HCECs, including ATP production and respiratory capacity. Although these effects suggest mitochondrial protection, the role of TCDCA in apoptosis regulation requires further investigation.
Recent studies have highlighted TCDCA as a signaling molecule capable of activating multiple pathways. For instance, TCDCA activates the FXR signaling pathway in hepatic endothelial cells, subsequently triggering the Myc signaling cascade to promote neutrophil recruitment, thereby exerting therapeutic effects against obstructive cholestasis.17,29 Additionally, TCDCA activates the TGR5 signaling pathway, mediating anti-inflammatory responses and modulating immune regulation.7,30,31 In our study, we observed that TCDCA simultaneously activates the Hippo, MAPK, and Ca²⁺ signaling pathways. Although our subsequent experiments confirmed the critical role of the Ca²⁺ signaling pathway in this process, the potential synergistic contributions of other activated pathways require further investigation.
The Ca²⁺ signaling pathway is one of the most fundamental and ubiquitous intracellular signaling mechanisms.32 While the critical role of Ca²⁺ signaling in ocular diseases35–39 and corneal epithelial repair is well-established,40,41 its function in CE remains less defined. This study demonstrated the involvement of Ca²⁺ signaling in the repair of CEC damage. Nonetheless, the downstream mechanisms by which TCDCA activates Ca²⁺ signaling to mediate CEC repair remain unclear and require further investigation. Previous studies have not directly linked Ca²⁺ signaling genes (CACNA1D, PTGER3, PTGFR, FGF18, and PLGC2) to the corneal endothelium, although their roles in vascular endothelium are established—such as in regulating permeability and inflammation.42–44 Given the shared characteristics between vascular and corneal endothelia (including barrier function and tight junctions), future studies should investigate downstream Ca²⁺ signaling pathway components in greater detail. Additionally, whereas mitochondrial Ca²⁺ signaling has been shown to regulate gene expression in neurons,45 its potential role in corneal endothelial repair mechanisms remains unexplored and merits future study.
TCDCA demonstrates therapeutic potential for corneal endothelial disorders by mitigating UVA-induced damage and improving mitochondrial bioenergetics, with Ca²⁺ signaling implicated as a key pathway. Future work with mutation models such as COL8A2, TCF4, and SLC4A11, or human donor tissues to directly verify these findings and further assess TCDCA’s therapeutic potential for conditions such as FECD.
Supplementary Material
Acknowledgments
Supported by grants from the National Science Foundation of China (82325014), the Taishan Scholar Program (tstp20221163), the Key Subproject under a Major Research and Development Program (2024YFC2510902), and the National Science Foundation of China (82201154).
Q.W. and Q.Z. conducted the project design and supervised this study. Y.Q., C.Z., and S.Y. carried out the experiments. S.D. and X.L. analyzed the data. The manuscript was drafted by Y.Q. and Q.W., and was reviewed and edited by Q.Z. All authors contributed to the article and approved the submitted version.
Disclosure: Y. Qiao, None; C. Zhao, None; S. Yao, None; S. Dou, None; X. Li, None; Q. Wang, None; Q. Zhou, None
References
- 1. Price MO, Mehta JS, Jurkunas UV, Price FW Jr. Corneal endothelial dysfunction: evolving understanding and treatment options. Prog Retin Eye Res. 2021; 82: 100904. [DOI] [PubMed] [Google Scholar]
- 2. Joyce NC. Proliferative capacity of the corneal endothelium. Prog Retin Eye Res. 2003; 22(3): 359–389. [DOI] [PubMed] [Google Scholar]
- 3. Ong Tone S, Kocaba V, Böhm M, Wylegala A, White TL, Jurkunas UV. Fuchs endothelial corneal dystrophy: the vicious cycle of Fuchs pathogenesis. Prog Retin Eye Res. 2021; 80: 100863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Setchell KD, Rodrigues CM, Podda M, Crosignani A. Metabolism of orally administered tauroursodeoxycholic acid in patients with primary biliary cirrhosis. Gut. 1996; 38(3): 439–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Yang X, Wang J, Qi X, et al.. HLF and PPARα axis regulates metabolic-associated fatty liver disease through extracellular vesicles derived from the intestinal microbiota. Imeta. 2025; 4(2): e70022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Qi YC, Duan GZ, Mao W, Liu Q, Zhang YL, Li PF. Taurochenodeoxycholic acid mediates cAMP-PKA-CREB signaling pathway. Chin J Nat Med. 2020; 18(12): 898–906. [DOI] [PubMed] [Google Scholar]
- 7. Zhang ZY, Guo XL, Liu JT, et al.. Conjugated bile acids alleviate acute pancreatitis through inhibition of TGR5 and NLRP3 mediated inflammation. J Transl Med. 2024; 22(1): 1124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Wang X, Zhang Z, He X, Mao W, Zhou L, Li P. Taurochenodeoxycholic acid induces NR8383 cells apoptosis via PKC/JNK-dependent pathway. Eur J Pharmacol. 2016; 786: 109–115. [DOI] [PubMed] [Google Scholar]
- 9. Ni C, Wang L, Bai Y, et al.. Taurochenodeoxycholic acid activates autophagy and suppresses inflammatory responses in microglia of MPTP-induced Parkinson's disease mice via AMPK/mTOR, AKT/NFκB and Pink1/Parkin signaling pathways mediated by Takeda G protein-coupled receptor 5. Free Radic Biol Med. 2025; 235: 347–363. [DOI] [PubMed] [Google Scholar]
- 10. Zhao Q, Dai MY, Huang RY, et al.. Parabacteroides distasonis ameliorates hepatic fibrosis potentially via modulating intestinal bile acid metabolism and hepatocyte pyroptosis in male mice. Nat Commun. 2023; 14(1): 1829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Pardue MT, Allen RS. Neuroprotective strategies for retinal disease. Prog Retin Eye Res. 2018; 65: 50–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Guindolet D, Woodward AM, Gabison EE, Argüeso P. Alleviation of endoplasmic reticulum stress enhances human corneal epithelial cell viability under hyperosmotic conditions. Int J Mol Sci. 2022; 23(9): 4528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Lenin R, Nagy PG, Jha KA, Gangaraju R. GRP78 translocation to the cell surface and O-GlcNAcylation of VE-Cadherin contribute to ER stress-mediated endothelial permeability. Sci Rep. 2019; 9(1): 10783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Liu C, Miyajima T, Melangath G, et al.. Ultraviolet A light induces DNA damage and estrogen-DNA adducts in Fuchs endothelial corneal dystrophy causing females to be more affected. Proc Natl Acad Sci USA. 2020; 117(1): 573–583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Gan G, Lin S, Luo Y, et al.. Unveiling the oral-gut connection: chronic apical periodontitis accelerates atherosclerosis via gut microbiota dysbiosis and altered metabolites in apoE(-/-) Mice on a high-fat diet. Int J Oral Sci. 2024; 16(1): 39. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Jiang X, Liu K, Luo P, et al.. Hypothalamic SLC7A14 accounts for aging-reduced lipolysis in white adipose tissue of male mice. Nat Commun. 2024; 15(1): 7948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Zhang P, Li X, Liang J, et al.. Chenodeoxycholic acid modulates cholestatic niche through FXR/Myc/P-selectin axis in liver endothelial cells. Nat Commun. 2025; 16(1): 2093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Ryu Y, Seo JH, Kim HS, et al.. COL8A2 activation enhances function of corneal endothelial cells through HIPPO signaling/mitochondria pathway. Matrix Biol. 2024; 134: 119–131. [DOI] [PubMed] [Google Scholar]
- 19. Hsueh YJ, Meir YJ, Lai JY, et al.. Ascorbic acid ameliorates corneal endothelial dysfunction and enhances cell proliferation via the noncanonical GLUT1-ERK axis. Biomed Pharmacother. 2021; 144: 112306. [DOI] [PubMed] [Google Scholar]
- 20. Kosuru R, Romito O, Sharma GP, et al.. Rap1A modulates store-operated calcium entry in the lung endothelium: a novel mechanism controlling NFAT-mediated vascular inflammation and permeability. Arterioscler Thromb Vasc Biol. 2024; 44(11): 2271–2287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Huang F, Zhang F, Huang L, et al.. Inositol 1,4,5-trisphosphate receptors regulate vascular smooth muscle cell proliferation and neointima formation in mice. J Am Heart Assoc. 2024; 13(15): e034203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Buckley C, Lee MD, Zhang X, Wilson C, McCarron JG. Signalling switches maintain intercellular communication in the vascular endothelium. Br J Pharmacol. 2024; 181(16): 2810–2832. [DOI] [PubMed] [Google Scholar]
- 23. Žížalová K, Nováková B, Vecka M, et al.. Serum concentration of taurochenodeoxycholic acid predicts clinically significant portal hypertension. Liver Int. 2023; 43(4): 888–895. [DOI] [PubMed] [Google Scholar]
- 24. Liu L, Panzitt K, Racedo S, et al.. Bile acids increase steroidogenesis in cholemic mice and induce cortisol secretion in adrenocortical H295R cells via S1PR2, ERK and SF-1. Liver Int. 2019; 39(11): 2112–2123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Waise TMZ, Lim YM, Danaei Z, Zhang SY, Lam TKT. Small intestinal taurochenodeoxycholic acid-FXR axis alters local nutrient-sensing glucoregulatory pathways in rats. Mol Metab. 2021; 44: 101132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Xie G, Wang X, Huang F, et al.. Dysregulated hepatic bile acids collaboratively promote liver carcinogenesis. Int J Cancer. 2016; 139(8): 1764–1775. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kumar V, Jurkunas UV. Mitochondrial dysfunction and mitophagy in Fuchs endothelial corneal dystrophy. Cells. 2021; 10(8): 1888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Azzaroli F, Mehal W, Soroka CJ, et al.. Ursodeoxycholic acid diminishes Fas-ligand-induced apoptosis in mouse hepatocytes. Hepatology. 2002; 36(1): 49–54. [DOI] [PubMed] [Google Scholar]
- 29. Zhang SY, Li RJW, Lim YM, et al.. FXR in the dorsal vagal complex is sufficient and necessary for upper small intestinal microbiome-mediated changes of TCDCA to alter insulin action in rats. Gut. 2021; 70(9): 1675–1683. [DOI] [PubMed] [Google Scholar]
- 30. Qi Y, Shi L, Duan G, Ma Y, Li P. Taurochenodeoxycholic acid increases cAMP content via specially interacting with bile acid receptor TGR5. Molecules. 2021; 26(23): 7066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Bao L, Hao D, Wang X, He X, Mao W, Li P. Transcriptome investigation of anti-inflammation and immuno-regulation mechanism of taurochenodeoxycholic acid. BMC Pharmacol Toxicol. 2021; 22(1): 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Eisner D, Neher E, Taschenberger H, Smith G. Physiology of intracellular calcium buffering. Physiol Rev. 2023; 103(4): 2767–2845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Rhodes JD, Sanderson J. The mechanisms of calcium homeostasis and signalling in the lens. Exp Eye Res. 2009; 88(2): 226–234. [DOI] [PubMed] [Google Scholar]
- 34. Jia Y, Qin Q, Fang CP, et al.. UVB induces apoptosis via downregulation of CALML3-dependent JNK1/2 and ERK1/2 pathways in cataract. Int J Mol Med. 2018; 41(5): 3041–3050. [DOI] [PubMed] [Google Scholar]
- 35. Wang HN, Qian WJ, Zhao GL, et al.. L- and T-type Ca(2+) channels dichotomously contribute to retinal ganglion cell injury in experimental glaucoma. Neural Regen Res. 2023; 18(7): 1570–1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Patel PD, Chen YL, Kasetti RB, et al.. Impaired TRPV4-eNOS signaling in trabecular meshwork elevates intraocular pressure in glaucoma. Proc Natl Acad Sci USA. 2021; 118(16): e2022461118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Williams B, Maddox JW, Lee A. Calcium channels in retinal function and disease. Annu Rev Vis Sci. 2022; 8: 53–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Gao F, Li M, Zhu L, et al.. Knockdown of HSPA13 Inhibits TGFβ1-Induced Epithelial-Mesenchymal Transition of RPE by Suppressing the PI3K/Akt Signaling Pathway. Invest Ophthalmol Vis Sci. 2024; 65(11): 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Sneyers F, Loncke J, Bultynck G. Keeping an eye on Ca(2+) signalling to tackle dry eye diseases. EBioMedicine. 2021; 74: 103741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Sun CC, Lee SY, Chen LH, et al.. Targeting Ca(2+)-dependent pathways to promote corneal epithelial wound healing induced by CISD2 deficiency. Cell Signal. 2023; 109: 110755. [DOI] [PubMed] [Google Scholar]
- 41. Lapajne L, Lakk M, Rudzitis CN, et al.. Neuropsin, TRPV4 and intracellular calcium mediate intrinsic photosensitivity in corneal epithelial cells. Ocul Surf. 2025; 36: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Zhou F, Wang SF, Lu WH, et al.. The essential role of PGF2α/PTGFR in molding endometrial breakdown and vascular dynamics, regulated by HIF-1α in a mouse menstrual-like model. Reprod Sci. 2024; 31(9): 2718–2730. [DOI] [PubMed] [Google Scholar]
- 43. Wang JJ, Gao JH, Ding L, et al.. Circular RNA-Cacna1d Plays a Critical Role in Sepsis-induced Lung Injury by Sponging microRNA-185-5p. Am J Resp Cell Mol. 2025; 72(2): 181–194. [DOI] [PubMed] [Google Scholar]
- 44. Chen LH, Miao YF, Zhang YH, et al.. Inactivation of the E-Prostanoid 3 receptor attenuates the angiotensin II pressor response via decreasing arterial contractility. Arterioscl Throm Vas. 2012; 32(12): 3024–3032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Li WW, Li JR, Li J, et al.. Boosting neuronal activity-driven mitochondrial DNA transcription improves cognition in aged mice. Science. 2024; 386(6728): eadp6547. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







