Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Jan 17;16:5604. doi: 10.1038/s41598-026-36084-2

Aesculetin (6,7-dihydroxycoumarin) enhances the differentiation of human bone marrow-derived mesenchymal stem cells into functional hepatocyte-like cells

Sook-Kyoung Heo 1, Yerang Shin 1, Sung Ah Kim 1, Minhui Kim 1, Eui-Kyu Noh 2,, Jae-Cheol Jo 1,2,
PMCID: PMC12891613  PMID: 41547666

Abstract

While a liver transplant is the best therapeutic intervention for patients with severe liver failure, this life-saving procedure has significant limitations. The primary challenges are the severe shortage of organ donors, the inherent risks of major surgery, the substantial financial cost, and the need for lifelong immunosuppressive medication to prevent the body from rejecting the new organ. Accordingly, liver cell transplantation may be a promising alternative option. While aesculetin is recognized for its diverse biological properties, including anticancer, antioxidant, and anti-inflammatory effects, its potential to promote the differentiation of hepatocyte-like cells has not yet been fully investigated. Aesculetin (6,7-dihydroxycoumarin) is a bioactive compound that can facilitate the differentiation of human bone marrow-derived mesenchymal stem cells (hBM-MSCs) into hepatocyte-like cells. In this study, we explored the effectiveness of aesculetin in directing hBM-MSCs toward a hepatic lineage. After aesculetin treatment, the hBM-MSCs exhibited increased expression of liver-specific markers such as albumin, CK-18, CK-19, CYP1A1, CYP1A2, CYP3A4, SOX17, and FOXA2, indicating successful lineage commitment. The aesculetin-treated cells demonstrated enhanced glycogen storage and increased indocyanine green uptake, demonstrating greater hepatic functionality than untreated controls. Importantly, further analysis revealed that the differentiation process promoted by aesculetin was associated with the activation of the STAT3 and STAT5 signaling pathways. Collectively, these findings underscore the pivotal role of aesculetin in promoting the hepatic differentiation of hBM-MSCs and demonstrate its potential as a key component for regenerative medicine applications in liver tissue engineering or stem cell-based therapies.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-36084-2.

Keywords: Aesculetin; 6,7-Dihydroxycoumarin; Hepatocyte-like cells; Human bone marrow-derived mesenchymal stem cells; Differentiation

Subject terms: Biotechnology, Cell biology, Drug discovery, Stem cells

Introduction

Liver transplantation is currently the most effective therapeutic option for patients with acute or chronic liver failure1,2. However, the broader application and overall success of this treatment are often significantly limited by a shortage of available donor organs, potential surgical complications, high healthcare costs, and the need for lifelong immunosuppressive therapy to prevent graft rejection3. Liver cell transplantation has emerged as a promising and innovative alternative that could address these limitations, offering potential benefits such as minimized invasiveness, lower risk of complications, decreased reliance on immunosuppressants, and improved availability for patients awaiting treatment3,4. Furthermore, hepatocyte transplantation is also actively used as a treatment for patients with liver-based metabolic disorders, such as Crigler–Najjar syndrome type 1 and glycogen storage disease type I 46.

Mesenchymal stem cells (MSCs) are mature, multipotent progenitor cells capable of self-renewal7,8. They are found in a wide range of tissues and organs, including bone marrow (BM-MSCs)8, umbilical cord blood9, adipose tissues10, placenta11, dental pulp12, and synovial membrane13. MSCs exhibit the potential to differentiate into multiple mesodermal lineages, notably osteogenic, chondrogenic, and adipogenic cell types14. Because of this potential, as well as their notable immunoregulatory functions, MSCs have garnered significant interest in both preclinical and clinical research as promising candidates for the treatment of various autoimmune and degenerative disorders. Depending on the nature of the surrounding inflammatory environment, MSCs can exhibit either immunosuppressive or pro-inflammatory characteristics7.

Aesculetin (6,7-dihydroxycoumarin) is a naturally derived compound belonging to the coumarin family that occurs in several medicinal plants, such as Artemisia capillaris and A. princeps1517. Aesculetin exhibits a wide spectrum of biological activities, most notably its ability to neutralize reactive oxygen species and enhance the body’s antioxidant defense mechanisms18,19. Aesculetin may also be a potent anti-inflammatory agent, given its ability to downregulate key pro-inflammatory mediators, primarily by inhibiting the NF-κB and MAPK signaling pathways20,21. Oncology studies have demonstrated the promising anticancer effects of aesculetin in various cancers, including leukemia17,22, breast23, colon24, lung25, and pancreatic cancers26. Furthermore, aesculetin exerts hepatoprotective effects by mitigating chemically induced liver damage27. Although aesculetin has been actively studied as a potential therapeutic agent for various pathological conditions due to its diverse biological activities, its ability to promote the differentiation of MSCs into hepatocyte-like cells has not been elucidated.

Materials and methods

Materials and reagents

Aesculetin was obtained from Sigma-Aldrich (St. Louis, MO, USA). The Mesenchymal Stem Cell Growth Medium BulletKit™ (MSCGM™) was obtained from Lonza (Basel, Switzerland). Anti-human CD44–fluorescein isothiocyanate (FITC), anti-human CD90-FITC, anti-human CD105-FITC, anti-human CD19-FITC, anti-human CD34-FITC, anti-human CD45-FITC, and FITC mouse immunoglobulin G (IgG)-isotype control antibodies were purchased from BD Biosciences (San Diego, CA, USA). Antibodies against albumin, SRY-box transcription factor 17 (SOX17), forkhead box A2 (FOXA2), signal transducer and activator of transcription 3 (STAT3), STAT5, cyclin D3, B-cell lymphoma-extra large (Bcl-xl), myeloid cell leukemia-1 (MCL-1), protein kinase B (AKT), phospho-AKT, rabbit IgG-horseradish peroxidase (IgG-HRP), and mouse IgG-HRP were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against cytokeratin-18 (CK-18), CK-19, cytochrome P450 family 1 subfamily A member 1 (CYP1A1), CYP1A2, CYP3A4, phospho-signal transducer and activator of transcription 3 (STAT3), phospho-STAT5, c-MYC, cyclin D1, B-cell lymphoma protein 2 (Bcl-2), and β-actin were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). All reagents and media used in this study were obtained from Sigma–Aldrich (St. Louis, MO, USA), including hepatocyte growth factor (HGF), fibroblast growth factor-2 (FGF-2), oncostatin M (OSM), and insulin–transferrin–sodium selenite (ITS).

Human samples

Human bone marrow (BM) samples were collected once from all healthy volunteers participating in this study at the Ulsan University Hospital, Ulsan, South Korea.

hBM-MSCs isolation and culture

The isolation and culture of human BM (hBM)-MSCs were performed as described previously14,28. Briefly, the hBM-MSCs were passaged 3–9 times and maintained in MSCGM™ in a humidified environment with 5% CO2 at 37 °C.

Ethics approval

Human subject research submitted to Scientific Reports adheres to the principles outlined in the Declaration of Helsinki. The experimental protocol was developed in accordance with the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of Ulsan University College of Medicine (Approval Number: UUH-IRB-2016-07-026). All procedures involving human subjects were conducted in accordance with the relevant guidelines and regulations. All donors provided written informed consent prior to the commencement of the study.

HepG2 cell culture

Human hepatocellular carcinoma HepG2 cells were cultured and maintained in high glucose Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin (P/S) solution in a humidified atmosphere with 5% CO2 at 37 °C. The HepG2 cells were subsequently used as positive controls.

Marker staining by flow cytometry analysis

The hBM-MSCs were harvested and washed three times with fluorescence-activated cell sorting (FACS) buffer as described previously14,29. Cells were incubated on ice for 30 min with antibodies against cell surface antigens, negative markers (e.g., CD19, CD34, and CD45), and positive markers (e.g., CD44, CD90, and CD105). Subsequently, cells were washed three times with FACS buffer and analyzed using the NovoCyte flow cytometer (Agilent Technologies, USA).

Hepatogenic differentiation protocol

The hepatogenic differentiation process is structured into three key phases, each requiring a specific culture medium as described previously28: hepatocyte induction, hepatogenic differentiation, and hepatogenic maturation. The overall protocol is illustrated in Fig. 1A. Initially, 3 × 105 cells were plated onto 60-mm culture dishes using a preconditioning medium composed of 60% DMEM–low glucose (LG), 40% Molecular, Cellular, and Developmental Biology Medium (MCDB) 201, 1× P/S solution, 20 ng/mL epidermal growth factor (EGF), 10 ng/mL basic fibroblast growth factor (bFGF), and 10 ng/mL bone morphogenetic protein 4 (BMP-4). After 2 days of incubation, the culture medium was replaced with Stage I differentiation medium, which consisted of 60% DMEM-LG, 40% MCDB 201, 2% FBS, 1 × P/S, 10 ng/mL bFGF, and 20 ng/mL HGF. Following 7 days of differentiation, the cells were cultured in Stage II maturation medium containing 60% DMEM-LG, 40% MCDB 201, 2% FBS, 1 × P/S, 20 ng/mL OSM, 1 µM dexamethasone, and 1 × ITS supplement. Aesculetin was administered at various concentrations from day 0. For experimental validation, undifferentiated BM-MSCs were used as negative controls, while HepG2 cells served as positive controls.

Fig. 1.

Fig. 1

(A) Chemical structure of aesculetin. (B) Protocol for inducing the differentiation of human bone marrow-derived mesenchymal stem cells (hBM-MSCs) into hepatocyte-like cells by treatment with aesculetin, starting from Day 0. The composition of the hepatocyte differentiation medium is shown in detail.

Real-time quantitative reverse transcription-polymerase chain reaction

The real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed as previously described14,28,30. BM-MSCs were cultured under various aesculetin concentrations for 21 days. Total RNA was isolated from cells using the TRIzol Reagent (Sigma–Aldrich), and cDNA was synthesized using Superscript III Reverse Transcriptase according to the manufacturer’s instructions (Invitrogen, Grand Island, NY, USA). The cDNA was analyzed on the CFX96 real-time PCR system using iQ SYBR Green Supermix (BioRad, Hercules, CA, USA). All primers used in this experiment were synthesized by Bioneer Corporation (Daejeon, Korea). The primer sequences are shown in Table 1.

Table 1.

Sequences of primers used for quantitative RT-PCR.

Target gene Primer sequences (5’ → 3’)
Albumin Forward CCAAGTGTCAACTCCAACTCT
Reverse TCTGCACAGGGCATTCTTT
CYP1A1 Forward AATGCAGCTGCGCTCTTA
Reverse GGCTGAACCTTAGACCACATAG
CYP1A2 Forward CTTCCCAAAGTCCTGGGATTAC
Reverse CTGGTGATGGTTGCACAATTC
CK-18 Forward GACCTGGACTCCATGAGAAATC
Reverse GTTGAGCTGCTCCATCTGTA
CK-19 Forward GTGACATGCGAAGCCAATATG
Reverse GACCTCCCGGTTCAATTCTT
GAPDH Forward GATCATCAGCAATGCCTCCT
Reverse GTCATGAGTCCTTCCACGATAC

Cytochrome P450 1A2 : CYP1A2.

Cytokeratin-18 : CK-18.

Cytokeratin-19 : CK-19.

GAPDH : Glyceraldehyde 3-phosphate dehydrogenase.

Western blotting analysis

Western blotting was performed as described previously31,32. MSCs and HepG2 cells were used as negative and positive controls, respectively.

Periodic acid–Schiff staining

Glycogen storage by hepatocyte-like cells was evaluated by periodic acid–Schiff staining (PAS) staining as described previously28. Briefly, differentiated cells were fixed with 10% paraformaldehyde. After washing, the cells were incubated with 0.5% periodic acid for 5 min, rinsed thrice with distilled water, treated with Schiff’s reagent for 15 min in the dark, and rinsed again with distilled water for 5 min. The glycogen levels in the cells were subsequently visualized by incubating the cells once more with Schiff’s reagent and then observed under a light microscope. HepG2 cells were used as positive controls.

Indocyanine green uptake assay

The culture media were replaced with 1 mg/mL indocyanine green (ICG) prepared in culture media as known methods previously28. After incubation at 37 °C for 30 min, the cells were rinsed thrice with PBS, and ICG uptake was evaluated using an inverted microscope. HepG2 cells were used as positive controls.

Statistical analysis

Data are expressed as mean ± standard error of the mean based on at least three independent experiments. All values were evaluated by one-way analysis of variance, followed by Tukey’s range test. The analyses were performed using GraphPad Prism 8.0 software (GraphPad Software, Inc., La Jolla, CA, USA). Statistical significance was denoted by p < 0.05. Each treatment was assayed in triplicate.

Results

Aesculetin enhanced hepatocyte-specific marker proteins in hBM-MSCs

In our previous study, we assessed the extent of differentiation of hBM-MSCs and their quality into adipocytes by Oil Red O staining, into chondrocytes via Alcian Blue staining, and into osteocytes by Alizarin Red staining14. Figure 1A presents the chemical structure of aesculetin, while Fig. 1B outlines the hepatocyte differentiation protocol implemented in this study. Before commencing the study, hBM-MSCs were assessed for their ability to differentiate in vitro into hepatocyte-like cells using conditioned media, Stage I media, and Stage II media. hepatocyte-like cells derived from BM-MSCs were observed after 21 days of culture in these hepatic differentiation media, which were typically supplemented with HGF, FGF-2, OSM, and ITS liquid media (Fig. 1). To verify the status of MSCs prior to the experiment, negative and positive differentiation markers of hBM-MSCs were analyzed by flow cytometry, as shown in Fig. 2A and B. The MSCs used in this study consistently showed negative expression for CD34, CD45, and CD19 and positive expression for CD90, CD44, and CD105 (Fig. 2).

Fig. 2.

Fig. 2

Quality testing of human bone marrow-derived mesenchymal stem cells (hBM-MSCs) by flow cytometry. Staining of (A) negative (CD19, CD34, and CD45) and (B) positive (CD44, CD90, and CD105) markers in BM-MSCs. The red-filled histogram represents the isotype control (mouse immunoglobulins); the green filled histogram represents each antigen.

We incorporated these findings into the present study to elucidate the role of aesculetin in the differentiation of hBM-MSCs into functional hepatocyte-like cells. The expression of hepatocyte-specific marker genes, such as ALB, CYP1A1, CYP1A2, KRT18, and KRT19, were observed using qRT-PCR. The expression level of each gene increased with aesculetin treatment in a concentration-dependent manner (Fig. 3A and E). All genes showed the highest expression intensity on day 21 when the aesculetin concentration was 40 μm. ALB expression was highest on day 21 when the aesculetin concentration was 40 μm (Fig. 3F). Furthermore, even as the concentration of aesculetin increased to 60 μm under the same conditions, ALB expression remained at a comparable level to that of 40 μm. Considering the potential for drug toxicity, 40 μm was determined to be the optimal concentration for subsequent studies (Fig. 3).

Fig. 3.

Fig. 3

Aesculetin-induced differentiation of human bone marrow-derived mesenchymal stem cells (hBM-MSCs) into hepatocyte-like cells. After 21 days of treatment with aesculetin, the differentiation of hBM-MSCs into hepatocyte-like cells was evaluated by assessing the expression levels of hepatocyte-specific genes. The RNA expression levels of ALB (A), CYP1A1 (B), CYP1A2 (C), KRT18 (D), and KRT19 (E) were determined by quantifying the changes in aesculetin concentration by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR). qRT-PCR analysis RNA expression levels evaluated by day under treatment with 40 µM aesculetin (F). Data are expressed as mean ± standard error of the mean. *P < 0.05, **P < 0.01, and ***P < 0.001.

The expression of hepatocyte-related proteins, such as albumin, CK-18, CK-19, CYP1A1, CYP1A2, and CYP3A4, increased significantly (Fig. 4A and C). Furthermore, the expression levels of definitive endoderm markers SOX17 and FOXA2 also significantly increased under the same experimental conditions (Fig. 4D). Therefore, aesculetin effectively promoted the expression of both hepatocyte-specific proteins and absolute endoderm markers, thereby facilitating the differentiation of hBM-MSCs into hepatocyte-like cells. Furthermore, the differentiated cells not only expressed hepatocyte markers but may also exhibit biological activity comparable to those of HepG2 cells (Fig. 4).

Fig. 4.

Fig. 4

Aesculetin (Aes) enhanced the expression of hepatocyte-specific marker proteins in human bone marrow-derived mesenchymal stem cells (hBM-MSCs). Cells were treated with 0, 20, and 40 µM aesculetin for 21 days. Immunoblotting analysis revealed that the protein expression of the hepatocyte-specific marker proteins (A) albumin, (B) CK-8, CK-9, (C) CYP1A1, CYP1A2, CYP3A4, (D) SOX17, and FOXA2 significantly increased under 40 µM aesculetin compared with the control group (0 µM aesculetin). All assays were performed with undifferentiated BM-MSCs as negative controls and HepG2 cells as positive controls. The membrane was stripped and re-probed with an anti-β-actin monoclonal antibody to confirm equal loading. The original blots are presented in Supplementary Fig. 1.

Aesculetin enhanced the differentiation of hBM-MSCs into functional hepatocyte-like cells

To further characterize the hepatocyte-like cells derived from hBM-MSCs, we evaluated their functional capacity by assessing glycogen storage and ICG uptake. Glycogen accumulation was first evaluated by PAS staining. Numerous cells treated with 40 µM aesculetin exhibited strong PAS-positive staining, indicating significant glycogen storage (Fig. 5A). Notably, the intensity of PAS staining was comparable to that observed in HepG2 cells, a hepatocyte-derived cell line. Quantitative analysis of PAS staining intensity is shown in Fig. 5B.

Fig. 5.

Fig. 5

Functional analysis of glycogen accumulation in hepatocytes-like cells derived from aesculetin (Aes)-induced human bone marrow-derived mesenchymal stem cells (hBM-MSCs). Aesculetin enhanced the differentiation of hBM-MSCs into functional hepatocyte-like cells. Cells were stimulated with 0 and 40 µM aesculetin for 21 days. (A) Periodic acid–Schiff (PAS) staining for glycogen revealed glycogen storage by the differentiated hBM-MSCs after hepatogenic induction for 21 days. HepG2 cells were used as positive control. Magnification: 100×; scale bar: 200 μm. (B) Relative intensity of glycogen as analyzed by PAS staining in (A). The relative intensity was measured using the ImageJ software. Data are expressed as mean ± standard error of the mean. ***P < 0.001.

Furthermore, we assessed ICG uptake, a hallmark of mature hepatocyte function. The majority of aesculetin-induced cells demonstrated efficient ICG uptake, exhibiting a staining intensity similar to that of HepG2 cells (Fig. 6A). The relative quantification of ICG uptake is summarized in Fig. 6B. These findings collectively demonstrate the ability of aesculetin to promote not only the differentiation of hBM-MSCs into hepatocyte-like cells but also the acquisition of functional hepatocyte characteristics (Figs. 5 and 6).

Fig. 6.

Fig. 6

Functional analysis of indocyanine green uptake in hepatocytes-like cells derived from aesculetin (Aes)-induced human bone marrow-derived mesenchymal stem cells (hBM-MSCs). Under the same conditions as in Fig. 5, cells were stimulated with 0 and 40 µM aesculetin for 21 days. (A) Differentiated hBM-MSCs were positive for indocyanine green (ICG) after incubation in ICG solution for 30 min. HepG2 cells were used as positive control. Magnification: 100×; scale bar: 200 μm. (B) Relative intensity of ICG uptake in (A). The relative intensity was measured using the ImageJ software. Data are expressed as mean ± standard error of the mean. ***P < 0.001.

Aesculetin activated the STAT3 and STAT5 pathways in hBM-MSC-derived hepatocyte-like cells

The diverse roles of STAT3 in liver regeneration, which include cell survival, proliferation, DNA synthesis, and liver mass restoration, have all been demonstrated previously33,34. Furthermore, STAT5 activation is essential for hepatocyte differentiation from human induced pluripotent stem cells (iPSCs). These findings signify that sustained STAT5 activation is crucial for hepatocyte maturation35. Based on these previous findings, we investigated whether the STAT3 and STAT5 signaling pathways participate in the differentiation and proliferation of hepatocyte-like cells derived hBM-MSCs following aesculetin treatment. We confirmed that STAT3, several of its downstream proteins (c-MYC, cyclin D1, cyclin D3, Bcl-2, Bcl-xL, and MCL-1), and STAT5 were significantly activated during the aesculetin-induced differentiation and proliferation of hepatocyte-like cells (Fig. 7A, C). Furthermore, AKT, a representative survival signaling molecule, was activated following aesculetin stimulation (Fig. 7D). Therefore, the STAT3 and STAT5 signaling pathways may be critical processes in the differentiation and proliferation of hBM-MSC-derived hepatocyte-like cells after aesculetin treatment. Therefore, aesculetin-induced hepatocyte differentiation of hBM-MSCs is mediated through activation of the STAT3 and STAT5 pathways (Fig. 7).

Fig. 7.

Fig. 7

Aesculetin (Aes) significantly enhanced the differentiation of human bone marrow-derived mesenchymal stem cells (hBM-MSCs) into functional hepatocyte-like cells by stimulating the signal transducer and activator of transcription 3 (STAT3) and STAT5 signaling pathways. Under the same conditions as in Fig. 6, cells were stimulated with 0 and 40 µM aesculetin for 21 days. (A) Expression of phosphorylated STAT3 (p-STAT3) and STAT3, as determined by western blotting analysis. (B) Expression of STAT3 downstream proteins (c-MYC, cyclin D1, cyclin D3, B-cell lymphoma protein 2, B-cell lymphoma-extra large, and myeloid cell leukemia-1). (C) Expression of p-STAT5, and STAT5, as determined by western blotting analysis. (D) Expression of protein kinase B (AKT) and p-AKT, as determined by western blotting analysis. The membrane was stripped and re-probed with an anti-β-actin monoclonal antibody to confirm equal loading. The original blots are presented in Supplementary Fig. 1.

Discussion

Severe liver dysfunction, including cirrhosis and liver cancer, is a life-threatening condition that requires effective treatment36. Given the significance of the liver in metabolic processes and detoxification, diseases can severely impair its function, often irreversibly. Complete loss of liver functionality leads to significant morbidity and mortality, with liver transplantation traditionally being the only viable treatment. However, it is severely limited by the scarcity of healthy donors, thereby prompting the development of alternative strategies, one of which being hepatocyte transplantation. MSCs, which are mature stem cells capable of differentiating into multiple cell types, have become the focus of innovative methods aimed at generating hepatocyte-like cells suitable for therapeutic applications12.

Hepatocyte transplantation and bioartificial liver systems can offer temporary metabolic support and have emerged as viable therapeutic options for managing liver failure. Hepatocyte-like cells derived from MSCs hold substantial potential as cellular resources for liver regeneration and tissue engineering applications37. Although MSCs are considered an optimal cell source for liver transplantation and tissue engineering, current differentiation protocols remain insufficient for reliably producing functional hepatic cells from MSCs, limiting their applicability for routine clinical use38. Despite these limitations, the therapeutic application of human stem cells in liver diseases remains a viable alternative. MSCs are multipotent mature stem cells capable of differentiating into various cell lineages and possessing immunomodulatory functions independent of human leukocyte antigen restrictions39,40. The multipotent characteristics of MSCs underlie their broad applications in immunotherapy and regenerative medicine. Despite this increased utilization, no standardized protocols for MSC production have been established. Regardless of the tissue origin—be it bone marrow, adipose tissue, or umbilical cord blood—key variables, including the initial seeding density, number of passages, and composition of the culture medium, crucially influence the cultivation process and require careful optimization39.

Research on various stem cells has demonstrated the enormous therapeutic potential of stem cell-based therapies in the treatment of degenerative, autoimmune, and genetic diseases38. Reports on stem cell-based therapies for spinal cord injury and type 1 diabetes reveal the significant therapeutic potential of stem cells6,41. However, clinical applications of stem cells have raised numerous ethical and safety issues. The infinite differentiation potential of iPSCs, which could be harnessed for human reproductive cloning, has elicited significant ethical concerns due to the risks of creating genetically engineered human embryos and human–animal chimeras. Furthermore, unwanted differentiation and malignant transformation significantly compromise safety. Although the clinical applications of MSCs have enhanced the treatment of autoimmune and chronic inflammatory diseases, their ability to promote tumor growth and metastasis, as well as their potentially overestimated therapeutic potential, remain substantial concerns in the field of regenerative medicine38.

Aesculetin has been recognized for its notable pharmacological and biological properties15,16. It has demonstrated antioxidant effects through its activation of the ERK pathway in myofibroblasts and anti-inflammatory effects by inhibiting the expression of inflammatory cytokines in atopic dermatitis1820. Aesculetin has exhibited anticancer effects in acute myeloid leukemia and various solid cancers17,2226. Acute liver failure is a fatal clinical disease that causes the rapid loss of liver function. Studies on acute liver failure mouse models have shown that aesculetin reduced oxidative stress and myeloperoxidase activity, decreased liver injury markers in serum (alanine aminotransferase, aspartate transaminase, and alkaline phosphatase), and decreased cytokine levels such as IL-1β, IL-6, and TNF-α. Furthermore, aesculetin improved liver tissue damage and exerted hepatoprotective effects27. Given its various biological activities, aesculetin emerges as a potential therapeutic agent for various pathological diseases.

This study found that aesculetin enhanced the expression of hepatocyte-specific genes and marker proteins in hBM-MSCs (Figs. 3 and 4). Notably, the upregulation of SOX17 and FOXA2, which are markers of endodermal lineage, in mesoderm-derived mesenchymal stem cells signifies their hepatocyte differentiation via aesculetin induction. Functional assessments (Figs. 5 and 6) further demonstrated that aesculetin facilitated the differentiation of hBM-MSCs into hepatocyte-like cells. Specifically, glycogen storage capacity and ICG uptake in cells treated with 40 µM aesculetin were comparable to those observed in HepG2 cells. These results support the conclusion that aesculetin successfully induced the functional differentiation of hBM-MSCs into hepatocyte-like cells. Furhtermore, aesculetin treatment increased the expression of key signaling proteins, including p-STAT3, STAT3, p-STAT5, STAT5, p-AKT, and AKT. Several downstream targets of STAT3 signaling—such as c-MYC, cyclin D1, cyclin D3, Bcl-2, Bcl-xL, and MCL-1—were also markedly upregulated in the aesculetin-induced hBM-MSCs (Fig. 7).

In conclusion, the results of this study demonstrate that aesculetin, a bioactive herbal compound, effectively promotes the differentiation of hBM-MSCs into hepatocyte-like cells. These findings highlight the therapeutic potential of aesculetin as a candidate molecule for liver regeneration. Nevertheless, comprehensive preclinical and clinical investigations are warranted to assess the long-term safety, efficacy, and translational applicability of MSC-based therapies incorporating aesculetin for the treatment of liver diseases.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

MSCs

Mesenchymal stem cells

BMCs

Bone marrow cells

BM-MSCs

Bone marrow-derived MSCs

FGF

Fibroblast growth factor

EGF

Epidermal growth factor

HGF

Hepatocyte growth factor

DMEM-LG

Dulbecco’s modified Eagle’s medium–low glucose

CK

Cytokeratin

CYP1A1

Cytochrome P450 family 1 subfamily A member 1

SOX17

SRY-Box transcription factor 17

FOXA2

Forkhead box protein A2

hBM-MSCs

Human BM-MSCs

mAb

Monoclonal antibody

ICG

Indocyanine green

PAS

Periodic acid–Schiff

STAT

Signal transducer and activator of transcription

Author contributions

S-K.H., E-K.N. and J-C.J. designed the study. S-K.H., Y.S., S.A.K, and M.K. performed the experiments. S-K.H., and E-K.N. analyzed and interpreted the experimental data. S-K.H., and J.C. provided discussions and suggestions for the experiments. S-K.H. and J-C.J. wrote the manuscript with input from all authors. E-K.N. and J-C.J. revised the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the Ulsan University Hospital Research Grant (UUH-2023-11).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Ethical approval and consent

Human subject research submitted to Scientific Reports adheres to the principles outlined in the Declaration of Helsinki. The experimental protocol was developed in accordance with the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of Ulsan University College of Medicine (Approval Number: UUH-IRB-2016-07-026).

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Eui-Kyu Noh, Email: noheuikyu@gmail.com.

Jae-Cheol Jo, Email: jcjo@uuh.ulsan.kr.

References

  • 1.So, B. N. & Reddy, K. R. Liver transplantation for the nonhepatologist. Med. Clin. North. Am.107, 605–621. 10.1016/j.mcna.2023.01.004 (2023). [DOI] [PubMed] [Google Scholar]
  • 2.Lai, J. C. et al. Development of a novel frailty index to predict mortality in patients with end-stage liver disease. Hepatology66, 564–574. 10.1002/hep.29219 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Iansante, V., Mitry, R. R., Filippi, C., Fitzpatrick, E. & Dhawan, A. Human hepatocyte transplantation for liver disease: Current status and future perspectives. Pediatr. Res.83, 232–240. 10.1038/pr.2017.284 (2018). [DOI] [PubMed] [Google Scholar]
  • 4.Nulty, J., Anand, H. & Dhawan, A. Human hepatocyte transplantation: Three decades of clinical experience and future perspective. Stem Cells Transl Med.13, 204–218. 10.1093/stcltm/szad084 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dhawan, A., Puppi, J., Hughes, R. D. & Mitry, R. R. Human hepatocyte transplantation: Current experience and future challenges. Nat. Rev. Gastroenterol. Hepatol.7, 288–298. 10.1038/nrgastro.2010.44 (2010). [DOI] [PubMed] [Google Scholar]
  • 6.Godfrey, K. J. et al. Stem cell-based treatments for type 1 diabetes mellitus: Bone marrow, embryonic, hepatic, pancreatic and induced pluripotent stem cells. Diabet. Med.29, 14–23. 10.1111/j.1464-5491.2011.03433.x (2012). [DOI] [PubMed] [Google Scholar]
  • 7.Gazdic, M., Volarevic, V., Arsenijevic, N. & Stojkovic, M. Mesenchymal stem cells: A friend or foe in immune-mediated diseases. Stem Cell. Rev. Rep.11, 280–287. 10.1007/s12015-014-9583-3 (2015). [DOI] [PubMed] [Google Scholar]
  • 8.Pittenger, M. F. et al. Multilineage potential of adult human mesenchymal stem cells. Science284, 143–147. 10.1126/science.284.5411.143 (1999). [DOI] [PubMed] [Google Scholar]
  • 9.Lee, O. K. et al. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood103, 1669–1675. 10.1182/blood-2003-05-1670 (2004). [DOI] [PubMed] [Google Scholar]
  • 10.Bunnell, B. A. Adipose tissue-derived mesenchymal stem cells. Cells 10, (2021). 10.3390/cells10123433 [DOI] [PMC free article] [PubMed]
  • 11.‘t Anker, P. S. et al. (eds) In Isolation of mesenchymal stem cells of fetal or maternal origin from human placenta. Stem Cells 22, 1338–1345, (2004). 10.1634/stemcells.2004-0058 [DOI] [PubMed]
  • 12.Afshari, A., Shamdani, S., Uzan, G., Naserian, S. & Azarpira, N. Different approaches for transformation of mesenchymal stem cells into hepatocyte-like cells. Stem Cell. Res. Ther.11, 54. 10.1186/s13287-020-1555-8 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.De Bari, C., Dell’Accio, F., Tylzanowski, P. & Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheum.44, 1928–1942. 10.1002/1529-0131(200108)44:8%3C1928::AID-ART331%3E3.0.CO;2-P (2001). [DOI] [PubMed] [Google Scholar]
  • 14.Heo, S. K. et al. Light (TNFSF14) increases the survival and proliferation of human bone marrow-derived mesenchymal stem cells. PLoS One. 11, e0166589. 10.1371/journal.pone.0166589 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Leung, K. N., Leung, P. Y., Kong, L. P. & Leung, P. K. Immunomodulatory effects of Esculetin (6,7-dihydroxycoumarin) on murine lymphocytes and peritoneal macrophages. Cell. Mol. Immunol.2, 181–188 (2005). [PubMed] [Google Scholar]
  • 16.Zhang, J., Feng, M. & Guan, W. Naturally occurring aesculetin coumarin exerts antiproliferative effects in gastric cancer cells mediated via apoptotic cell death, cell cycle arrest and targeting PI3K/AKT/M-TOR signalling pathway. Acta Biochim. Pol.68, 109–113. 10.18388/abp.2020_5463 (2021). [DOI] [PubMed] [Google Scholar]
  • 17.Gong, J., Zhang, W. G., Feng, X. F., Shao, M. J. & Xing, C. Aesculetin (6,7-dihydroxycoumarin) exhibits potent and selective antitumor activity in human acute myeloid leukemia cells (THP-1) via induction of mitochondrial mediated apoptosis and cancer cell migration Inhibition. J. BUON. 22, 1563–1569 (2017). [PubMed] [Google Scholar]
  • 18.Liu, G. et al. Antioxidant capacity and interaction of endogenous phenolic compounds from tea seed oil. Food Chem.376, 131940. 10.1016/j.foodchem.2021.131940 (2021). [DOI] [PubMed] [Google Scholar]
  • 19.Han, M. H. et al. Cytoprotective effects of Esculetin against oxidative stress are associated with the upregulation of Nrf2-mediated NQO1 expression via the activation of the ERK pathway. Int. J. Mol. Med.39, 380–386. 10.3892/ijmm.2016.2834 (2017). [DOI] [PubMed] [Google Scholar]
  • 20.Wang, S. K. et al. Aesculetin exhibited anti-inflammatory activities through inhibiting NF-small ka, CyrillicB and MAPKs pathway in vitro and in vivo. J. Ethnopharmacol.296, 115489. 10.1016/j.jep.2022.115489 (2022). [DOI] [PubMed] [Google Scholar]
  • 21.Jeong, N. H. et al. Esculetin from fraxinus rhynchophylla attenuates atopic skin inflammation by inhibiting the expression of inflammatory cytokines. Int. Immunopharmacol.59, 209–216. 10.1016/j.intimp.2018.04.005 (2018). [DOI] [PubMed] [Google Scholar]
  • 22.Rubio, V., Calvino, E., Garcia-Perez, A., Herraez, A. & Diez, J. C. Human acute promyelocytic leukemia NB4 cells are sensitive to Esculetin through induction of an apoptotic mechanism. Chem. Biol. Interact.220, 129–139. 10.1016/j.cbi.2014.06.021 (2014). [DOI] [PubMed] [Google Scholar]
  • 23.Chang, H. T. et al. Esculetin, a natural coumarin compound, evokes Ca(2+) movement and activation of Ca(2+)-associated mitochondrial apoptotic pathways that involved cell cycle arrest in ZR-75-1 human breast cancer cells. Tumour Biol.37, 4665–4678. 10.1007/s13277-015-4286-1 (2016). [DOI] [PubMed] [Google Scholar]
  • 24.Choi, Y. J., Lee, C. M., Park, S. H. & Nam, M. J. Esculetin induces cell cycle arrest and apoptosis in human colon cancer LoVo cells. Environ. Toxicol.34, 1129–1136. 10.1002/tox.22815 (2019). [DOI] [PubMed] [Google Scholar]
  • 25.Li, H., Wang, Q., Wang, Y., Xu, Z. & Han, Z. Esculetin inhibits the proliferation of human lung cancer cells by targeting epithelial-to-mesenchymal transition of the cells. Cell. Mol. Biol. (Noisy-le-grand). 65, 95–98 (2019). [PubMed] [Google Scholar]
  • 26.Arora, R. et al. Esculetin induces antiproliferative and apoptotic response in pancreatic cancer cells by directly binding to KEAP1. Mol. Cancer. 15, 64. 10.1186/s12943-016-0550-2 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mohamadi-Zarch, S. M. et al. Esculetin alleviates acute liver failure following Lipopolysaccharide/D-Galactosamine in male C57BL/6 mice. Iran. J. Med. Sci.46, 373–382. 10.30476/ijms.2020.84909.1474 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Heo, S. K. et al. LIGHT (TNFSF14) promotes the differentiation of human bone marrow-derived mesenchymal stem cells into functional hepatocyte-like cells. PLoS One. 18, e0289798. 10.1371/journal.pone.0289798 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Heo, S. K. et al. The c-Abl inhibitor, Radotinib induces apoptosis in multiple myeloma cells via mitochondrial-dependent pathway. Sci. Rep.11, 13198. 10.1038/s41598-021-92651-9 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Heo, S. K., Yun, H. J., Noh, E. K., Park, W. H. & Park, S. D. LPS induces inflammatory responses in human aortic vascular smooth muscle cells via Toll-like receptor 4 expression and nitric oxide production. Immunol. Lett.120, 57–64. 10.1016/j.imlet.2008.07.002 (2008). [DOI] [PubMed] [Google Scholar]
  • 31.Heo, S. K. et al. Targeting c-KIT (CD117) by dasatinib and Radotinib promotes acute myeloid leukemia cell death. Sci. Rep.7, 15278. 10.1038/s41598-017-15492-5 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Heo, S. K. et al. Radotinib inhibits acute myeloid leukemia cell proliferation via induction of mitochondrial-dependent apoptosis and CDK inhibitors. Eur. J. Pharmacol.789, 280–290. 10.1016/j.ejphar.2016.07.049 (2016). [DOI] [PubMed] [Google Scholar]
  • 33.Moh, A. et al. Role of STAT3 in liver regeneration: Survival, DNA synthesis, inflammatory reaction and liver mass recovery. Lab. Invest.87, 1018–1028. 10.1038/labinvest.3700630 (2007). [DOI] [PubMed] [Google Scholar]
  • 34.Terui, K. & Ozaki, M. The role of STAT3 in liver regeneration. Drugs Today (Barc). 41, 461–469. 10.1358/dot.2005.41.7.893622 (2005). [DOI] [PubMed] [Google Scholar]
  • 35.Okumura, H., Nakanishi, A., Hashita, T., Iwao, T. & Matsunaga, T. Effect of celecoxib on differentiation of human induced pluripotent stem cells into hepatocytes involves STAT5 activation. Drug Metab. Dispos.46, 1519–1527. 10.1124/dmd.118.082982 (2018). [DOI] [PubMed] [Google Scholar]
  • 36.Ishikawa, T., Banas, A., Hagiwara, K., Iwaguro, H. & Ochiya, T. Stem cells for hepatic regeneration: the role of adipose tissue derived mesenchymal stem cells. Curr. Stem Cell. Res. Ther.5, 182–189. 10.2174/157488810791268636 (2010). [DOI] [PubMed] [Google Scholar]
  • 37.Wu, X. B. & Tao, R. Hepatocyte differentiation of mesenchymal stem cells. Hepatobiliary Pancreat. Dis. Int.11, 360–371. 10.1016/s1499-3872(12)60193-3 (2012). [DOI] [PubMed] [Google Scholar]
  • 38.Volarevic, V. et al. Ethical and safety issues of stem Cell-Based therapy. Int. J. Med. Sci.15, 36–45. 10.7150/ijms.21666 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sensebe, L. & Bourin, P. Mesenchymal stem cells for therapeutic purposes. Transplantation87, 49–53. 10.1097/TP.0b013e3181a28635 (2009). [DOI] [PubMed] [Google Scholar]
  • 40.Wei, X. et al. Mesenchymal stem cells: a new trend for cell therapy. Acta Pharmacol. Sin. 34, 747–754. 10.1038/aps.2013.50 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Volarevic, V. et al. Stem cell-based therapy for spinal cord injury. Cell. Transpl.22, 1309–1323. 10.3727/096368912X657260 (2013). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES