Aberrant Accumulation of Cell-Free DNA Activates the cGAS-STING-TBK1 Pathway of γδ T Cells to Promote the Inflammatory Responses in Oral Lichen Planus

Abstract

Oral lichen planus (OLP) is a chronic T-cell-mediated immune inflammatory disease with unclear etiology. γδ T cells are crucial for regulating T-cell activity and immune inflammatory responses. The cGAS-STING-TBK1 pathway serves as an immune sentinel for cytosolic DNA that triggers proinflammatory cytokines production and T-cell recruitment. We recently verified the co-localization of STING with γδ T cells in OLP lesions. However, the molecular mechanisms governing the roles of γδ T cells in OLP remain unknown. In the present study, we firstly investigated γδ T cells subsets and functions and found that γδ T cells were enriched in OLP lesions but reduced in peripheral blood of OLP, with the Vδ1 subset predominating. Besides, proinflammatory cytokines IL-6, IL-17, and IFN-γ secreted by OLP γδ T cells were upregulated. cfDNA levels were elevated in OLP plasma, and transfection of cfDNA into primary γδ T cells activated the cGAS-STING-TBK1 pathway, enhancing cytokine secretion, which could be reversed by the STING inhibitor H-151. Furthermore, cfDNA-OLP reduced the apoptosis rate of γδ T cells and altered their differentiation into Th17 and Foxp3⁺ Treg cells. An in vivo model further validated the proinflammatory role of the STING pathway in OLP. Collectively, this study revealed distinct expression pattern of γδ T cells in OLP. Aberrant accumulation of OLP circulating cfDNA triggered the activation of cGAS-STING-TBK1 pathway, modulating γδ T cell survival, differentiation, and proinflammatory responses, thereby promoting the inflammatory responses in OLP.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-025-02416-z.

Background

Oral lichen planus (OLP) is a chronic T-cell-mediated inflammatory immune disease that primarily affects the oral mucosa [1]. It is defined as an oral potentially malignant disorder, with a malignant transformation rate ranges from 0.44% to 2.28% [2]. Clinically, OLP is generally categorized into erosive and non-erosive forms. Pathologically, OLP is characterized by a band-like predominantly T cells infiltrate in the lamina propria, accompanied by vacuolar degeneration of the basal cell layers, and keratinocyte apoptosis [3]. Although the etiology and pathogenesis of OLP remain unclear, it is widely recognized that T-cell-mediated immune dysfunctions play a pivotal role in its onset and progression. In OLP, T cells are activated upon antigen presentation, subsequently triggering keratinocyte apoptosis through cytotoxic T cells, which release chemokines to recruit helper T cells to OLP lesions [4]. Exogenous antigens, autoantigens, and superantigens are considered as potential triggers of the immune inflammatory responses in OLP [5]. OLP was featured by a Th1 cytokine bias and a corresponding Th1-biased expression pattern of upstream transcription factors. Previous studies have reported elevated levels of proinflammatory factors, including IFN-γ, interleukin (IL), and TNF-α in OLP lesions, peripheral blood, and saliva [4, 6].

γδ T cells, a unique subset of unconventional T cells, are a prominent source of the proinflammatory cytokines IFN-γ and IL-17 [7]. γδ T cells can recognize exogenous and endogenous antigens in an MHC-independent manner and interact with other immune cells, thereby bridging innate and adaptive immunity [8]. Based on their TCR δ chain expression, γδ T cells are primarily classified into 3 subpopulations: Vδ1, Vδ2, and Vδ3 γδ T cells. Vδ1 γδ T cells mainly distribute in mucosal epithelial cells and engage in the first line of immune defense [9]. Whereas Vδ2 γδ T cells predominantly present in peripheral blood and exert cytolytic effects against pathogens. The less common Vδ3 γδ T cells mainly concentrate in the liver and gut [10]. Increasing evidence revealed the involvement of γδ T cells on the pathogenesis of autoimmune diseases, including systemic lupus erythematosus, psoriasis, and rheumatoid arthritis [11]. We recently found the aberrant expression of γδ T cells in OLP [12, 13], but their functions and regulatory mechanisms remain to be elucidated.

The cGAS-STING-TBK1 pathway is a vital intracellular DNA-sensing mechanism, which regulates immune responses by inducing the expression of proinflammatory cytokines and T cell recruitment factors [14]. The cGAS enzyme recognizes cfDNA derived from apoptotic or dying cells and catalyzes the synthesis of cGAMP. cGAMP then binds to and activates STING, which subsequently activates TBK1. Activated TBK1 phosphorylates the transcription factor IRF3 [15]. STING also activates the transcription factor NF-κB, which functions together with phosphorylated IRF3 to induce the expression of IFN-I and proinflammatory cytokines IL-6 and TNF [16]. Several studies have found an upregulated expression of cGAS-STING-TBK1 pathway in keratinocytes and macrophages of OLP [17, 18]. Activation of the STING pathway also regulates the cytokines production of γδ T cells [19]. Our recent study verified the co-localization of STING with γδ T cells in OLP lesions [13]. Hence, the implication of γδ T cells and cGAS-STING-TBK1 pathway may shed light on the underlying pathogenesis of OLP.

In the present study, the subsets and proinflammatory cytokines secretion profiles of γδ T cells in OLP were explored. Furthermore, the functional roles and regulatory mechanisms of the cGAS-STING-TBK1 pathway in γδ T cells of OLP were investigated.

Methods

Participants and Samples

Ethical approval was granted by the Ethics Committee of Wuhan University Stomatology Hospital (No. 2022A29), and all sample collection adhered to the principles of the Declaration of Helsinki. The inclusion and exclusion criteria for OLP and normal control participants were based on our previous study [20]. In accordance with modified WHO criteria, only those presenting with symmetrical white lesions and typical histopathological features of OLP were included [21]. Patients with oral lichenoid lesions or OLP lesions with dysplasia, other visible oral lesions, or systemic disorders were excluded. A total of 63 clinically and histopathologically confirmed OLP patients and 26 age-and-sex-matched healthy controls who received orthognathic surgery were recruited for this study, all providing written informed consent. The severity of OLP was evaluated using a grading system that quantifies reticular, atrophic, and erosive (RAE) scores [22]. The enrolled participants consisted of 19 males and 44 females in the OLP group, whereas 6 males and 20 females in healthy controls. According to the clinical presentation, OLP patients was classified into non-erosive (n = 38) and erosive (n = 25) forms. Oral mucosal tissue samples and peripheral blood specimens were collected separately.

SsGSEA Analysis

The GEO dataset GSE63741 was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo), consisting of 30 lichen planus epithelium samples and 30 control epithelium samples. Gene sets for 28 immune cell types were downloaded from the TISIDB database. The extent of immune cell infiltration in lichen planus tissues was assessed using ssGSEA in the R programming environment (GSVA package).

PBMC and γδ T Cells Isolation and Expansion

Peripheral blood mononuclear cells (PBMCs) were isolated by density-gradient centrifugation using Ficoll-Paque solution (Tianjin Haoyang biological manufacture co. Ltd, Tianjin, China). γδ T cells were isolated from PBMCs using the TCRγ/δ Microbead Kit and the autoMACS^® NEO Separator (Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of isolated γδ T cells was confirmed by flow cytometry, with a purity threshold exceeding 90%. γδ T cells were then cultured in the ImmunoCult-XF T Cell Expansion Medium (STEMCELL Technologies, BC, Canada) supplemented with zoledronic acid (STEMCELL Technologies, BC, Canada) and IL-2 (PeproTech, NJ, USA) under 5% CO₂ at 37 °C for 10 days. The fresh culture medium containing IL-2 was replenished every 2 days.

Tissue Samples Preparation

OLP lesion tissues and normal control oral mucosal tissues were minced and incubated with DNase I and collagenase I (BioSharp, Hefei, China) in RPMI medium at 37 °C for 1 h. After digestion, the reaction was halted by adding an equal volume of 2% fetal bovine serum (FBS). The cell suspension was passed through a 70-µm cell strainer to obtain dissociated cells. Red Blood Cell Lysis Buffer was used to remove erythrocytes. For intracellular proinflammatory cytokine staining, the cells were pre-stimulated with the Activation Cocktail (PMA/Ionomycin/Brefeldin A, BioLegend, CA, USA) or LPS (Solarbio, Beijing, China) for 6 h. The activated cells were harvested after incubation and prepared for flow cytometry.

Cell Culture and Treatment

Jurkat T cells (American Type Culture Collection, Rockville, MA, USA) were cultured in RPMI medium supplemented with 1% penicillin–streptomycin and 10% FBS at 37 °C in a 5% CO₂ incubator. For the plasma stimulation assay, Jurkat T cells were stimulated with plasma from OLP patients and normal controls for 48 h at 37 °C in 5% CO₂.

Bacteria Culture

The Prevotella melaninogenica (P. melaninogenica) strain ATCC 25845™ was grown on Columbia agar plates supplemented with defibrinated sheep blood (PB003A, Beijing Luqiao, China) under anaerobic conditions at 37 °C.

Animal Experiments

A total of 21 six-week-old C57BL/6 female mice were housed in a specific pathogen-free (SPF) environment and randomly divided into 3 groups: (1) PBS control, (2) P. melaninogenica only, and (3) P. melaninogenica with the STING inhibitor C-176 (MedChemExpress, NJ, USA). The P. melaninogenica suspension was adjusted to an OD600 of 1.0 before use. Mice were injected intramucosally with 50 µL of the bacterial suspension into the buccal mucosa on each side, while the control group received injection of an equal volume of PBS. For STING inhibition experiment, mice were injected with C-176 (5 mg/kg) after injection of P. melaninogenica into the same region of buccal mucosa. The treatment was administered every other day for 4 weeks, after which the mice were euthanized, and tissue samples were collected for further analysis. Ethical approval was granted by the Ethics Committee of School and Hospital of Stomatology, Wuhan University (No. S07924040E).

Immunohistochemistry Assay and Immunofluorescence Staining

For immunohistochemistry (IHC), slides were incubated with primary antibodies against p-STING (1:100, Affinity Biosciences. OH. USA) and p-TBK1 (1:100, Cell Signaling Technology, MA, USA) in a moist chamber at 4 °C overnight. Then, the Streptavidin-Biotin Complex IHC Kit (MXB, Fuzhou, China) was used in accordance with the manufacturer’s instructions. The slides were visualized using diaminobenzidine (DAB) solution and counterstained with hematoxylin. Images were captured using the Aperio VERSA system. Positive staining was quantified by measuring the integrated optical density (IOD) in at least four randomly selected fields at 400× magnification using Image-Pro Plus 6.0. For immunofluorescence staining, cells were seeded on adhesive microscope slides and fixed in 4% paraformaldehyde (PFA). Permeabilization was performed with PBS-0.1% Triton X-100 for 15 min, followed by blocking with PBS-5% BSA for 1 h. The cells were then incubated with primary antibodies against p-STING (1:2000, Cell Signaling Technology, MA, USA) and γ-H2A.X (1:400, Cell Signaling Technology, MA, USA) at 4 °C overnight. Then, cells were incubated with secondary antibodies for 1 h and counterstained with DAPI. Confocal microscopy (Leica SP8) was used to acquire Images.

Multiparameter Flow Cytometry

The Fixable Viability Dye (Thermo Fisher Scientific, MA, USA) was used to exclude dead cells in the analysis. Cells were first gated on singlets using FSC-H vs. FSC-A to exclude doublets and aggregates, followed by gating on viable cells using the Fixable Viability Dye. Then, cells were stained with surface antibody: anti-CD3 (FITC, BioLegend, CA, USA), anti-γδTCR (Percp/cy5.5, BioLegend, CA, USA), anti-TCRVδ1 (PE, BD Pharmingen, CA, USA), and anti-TCRVδ2 (PE/cy7, BioLegend, CA, USA). After surface staining, the cells were fixed and permeabilized using the Fixation/Permeabilization Solution Kit (BioLegend, CA, USA). Subsequently, cells were stained intracellularly with antibodies targeting IFN-γ (APC, BD Pharmingen, CA, USA), IL-17 A (BV421, BD Pharmingen, CA, USA), and IL-6 (APC, BD Pharmingen, CA, USA). We first gated on lymphocytes, monocytes, live cells (using FSC/SSC and SSC-A/SSC-H), then CD3⁺ T cells, and finally the γδ-TCR⁺ subset to identify γδ T cells. Appropriate isotype controls were used for all staining procedures. Data were acquired using the Cytoflex LX flow cytometer (Beckman Coulter) and analyzed with FlowJo 10.0 software.

Cell-Free DNA Isolation, Quantification, and Transfection

Blood samples were collected and centrifuged at 900 g for 10 min at 4 °C. The upper plasma was then aspirated and centrifuged twice at 1500 g for 10 min. cfDNA was purified from plasma using the QIAamp DNA Blood Kits (QIAGEN, Duesseldorf, Germany) according to the manufacturer’s protocol. All samples were stored at −80 °C until further analysis. The A260/280 ratio of the isolated cfDNA ranged from 1.01 to 1.81. The concentration of cfDNA was quantified using a Qubit 4 Fluorometer (Thermo Fisher Scientific, MA, USA) and the dsDNA HS Assay Kit (Yeasen, Shanghai, China). Jurkat T cells and γδ T cells were transfected with 200 ng/ml isolated cfDNA using Lipofectamine 3000 (Thermo Fisher Scientific, MA, USA) according to the manufacturer’s instructions. After 24 h, qRT-PCR and Western blot were conducted to evaluate the proinflammatory capability of the cfDNA.

Western Blot

Cells were lysed on ice with RIPA Lysis Buffer (Beyotime, Shanghai, China). Equal amounts of protein were separated via 10% SDS-PAGE gels and transferred onto PVDF membranes. The membranes were blocked with 5% skim milk in TBST and incubated with the following primary antibodies: p-STING (1:1000, Cell Signaling Technology, MA, USA), p-TBK1 (1:500, Abmart, Shanghai, China), p-NF-κB (1:500, Abmart, Shanghai, China), TBK1 (1:200, Santa Cruz Biotechnology, CA, USA), NF-κB (1:200, Santa Cruz Biotechnology, CA, USA), IRF3 (1:200, Santa Cruz Biotechnology, CA, USA), and β-actin (1:5000, BioSharp, Hefei, China). The membranes were further incubated with secondary antibodies and visualized via the BioRad system.

Quantitative RT-PCR (qRT-PCR)

Total RNA was extracted using the Total RNA Kit I (Omega Biotech, GA, USA). The PrimeScript™ FAST RT Reagent Kit with gDNA Erase (TaKaRa, Tokyo, Japan) was then used to synthesize cDNA from the isolated RNA. Gene expression was measured by real-time PCR using the SYBR Green mix (Servicebio, Wuhan, China) on the QuantStudio6 Real-Time PCR system (Applied Biosystems). Relative gene expression levels were calculated using the comparative cycle threshold (Ct) (2^{^−ΔΔCt}) formula and normalized to β-actin as the internal control. All qRT-PCR primer sequences are listed in Table 1.

Table 1.

Primer sequences involved in this study

Prime name	Forward (5’−3’)	Reverse (3’−5’)
STING	CCAGAGCACACTCTCCGGTA	CGCATTTGGGAGGGAGTAGTA
TBK1	TGGGTGGAATGAATCATCTACGA	GCTGCACCAAAATCTGTGAGT
IRF3	AGAGGCTCGTGATGGTCAAG	AGGTCCACAGTATTCTCCAGG
IFN-γ	GAGTGTGGAGACCATCAAGGA	GTATTGCTTTGCGTTGGACA
TNF-α	TGGCGTGGAGCTGAGAGATAACC	CGATGCGGCTGATGGTGTGG
TLR9	CCGTGACAATTACCTGGCCTTC	CAGGGCCTTCAGCTGGTTTC
CXCL10	GTGGCATTCAAGGAGTACCTC	TGATGGCCTTCGATTCTGGATT
FoxP3	GTGGCCCGGATGTGAGAAG	GGAGCCCTTGTCGGATGATG
Rorc	AGTCGGAGGGCAAGATCAGA	CAAGAGAGGTCCTGGGCAAG
IL-6	CACTGGTCTTTTGGAGTTTGAG	GGACTTTTGTACTCATCTGCAC
IL-17 A	GAGATATCCCTCTGTGATCTGG	GACAGAGTTCATGTGGTAGTCC

Determination of Cell Viability and Apoptosis

Jurkat T cells (approximately 8000 cells/well) were seeded into 96-well microplates and treated with cfDNA for 0, 12, 24, or 36 h. Then, 10% CCK-8 solution was added to each well and incubated at 37 °C for 2 h. Absorbance was read at 450 nm using a microplate reader. For apoptosis analysis, the Annexin V-FITC/PI Apoptosis Kit (Elabscience, Wuhan, China) was used. Briefly, Jurkat T cells and γδ T cells were harvested after pre-treatment. Samples were stained with Annexin V-FITC/PI for 20 min, and data were acquired using flow cytometry (Cytoflex LX) and analyzed with FlowJo 10.0 software. Apoptotic cells were quantified as the percentage of Q2 (late apoptosis, Annexin V⁺-PI⁺) plus Q3 (early apoptosis, Annexin V⁺-PI⁻) quadrants.

Statistical Analysis

All statistical analyses were conducted using GraphPad Prism 9 software. For data conformed to a normal distribution and exhibited homogeneity of variance, analyses were performed using independent-samples t-test (for 2 groups) or one-way analysis of variance (ANOVA) (for multiple groups). Otherwise, non-parametric Mann-Whitney U-tests (for 2 groups) or Kruskal-Wallis tests (for multiple groups) were employed. Data were presented as mean ± standard deviation (SD) from at least 3 independent experiments for parametric tests, whereas the median (interquartile range) was used for non-parametric tests. P value < 0.05 was considered statistically significant.

Results

Aberrant Expression Pattern of γδ T Cells in OLP

As shown in Fig. 1a, over half of the immune cell types were upregulated in lichen planus tissues compared to normal tissues. Notably, the infiltration degree of γδ T cells was significantly elevated in the lichen planus group (Fig. 1a). The percentage of CD3⁺ γδ T cells (OLP versus CON: 6.933%±1.846% versus 11.32%±1.563%, P = 0.0087) was significantly decreased in OLP peripheral blood (Fig. 1b). However, the percentages of CD3⁺ γδ T cells (OLP versus CON: 33.67%±3.922% versus 15.96%±7.609%, P = 0.0061) were significantly elevated in OLP lesions (Fig. 1d-e). Notably, the majority of γδ T cells were Vδ1 γδ T cells both in OLP peripheral blood (OLP versus CON: 34.73%±5.290% versus 4.322%±0.9095%, P < 0.0001, Fig. 1c) and lesions (OLP versus CON: 37.21%±2.584% versus 18.78%±15.73%, P = 0.0344, Fig. 1d-e), while Vδ2 γδ T cells were markedly reduced in OLP peripheral blood (OLP versus CON: 5.847%±1.779% versus 45.98%±6.717%, P < 0.0001, Fig. 1c) and lesions (OLP versus CON: 0.4160%±0.2625% versus 19.29%±16.83%, P = 0.0136, Fig. 1d-e).

Fig. 1.

The aberrant expression pattern of γδ T cells in OLP. a Differences in the abundance of infiltrating immune cells. Control epithelium samples were shown in blue, and lichen planus epithelium samples were shown in green. X-axis represented the different cell types, and the Y-axis represented the proportions of different immune cells infiltration. b, c Flow cytometry revealed the proportions of CD3⁺ γδ T cells, Vδ1⁺, and Vδ2⁺ γδ T cells in OLP and healthy controls peripheral blood. d, e The expression of CD3⁺ γδ T cells, Vδ1⁺, and Vδ2⁺ γδ T cells in OLP and healthy controls tissues. f-h Intracellular staining of cytokines IL-17, IL-6, and IFN-γ in local γδ T cells from OLP lesions and healthy controls tissues. i, j Comparison of IL-6 and IL-17 expression in Vδ1⁺ and Vδ2⁺ γδ T cells in OLP and healthy controls tissues. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns: nonsignificant, P > 0.05. CON: healthy controls; OLP: oral lichen planus

Furthermore, the differential expression of proinflammatory cytokines IL-17, IL-6, and IFN-γ was investigated in OLP lesions (Fig. 1f-h). In particular, IL-17⁺γδ T (γδT17) cells were significantly upregulated in OLP lesions (OLP versus CON: 22.89%±8.665% versus 6.192%±3.241%, P = 0.0050, Fig. 1f). Moreover, the proportions of IL-6⁺γδ T cells (OLP versus CON: 12.16%±3.819% versus 7.240%±1.701%, P = 0.0351, Fig. 1 g) and IFN-γ⁺ γδ T cells (OLP versus CON: 10.88%±3.429% versus 6.616%±1.802%, P = 0.0460, Fig. 1 h) in OLP were higher than in controls. Cytokine secretion varied among γδ T cell subtypes. Vδ1 γδ T cells showed increased expression of IL-6 (OLP versus CON: 12.333%±4.233% versus 1.275%±0.399%, P = 0.0032, Fig. 1i) and IL-17 (OLP versus CON: 31.300%±8.490% versus 5.293%±1.963%, P < 0.0001, Fig. 1j). In contrast, Vδ2 γδ T cells exhibited elevated IL-6 (OLP versus CON: 11.968%±4.799% versus 2.075%±1.890%, P = 0.0076, Fig. 1i) expression, but there was no significant change in IL-17 levels (Fig. 1j). Therefore, our findings indicated that Vδ1 cells predominantly secreted IL-17, while Vδ2 cells mainly produced IL-6 (Fig. 1i-j). This differentiation in cytokine secretion patterns highlighted the distinct functional roles of Vδ1 and Vδ2 γδ T cell subsets in the immune-inflammatory processes of OLP.

Activation of the cGAS-STING-TBK1 Pathway in OLP γδ T Cells

The expression levels of p-STING and p-TBK1 were significantly upregulated in OLP lesions. Both p-STING and p-TBK1 predominantly accumulated in the lymphocytic infiltrate of the lamina propria (Fig. 2a). Further protein expression tests showed that p-STING, p-TBK1, IFN-γ, and IL-17 were significantly upregulated in OLP tissues when compared with normal controls (Fig. 2b-c). Patients with erosive OLP showed elevated expression of p-STING and p-TBK1 than those with non-erosive lesions. Moreover, the expression of p-STING in OLP peripheral blood showed a similar tendency as in OLP lesional tissues (Fig. 2d-e).

Fig. 2.

Activation of the cGAS-STING-TBK1 pathway in OLP γδ T cells. a Increased expression of p-STING and p-TBK1 in OLP and normal control lesions. b, c Western blot analysis of p-TBK1, p-STING, IFN-γ, and IL-17 expression in OLP lesion tissues and normal controls. d, e The expression of p-STING protein in OLP and normal control peripheral blood. f Purity assessment of magnetically isolated γδ T cells from PBMCs, showing above 90% TCR γδ⁺ cells by flow cytometry. g Relative mRNA expression of STING and TBK1 in sorted γδ T cells and non-γδ monocytes from peripheral blood. h Relative mRNA expression of STING, TBK1, IRF3, NF-κB, and IFN-γ in γδ T cells. i, j The expression of p-STING protein in γδ T cells. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns: nonsignificant, P > 0.05. CON: healthy controls; OLP: oral lichen planus; NEOLP: non-erosive oral lichen planus; EOLP: erosive oral lichen planus

Primary γδ T cells were isolated and expanded from PBMCs. The isolated purity was above 90% (Fig. 2f). The mRNA expression of STING and TBK1 was increased in the sorted OLP γδ T cells compared to other monocytes (Fig. 2 g). OLP γδ T cells, especially in erosive OLP patients showed elevated expression level of the cGAS-STING-TBK1 pathway-related proteins than γδ T cells from normal controls (Fig. 2h-j).

Increased cfDNA Activated the cGAS-STING-TBK1 Pathway of OLP γδ T Cells

To further investigate the regulatory mechanism of cGAS-STING-TBK1 pathway, we here cocultured T cells with OLP plasma. The cGAS-STING-TBK1 pathway was significantly activated in T cells exposed to OLP plasma (Fig. 3a-e). Additionally, the expression of γ-H2A.X, a marker of double-stranded DNA damage, was upregulated in OLP plasma. These results collectively suggested the presence of DNA damage and activation of the cGAS-STING-TBK1 pathway in OLP.

Fig. 3.

Increased level of cfDNA activated the cGAS-STING-TBK1 pathway in OLP γδT cells and Jurkat T cells. a, b Immunofluorescence staining for p-STING and γ-H2A.X in Jurkat T cells were cultured with plasma from OLP and normal controls. c, d Western blot analysis of p-STING, p-TBK1, p-NF-κB, and NF-κB (normalized to β-actin) in Jurkat T cells. e qRT-PCR quantification of STING, TBK1, and IRF3 mRNA levels in Jurkat T cells. f Quantification of cfDNA concentration in NEOLP, EOLP, and normal control plasma samples. g The correlation between cfDNA levels and OLP severity, represented by RAE Scoring System. h-j The effect of cfDNA on the cGAS-STING-TBK1 pathway in primary γδ T cells. k, l The effect of cfDNA on the secretion of IFN-γ in primary γδ T cells. m The effect of cfDNA on mRNA expression of IL-6, IL-17, and TNF-α in primary γδ T cells. n-p The activation effect of cfDNA on cGAS-STING-TBK1 pathway in Jurkat T cells. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns: nonsignificant, P > 0.05. CON: healthy controls; OLP: oral lichen planus; NEOLP: non-erosive oral lichen planus; EOLP: erosive oral lichen planus

Then, cfDNA was extracted from OLP plasma. The concentration of cfDNA derived from OLP patients (cfDNA-OLP) was significantly increased than in the normal control group (cfDNA-Normal) (OLP versus CON: 112.4 ng/ml ±38.01 versus 75.48 ng/ml ± 35.03, P = 0.0004, Fig. 3f). Patients with erosive OLP exhibited a higher cfDNA level than those non-erosive lesions (EOLP versus NEOLP: 116.3 ng/ml ± 46.79 versus 80.83 ng/ml ± 15.06, P = 0.0183) (Fig. 3f). However, no significant correlation was observed between the content of OLP circulating cfDNA and the severity of OLP represented by RAE scores (Fig. 3 g).

The expression of cGAS-STING-TBK1 pathway-related proteins in γδ T cells (Fig. 3h-j) and Jurkat T cells (Fig. 3n-p) was significantly elevated in response to cfDNA stimulation, particularly under the stimulation of cfDNA-OLP, which could be reversed by the STING antagonist H151. Additionally, cfDNA stimulated γδ T cells to secrete proinflammatory cytokines, including IFN-γ, IL-6, IL-17 and TNF-α, which could be suppressed by H151 (Fig. 3k-m).

Effects of cfDNA on T Cell Apoptosis and Differentiation

Besides the activating effects on cGAS-STING-TBK1 pathway, OLP plasma also reduced the apoptosis rate of T cells (Fig. 4a-b). Notably, T cells exhibited suppressed apoptosis rate (P = 0.3295, Fig. 4c-d) and enhanced proliferation (P < 0.0001, Fig. 4e-g) after transfected with cfDNA isolated from plasma. cfDNA-OLP slightly reduced the apoptosis rate of OLP γδ T cells (P = 0.7600) (Fig. 4i-j). Additionally, cfDNA-OLP suppressed the differentiation of both T cells (Fig. 4 h) and primary OLP γδ T cells (Fig. 4k) into Th17 subtypes, whereas promoted their differentiation into Foxp3⁺ Treg cells.

Fig. 4.

Effects of cfDNA on T cell apoptosis and differentiation. a, b Apoptosis rate of Jurkat T cells cultured with plasma from OLP and normal controls by Annexin V/PI staining. c-g The effects of cfDNA on Jurkat T cells apoptosis and proliferation. i, j The effects of cfDNA on primary γδ T cells apoptosis. Effects of cfDNA on Jurkat T cells h and primary γδ T cells k differentiation toward Th17 and Foxp3⁺ Treg phenotype. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns: nonsignificant, P > 0.05. CON: healthy controls; OLP: oral lichen planus

Activation of the STING Pathway in Animal Inflammation Model

Currently, there is no widely accepted OLP animal model. P. melaninogenica has been demonstrated to be abundantly present on the mucosal surfaces of OLP lesions, which can penetrate the epithelial layer and even the lamina propria [23, 24]. In the present study, a chronic oral mucosal inflammation model was established in mice by local injection of P. melaninogenica. Histological analysis revealed prevalent lymphocytic infiltration in the buccal mucosa of the P. melaninogenica-treated group (Fig. 5a). Immunohistochemical staining revealed that P. melaninogenica treatment enhanced CD3⁺ and CD4⁺ T cells infiltration and activated the cGAS-STING-TBK1 pathway in this chronic oral mucosal inflammation mice model. Notably, the STING inhibitor C-176 suppressed STING pathway activation and reduced T cell infiltration (Fig. 5b). The mRNA expression levels of proinflammatory cytokines IL-6, IL-1β, TNF-α, and IL-17 were significantly elevated in mice treated with P. melaninogenica, whereas treatment with the STING inhibitor C-176 markedly reduced the expression of these proinflammatory cytokines (Fig. 5c).

Fig. 5.

Activation of the STING-TBK1 pathway in animal inflammation model. a Representative H&E staining of buccal mucosa sections showing epithelial structure and inflammatory infiltration in the OLP model and control group. b Immunohistochemical staining of CD3, CD4, and the STING pathway-related proteins STING and NF-κB in buccal mucosa tissues. c Relative mRNA expression of cGAS, STING, and proinflammatory cytokines IL-6, IL-1β, TNF-α, and IL-17 in buccal mucosa tissues from OLP model and controls. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns: nonsignificant, P > 0.05

Discussion

In the present study, we revealed distinct expression pattern of γδ T cells in OLP and identified the Vδ1 subset as the predominant population. γδ T cells were overexpressed in OLP lesions but decreased in peripheral blood. The majority of γδ T cells were Vδ1 subset, whereas Vδ2 γδ T cells were significantly reduced both in OLP lesions and peripheral blood. Our previous research revealed a tissue tropism of activated OLP γδ T cells [12, 13]. γδ T cells also exhibited tissue tropism in psoriasis, partially due to the redistribution of circulating Vγ9Vδ2 T cells from peripheral blood to skin sites [25]. Additionally, IL-6⁺, IL-17⁺, and IFN-γ⁺ γδ T cells, were accumulated in OLP lesional tissues. Vδ1 cells predominantly secreted IL-17, while Vδ2 cells mainly produced IL-6. Elevated levels of IL-6, IL-17, and IFN-γ in OLP exacerbated the proinflammatory cascade by recruiting effector cells [26, 27]. In particular, as the main inflammatory cytokines secreted by the predominating Vδ1 γδ T cells, IL-17 have been reported infiltrate in the epithelial layer of OLP, reinforcing T-cell mediated responses and the production of inflammatory mediators [28]. Therefore, γδ T cells may participate in the immune responses of OLP by secreting proinflammatory cytokines.

Our recent study verified the co-localization of STING and TBK1 proteins in γδ T cells within OLP lesions [13]. Accordingly, the present study indicated a functional activation of cGAS-STING-TBK1 pathway in OLP lesions and peripheral OLP γδ T cells, especially in erosive OLP patients showed elevated expression level of the cGAS-STING-TBK1 pathway-related proteins than γδ T cells from normal controls. The cGAS-STING-TBK1 pathway served as a crucial intracellular mechanism mediating the IFN response and promoting the secretion of inflammatory cytokines [14]. Activation of the STING ligand induced the production of IFN-γ and TNF-α in short-term expanded γδ T cells [19]. Therefore, it is speculated that the cGAS-STING-TBK1 pathway may regulate the proinflammatory activity of γδ T cells in OLP.

DNA damage or abnormal accumulation of cfDNA triggered the activation of the cGAS-STING-TBK1 pathway, leading to excessive interferon production [29, 30]. The present study revealed the presence of DNA damage in OLP, with increased γ-H2A.X expression and elevated concentrations of cfDNA in OLP plasma. cfDNA-OLP has been reported to induce the inflammatory response via activating the STING pathway in THP-1 macrophages [18]. In present study, cfDNA-OLP stimulated the secretion of inflammatory cytokines, modulating γδ T cell survival and differentiation via activating the cGAS-STING-TBK1 pathway. Collectively, these findings suggested that abnormal accumulation of cfDNA in OLP plasma activated the cGAS-STING-TBK1 pathway in γδ T cells, thereby contributing to the immune-responses of OLP.

Currently, there is no widely accepted OLP animal model. Previous studies have demonstrated that P. melaninogenica is abundantly present on the mucosal surfaces of OLP lesions and exhibit the capacity to invade both the epithelial layer and the underlying lamina propria [24]. In the present study, P. melaninogenica markedly enhanced T lymphocyte infiltration and the expression levels of proinflammatory cytokines, accompanied by activation of cGAS-STING-TBK1 pathway in this inflammation model. Consistent with forementioned findings, treatment with the STING inhibitor significantly suppressed the cGAS-STING-TBK1 pathway activation, reduced T cell infiltration, and decreased proinflammatory cytokine production, indicating a critical role of the STING pathway in the progression of oral mucosal inflammation.

The present study firstly isolated and expanded primary OLP γδ T cells and revealed the predominant Vδ1 subset of OLP γδ T cells. Besides, the aberrant accumulation of circulating cfDNA activated the cGAS-STING-TBK1 pathway in γδ T cells, promoting the inflammatory responses in OLP (Fig. 6). Future studies will aim to elucidate the in vivo mechanisms and regulatory roles of the cGAS-STING-TBK1 pathway in γδ T cells of OLP. Moreover, the development of small-molecule inhibitors targeting the cGAS-STING-TBK1 pathway in γδ T cells may offer a novel therapeutic strategy to alleviate the immune-mediated chronic inflammation in OLP.

Fig. 6.

Aberrant accumulation of cell-free DNA activates the cGAS-STING-TBK1 pathway of γδ T cells in OLP

After the recognition of aberrant cfDNA derived from apoptotic keratinocytes or dying cells by cGAS enzyme, which catalyzes the synthesis of cGAMP, and then activates STING and TBK1. Subsequently, STING activates the transcription factor NF-κB, which functions together with phosphorylated IRF3 to induce the expression of type I interferon and proinflammatory cytokines in OLP. Elevated levels of IL-6, IL-17, and IFN-γ exacerbate the proinflammatory cascade by recruiting effector cells in OLP. These effector cells, especially cytotoxic T cells, in turn mediate the apoptosis of keratinocytes, leading to accumulation of cfDNA and self‑sustaining inflammatory responses in OLP.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contributions

Xin-Yi Wei performed the experiments, analyzed the data, and drafted the manuscript. Ya-Qin Tan conceived the study and revised the manuscript. Gang Zhou supervised the experiments, and provided the resources. All authors have read and approved the final article.

Funding

This work was supported by the National Natural Science Foundation of China (Nos. 82201068, 82270983, and 82470982).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethical approval

This study was approved by the Ethics Committee of the School and Hospital of Stomatology, Wuhan University (No. 2022A29), and was conducted in compliance with the ethical guidelines of the Declaration of Helsinki.

Consent to participate

Informed consent was obtained from all subjects.

Consent for publication

Informed consent for publication was obtained from all subjects.

Competing interests

The authors declare no competing interests.