Skip to main content
NCBI home page
Food Chemistry: Molecular Sciences logoLink to Food Chemistry: Molecular Sciences
. 2026 Jan 30;12:100367. doi: 10.1016/j.fochms.2026.100367

Real-time PCR to target Hoodia in herbal supplements: a tool for conservation and trade regulation

Marie-Alice Fraiture a, Andrea Gobbo a, Patrick Philipp b, Nina Papazova a, Céline Vanhee c,1, Nancy HC Roosens a,⁎,1
PMCID: PMC12892049  PMID: 41685176

Abstract

Plants belonging to the Hoodia genus are widely used as ingredients in herbal dietary supplements. Rising demand and overharvesting have led to supply shortages, adulteration, and CITES-regulated trade, threatening the authenticity and safety of Hoodia in commercial products. These factors highlight the need for a reliable genus-level detection method for Hoodia to support the control of illegal trade and the verification of marketed Hoodia-based products. To address this need, we developed a real-time PCR method specific to Hoodia genus targeting the ITS2 region, a molecular marker with high variability enabling detection and differentiation of plant species or genera. Due to the limited number of publicly available Hoodia ITS2 sequences, 13 additional sequences were generated in-house to support assay design. This real-time PCR method was validated in compliance with international standards, demonstrating high specificity, high sensitivity, and inter-laboratory transferability. Its applicability was verified by testing commercial herbal dietary supplements. This study provides enforcement laboratories with a validated molecular tool to support Hoodia monitoring and authentication in commercial products.

Keywords: Hoodia genus, DNA-based detection, Real-time PCR development and validation, Herbal dietary supplements, CITES, Authenticity

Highlights

  • •

    A real-time PCR method was developed and validated for Hoodia genus detection.

  • •

    13 new Hoodia ITS2 sequences were generated in-house to optimize assay design.

  • •

    The assay specifically detected Hoodia with no false positives or negatives.

  • •

    The highly sensitive assay detected fewer than 25 DNA copies.

  • •

    The assay enabled Hoodia monitoring in commercial herbal supplements.

1. Introduction

The Hoodia genus, part of the Apocynaceae family, consists of spiny, leafless succulent plants native to Southern Africa. It has drawn attention for its potential appetite suppressant properties, which are associated with the presence of the oxypregnane glycoside P57AS3 (Avula et al., 2006, Avula et al., 2008; MacLean & Luo, 2004; Ríos-Hoyo & Gutiérrez-Salmeán, 2016; Rumalla et al., 2008; Smith & Krygsman, 2014; Van Heerden, 2008; Vermaak et al., 2011; Wang, Xiao, et al., 2023; Zhao et al., 2011). Consequently, the demand for Hoodia species, such as H. gordonii, H. currorii, H. parviflora and H. ruschii, has significantly increased, particularly due to their commercial use in herbal dietary supplements (Avula et al., 2008, Avula et al., 2006; Bonetti et al., 2022; Gathier et al., 2013; Joshi et al., 2009; Ríos-Hoyo & Gutiérrez-Salmeán, 2016; Smith & Krygsman, 2014; Van Heerden, 2008; Vermaak et al., 2011; Zhao et al., 2011). This surge in demand has led to excessive harvesting of this slow-growing succulent plant genus, thereby raising biodiversity conservation concerns. Therefore, the Hoodia genus was listed under Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). This classification, which remains in force, mandates permits for the cultivation and export of both wild and artificially propagated materials (Avula et al., 2008; Bonetti et al., 2022; CITES, 2006; CITES, 2025; Joshi et al., 2009; Smith & Krygsman, 2014; Van Heerden, 2008; Vermaak et al., 2011; Zhao et al., 2011). Overexploitation of Hoodia has additionally led to supply shortages and widespread adulteration with other plant materials. For instance, H. gordonii has frequently been substituted with Opuntia ficus indica, and many marketed Hoodia-based supplements or raw materials have been found to contain only little or no Hoodia. Such practices raise potential concerns about the authenticity, quality, traceability and safety of the commercial Hoodia-based products (Avula et al., 2008; Joshi et al., 2009; Koncz et al., 2021; Smith & Krygsman, 2014; Van Heerden, 2008; Vermaak et al., 2011; Zhao et al., 2011). In addition, potential public health concerns have arisen because clinical studies failed to demonstrate significant Hoodia weight-loss effects, while adverse cardiovascular and neurological effects have been reported (Avula et al., 2006; Blom et al., 2011; Le Nevé et al., 2010; Madgula et al., 2010; Ríos-Hoyo & Gutiérrez-Salmeán, 2016; Smith & Krygsman, 2014; Van Heerden, 2008; Zhao et al., 2011). For these reasons, several countries have banned the use of Hoodia in food supplements. On the European market, Hoodia-containing supplements are classified as novel food and cannot legally be marketed without prior authorization. Nevertheless, non-compliant products are frequently seize by customs authorities (Koncz et al., 2021).

Collectively, these challenges have consequently highlighted the need for a reliable genus-level detection method for Hoodia to enforce regulatory compliance and to monitoring illegal trade and product authenticity, thereby contributing to consumer protection (Avula et al., 2006; Avula et al., 2017, Avula et al., 2008; CITES, 2006; Coutinho Moraes et al., 2015; Gathier et al., 2013; Janssen et al., 2008; Joshi et al., 2009; Rojas et al., 2011; Rumalla et al., 2008; Zhao et al., 2011). Although official methods and standardized protocols are currently lacking across enforcement laboratories, different approaches have been explored. These include macroscopy and microscopy, which are, however, limited however by the highly processed nature of herbal ingredients in commercial supplements and the specialized expertise required (Coutinho Moraes et al., 2015; Gathier et al., 2013; Joshi et al., 2009). Consequently, alternative approaches have been investigated, including predominantly chemical-based methods, as well as DNA-based methods (Avula et al., 2006; Avula et al., 2017, Avula et al., 2008; Gathier et al., 2013; Janssen et al., 2008; Joshi et al., 2009; Rumalla et al., 2008; Zhao et al., 2011). However, chemical profiling is influenced by plant tissue types, developmental stages and environmental conditions (Avula et al., 2006; Avula et al., 2017, Avula et al., 2008; Coutinho Moraes et al., 2015; Gathier et al., 2013; Janssen et al., 2008; Joshi et al., 2009; Rojas et al., 2011; Rumalla et al., 2008; Zhao et al., 2011). In contrast, DNA-based methods offer a reliable and powerful complementary alternative, as DNA is a stable biological molecule found in all tissues, regardless of developmental stage or environmental factor, and often persists in processed materials. Nevertheless, only a few studies have applied DNA-based methods to detect Hoodia, including conventional PCR followed by amplicon size discrimination via electrophoresis or conventional PCR followed by Sanger sequencing (Coutinho Moraes et al., 2015; Gathier et al., 2013; Joshi et al., 2009; Rojas et al., 2011). However, these DNA-based methods present notable limitations for enforcement laboratories. Electrophoresis-based approaches are often avoided due to limited precision, sensitivity, resolution, and dynamic range. Sequencing-based approaches are not commonly employed because they require access to sequencing infrastructure and advanced bioinformatics expertise. The presence of mixed plant species in the tested sample, as commonly found in herbal supplements, further complicate the analysis, making the process time-consuming and technically challenging (Gathier et al., 2013; Joshi et al., 2009; Prigigallo et al., 2016). In contrast to these DNA-based methods, real-time PCR is a powerful, user-friendly, time-efficient alternative widely regarded as the gold standard by enforcement laboratories. This technology enables real-time monitoring of DNA amplification, eliminating post-PCR processing and accelerating data acquisition. Importantly, it can reliably detect specific target sequences even within complex mixtures of multiple species, a common challenge in herbal weight-loss products. Moreover, its ability to amplify short DNA fragments is particularly valuable for analyzing degraded DNA typically found in highly processed materials, such as commercial Hoodia ingredients (Coutinho Moraes et al., 2015;Gathier et al., 2013; Joshi et al., 2009). The successful use of real-time PCR has been demonstrated in various fields. These include food safety, traceability, authenticity and fraud detection, but also illegal trade monitoring of endangered animal species in food products (Cardeñosa et al., 2018; Deliveyne et al., 2022; Fraiture et al., 2015, Fraiture, Gobbo, Guillitte, Barhdadi, et al., 2024; Henger et al., 2023; Kang, 2019; Rojas et al., 2011; Villanueva-Zayas et al., 2021). In herbal-based supplements, real-time PCR has also been used to detect and authenticate plant species of interest such as Ginkgo biloba, Centella asiatica, Panax notoginseng, and Carica papaya (Biltes et al., 2025; Grazina et al., 2020; Lou et al., 2022; Patel et al., 2023). Among the genomic regions widely used in real-time PCR strategies for plant authentication, the multi-copy internal transcribed spacer 2 (ITS2) region of the nuclear ribosomal DNA has emerged as a key molecular marker (Grazina et al., 2020; Lou et al., 2022; Patel et al., 2023; Tao et al., 2025). ITS2 is characterized by high interspecific sequence variability while remaining relatively conserved within species, providing strong discriminatory power for the reliable detection and discrimination of closely related plant species or genera (Banchi et al., 2020; Frigerio et al., 2021; Gu et al., 2013; Yao et al., 2010). Despite the many advantages of real-time PCR technology and the demonstrated suitability of the ITS2 marker for plant authentication, no real-time PCR assay, including those targeting ITS2, has to date been developed for Hoodia authentication, likely in part due to the limited DNA sequence data available for Hoodia and related species, which represents a critical constraint for assay design (Gathier et al., 2013; Joshi et al., 2009).

Therefore, to support enforcement laboratories in controlling marketed Hoodia-based products, a new real-time PCR method specific to the Hoodia genus was developed in this study by targeting the well-established ITS2 molecular marker. Because publicly available Hoodia ITS2 sequences were limited, 13 additional sequences were generated in-house to support real-time PCR assay design. The developed real-time PCR assay was validated in accordance with European standards, including the minimum performance requirements (MPR) for GMO analysis defined by the European Network of GMO Laboratories (ENGL), enabling a harmonized and reliable application across enforcement laboratories (Marchesi et al., 2015). First, specificity was assessed using DNA from several Hoodia species, closely-related species and plant species frequently encountered in commercial herbal weight-loss products. Genus-level detection was intentionally targeted because the entire Hoodia genus is listed under Appendix II of CITES, adulteration can affect all Hoodia-based products, and regulatory measures in many jurisdiction apply broadly to the genus (Avula et al., 2006; Avula et al., 2008; Bonetti et al., 2022; CITES, 2025; Joshi et al., 2009; Koncz et al., 2021; Smith & Krygsman, 2014; Van Heerden, 2008; Vermaak et al., 2011; Zhao et al., 2011). Second, sensitivity was evaluated by determining the limit of detection through serial dilutions of the targeted Hoodia sequence. Third, the transferability of the in-house validated Hoodia real-time PCR method to an external laboratory was evaluated. Finally, its applicability was tested using commercial herbal weight-loss products labelled or suspected to contain Hoodia ingredients.

2. Materials and methods

2.1. Biological materials

Plant materials were collected from various sources, including Amsbio (UK), American Herbal Pharmacopoeia (USA), ANSM (France), AOCS (USA), BOTANICERT© (France), Cambridge botanical garden (UK), CRA-W (Belgium), Fagron (Belgium), Giromagi (Italy), JRC (EU), Lyon botanical garden (France), Meise botanical garden (Belgium), Rarepalmseeds (Germany) and UGent botanical garden (Belgium) (Tables S1–2). First, a total of 13 different Hoodia materials, representing 7 different Hoodia species, were included. These plant materials comprised 2 specimens of H. currorrii, 4 specimens of H. gordonii, 3 specimens of H. parviflora and one specimen of H. juttae, H. pedicellate, H. pilifera and H. ruschii (Table S1). Second, 17 samples from plant species closely related to Hoodia were collected, including Caralluma europea, C. europaea var. Europea, C. joannis, C. hesperidum, Ceropegia woodii, Dischidia nummularia, D. ruscifolia, Dischidia sp., Hoya multiflora, Huernia keniensis, H. rubra, Orbea variegate, Rauvolfia vomitoria, Senna alexandrina, Stapelia flavirostris/grandiflora, S. tromotriche revoluta and Strophanthus amboensis/petersianus (Table S2). Among these, Caralluma is a noteworthy plant genus for being commonly used alongside Hoodia ingredients in herbal weight-loss food products (Cohen et al., 2023; Corley & Miller, 2002; de Freitas Junior & de Almeida, 2017; Dutt et al., 2012; Elvir-Lazo et al., 2024; Gamboa-Gómez et al., 2015; König, 2024; Pittler et al., 2005; Sirotkin, 2022; Sun et al., 2021). Third, 8 samples from plant species not closely related to Hoodia but well-known to be used with Hoodia ingredients in herbal weight-loss food products were collected. These included Citrus aurantium (bitter orange), Capsicum annuum (paprika), Camelia sinensis (tea plant), Foeniculum vulgare (fennel), Garcinia cambogia/gummi-gutta, Ilex paraguariensis (Yerba mate), O. ficus indica (Prickly pear cactus) and Paullinia cupana (Guanara) (Table S2) (Cohen et al., 2023; Corley & Miller, 2002; de Freitas Junior & de Almeida, 2017; Dutt et al., 2012; Elvir-Lazo et al., 2024; Gamboa-Gómez et al., 2015; König, 2024; Pittler et al., 2005; Sirotkin, 2022; Sun et al., 2021). Fourth, 2 samples belonging to plant species not closely related to Hoodia and frequently found in herbal weight-loss food products, but not specifically mixed with Hoodia ingredients, were included. These are Carica papaya (Papaya) and Cynara scolymus (Artichoke) (Table S2) (Cohen et al., 2023; Corley & Miller, 2002; de Freitas Junior & de Almeida, 2017; Dutt et al., 2012; Elvir-Lazo et al., 2024; Gamboa-Gómez et al., 2015; König, 2024; Pittler et al., 2005; Sirotkin, 2022; Sun et al., 2021). Finally, 10 samples belonging to plant species neither closely related to Hoodia nor commonly observed in herbal weight-loss food products were used, including Beta vulgaris, Brassica napus, Glycine max, Gossypium hirsutum, Oryza sativa, Triticum aestivum, Zea mays, Nicotiana tabacum, Solanum lycopersicum and S. tuberosum (Table S2).

2.2. DNA extraction

Fresh plant material was cut into small pieces using a surgical blade, and placed in an incubator at 65 °C until fully dried. This material was then ground into a fine powder using an analytical mill (IKA-Werke GmbH, Germany) and stored at −20 °C until further analysis.

DNA was extracted using NucleoSpin® Food Kit (MACHEREY-NAGEL, Dueren, Germany) according to manufacturer's instructions. DNA concentration was measured by fluorometry using Qubit 4.0 Fluorometer (Thermo Fisher Scientific, Waltham, USA) and DNA purity was evaluated based on the A260/A280 and A260/A230 ratios provided by spectrophotometry using Nanodrop® 2000 (Thermo Fisher Scientific, Waltham, USA). Extracted DNA was stored at −20 °C.

2.3. ITS2 barcoding

From each Hoodia DNA sample, a conventional PCR assay was applied using a standard 25 μl reaction volume containing 1× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland), 250 nM of each primer (Eurogentec, Liège, Belgium), and 25 ng of DNA. The primer pair (ITS2-F: ATGCGATACTTGGTGTGAAT; ITS2-R: GACGCTTCTCCAGACTACAAT) used in this study was previously designed (Gu et al., 2013). The PCR assays were performed on a T100™ Thermal Cycler (Bio-Rad, Hercules, USA). The PCR program consisted of a single cycle at 95 °C for 5 min (initial denaturation), 30 cycles at 95 °C for 30 s (denaturation), at 54 °C for 40 s (annealing), and at 72 °C for 60 s (extension), and a single cycle at 72 °C for 10 min (final extension). From each Hoodia material, the final PCR product was visualized by electrophoresis using TapeStation4200 with associated D1000 ScreenTapes and reagents (Agilent, Santa Clara, USA), under default parameters according to the manufacturer's instructions. The final PCR product was then purified using ExoSAP-IT PCR Product Cleanup (Affymetrix, Santa Clara, USA) and subsequently sequenced on a Genetic Sequencer 5000 (Thermo Fisher Scientific, Waltham, USA) using the Big Dye Terminator Kit v3.1 (Applied Biosystems, Waltham, USA).

2.4. In-silico real-time PCR design

2.4.1. In-silico inclusivity assessment

All publicly available sequences belonging to Hoodia and corresponding to the ITS2 region were collected from NCBI and vascular plant ITS2 databases (access on 28/05/2024) (National Center for Biotechnology Information (NCBI), 2024; Quaresma et al., 2024), in addition to the in-house ITS2 sequences generated from Hoodia materials. Following an alignment of these sequences using CLUSTAL OMEGA (V1.2.4) with default parameters, a conservative region for Hoodia was selected for primer and probe design (Tables S3A—B) (Sievers & Higgins, 2021). The resulting real-time PCR oligonucleotides, including a forward primer (Hoodia-F: GCGTCGCCTCCTGCATAA), a reverse primer (Hoodia-R: TGGCGAGCGAGCAATCTTTTA) and a probe (Hoodia-P: FAM-TG + C + C + TT + G + G + TGC-3IABkFQ), were manually designed, using IDT OligoAnalyzer™ Tool for checking parameters (https://eu.idtdna.com/calc/analyzer) (Tables S3A—B). Key design parameters were evaluated, like oligonucleotide length, GC content, melting temperature (Tm), and potential secondary structures or dimers. The probe design included a custom TaqMan probe incorporating Locked Nucleic Acid (LNA) bases, indicated by “+” at specific positions, to enhance specific hybridization efficiency. Using CLUSTAL OMEGA (V1.2.4) with default parameters, the expected PCR amplicon sequence generated by the Hoodia real-time PCR method was aligned to all available Hoodia ITS2 region sequences collected from NCBI and vascular plant ITS2 databases, as well as generated in-house from Hoodia materials (Table S3C) (Sievers & Higgins, 2021).

2.4.2. In-silico exclusivity assessment

A BLAST search, using default parameters, of the expected PCR amplicon generated by the designed Hoodia real-time PCR method, was performed against the NCBI nucleotide collection (nr/nt) (Table S4A) (National Center for Biotechnology Information (NCBI), 2024). All resulting hits were aligned using CLUSTAL OMEGA (V1.2.4) with default parameters (Table S4B) (Sievers & Higgins, 2021). All observed single-nucleotide variations at the Hoodia-P probe sequence level were highlighted (Tables S4B—C). Therefore, in order to increase the discrimination between the targeted Hoodia-P probe sequence and the closely related sequences, two additional non-Hoodia probes (non-Hoodia-Pa: HEX-CG + TG + C + TTT + G + A + TGCG-3IABkFQ; non-Hoodia-Pb: HEX-CGTG+C + C + TT + G + A + TGC-3IABkFQ) were manually designed, using IDT OligoAnalyzer™ Tool for checking parameters (https://eu.idtdna.com/calc/analyzer), and subsequently integrated into the final oligonucleotide set of the developed real-time PCR method. The probe design included custom TaqMan probes incorporating LNA bases, indicated by “+” at specific positions.

2.5. Experimental real-time PCR performance assessment

The performance of the developed Hoodia real-time PCR method was experimentally assessed according an international standard guidance document (Marchesi et al., 2015).

For each real-time PCR reaction, a 25 μl standard volume was prepared, including 1× SsoAdvanced universal probes supermix (Bio-Rad, Hercules, USA), 400 nM of Hoodia-F and Hoodia-R primers (Eurogentec, Liège, Belgium), 80 nM of Hoodia-P probe (IDT, Leuven, Belgium), 600 nM of non-hoodia-Pa and non-Hoodia-Pb probes (IDT, Leuven, Belgium) and 5 μl of DNA. Preliminary tests were conducted to optimize probe concentrations, showing that a higher concentration of the non-target probes in combination with a lower concentration of the target probe enhanced assay specificity, ultimately resulting in no false-positive signals (Table S5).

The real-time PCR program consisted of an initial cycle for DNA polymerase activation at 95 °C for 10 min, followed by 45 amplification cycles of a 15 s denaturation step at 95 °C and a 60 s annealing-extension step at 64 °C. All real-time PCR runs were conducted using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, USA) and included a No Template Control (NTC). A real-time PCR reaction was considered as negative if either no Cq value or a Cq value ≥38 was observed.

2.5.1. Specificity

The developed real-time PCR method was tested in duplicate on about 3000 estimated haploid genome copies from several target and non-target materials gathered from different collections (Tables S1–2) (Arumuganathan & Earle, 1991; Pellicer & Leitch, 2020). In addition to plant materials described in Section 2.1., a total of 4 non-plant DNA samples belonging to animal and microbial species were also tested, including Homo sapiens (G3041, Promega, USA), Bacillus licheniformis (LMG 7558, BCCM, Belgium), Aspergillus niger (IHEM 2312, BCCM, Belgium) and Pichia pastori (MUCL 27793, BCCM, Belgium).

To verify its sequence identity, the PCR amplicon generated from the developed real-time PCR method applied on the H. gordonii (1) material was purified using USB ExoSAP-IT PCR Product Cleanup (Affymetrix, Santa Clara, USA) and sequenced on a Genetic Sequencer 5000 (Thermo Fisher Scientific, Waltham, USA) using the Big Dye Terminator Kit v3.1 (Applied Biosystems, Waltham, USA). The generated sequence was aligned against the expected Hoodia PCR amplicon sequence using CLUSTAL OMEGA (V1.2.4) with default parameters (Table S6) (Sievers & Higgins, 2021).

2.5.2. Sensitivity

A gBlocks Gene Fragment (IDT, Leuven, Belgium), artificially synthesized to contain a single copy of the expected PCR amplicon sequence produced by the developed Hoodia real-time PCR method, was utilized (Table S3C). Following the manufacturer's instructions, this synthetic control material was employed to prepare serial dilutions ranging from 25 to 0.1 estimated target copies and tested in 12 replicates. The limit of detection LOD95% was calculated as previously described (Table S7) (Grohmann et al., 2016; Uhlig et al., 2015).

2.5.3. Transferability

The in-house sensitivity assessment described in Section 2.5.2 was performed by an external laboratory, being the Laboratoire SCL de Strasbourg (Strasbourg, France) (Table S7). The real-time PCR assay was carried out using oligonucleotides (Eurogentec, Liège, Belgium), 1× SsoAdvanced universal probes supermix (Bio-Rad, Hercules, USA) and CFX Duet Real-Time PCR System (Bio-Rad, Hercules, USA).

2.5.4. Applicability

The developed real-time PCR method was tested on several commercial herbal weight-loss supplement products (samples n°1–10). For each product, 25 ng of DNA, prepared as described in Section 2.2, was tested in duplicate. All samples, collected on the European market, were either labelled or suspected to contain Hoodia ingredient (Table S8). These samples were also previously analyzed for the presence or absence of Hoodia ingredient by chemical analysis by using liquid chromatography coupled to mass spectrometry (LC-MS), allowing to evaluate the consistency and robustness of the developed real-time PCR method across the diverse matrices tested (Table S8). Moreover, these samples were tested using a plant-specific real-time PCR method as previously described (Table S8).

3. Results and discussion

3.1. In-house ITS2 sequence generation and in-silico real-time PCR design

Given the limited publicly available sequence data for Hoodia species, the ITS2 region was selected to develop the taxon-specific real-time PCR method for detecting Hoodia DNA. The ITS2 region is a molecular marker characterized by high sequence variability, offering discriminatory power for differentiating plant species and genera. This approach has been successfully applied in previous studies to develop real-time PCR methods targeting other underrepresented or taxonomically complex plant groups, such as Ephedra and Panax (Lou et al., 2022; Zheng et al., 2021). A search of public sequences databases yielded only 16 ITS2 sequences belonging to the Hoodia genus and covering 5 different species including H. officinalis, H. mossamedensis, H. gordonii, H. juttae and H. alstonii (Fig. 1A; Table S3B). Therefore, to strengthen this dataset, additional ITS2 sequences were generated in-house from 13 different Hoodia plants collected from various sources. These included 2 specimens of H. currorrii, 4 specimens of H. gordonii, 3 specimens of H. parviflora and one specimen of H. juttae, H. pedicellate, H. pilifera and H. ruschii (Fig. 1A; Tables S1, S3A).

Fig. 1.

Fig. 1

Open in a new tab

Oligonucleotides design. (A) Sequence alignment of the 88 bp Hoodia PCR amplicon using all 29 available Hoodia ITS2 region sequences, including 8 from the vascular plant ITS2 database, 8 from the NCBI database and 13 generated in-house (Table S3). The positions of the designed oligonucleotide (Hoodia-F, Hoodia-R and Hoodia-P) are underlined. (B) Sequence alignment at the Hoodia-P probe binding site between the consensus Hoodia PCR amplicon sequence (derived from Fig. 1A) and all observed sequence variations from closely related species (Clusters 1–10) (Table S4). For each variation cluster, the number of associated hits from closely related species is indicated in parentheses (Table S4). All observed single-nucleotide variations (SNVs) are shown in red. SNVs indicated in grey were used to design the two non-Hoodia probes (Non-Hoodia-Pa and Non-Hoodia-Pb). The positions of all designed oligonucleotides are underlined.

The resulting ITS2 Hoodia dataset, comprising 29 sequences, was then used for in-silico real-time PCR assay design. A set of two primers (Hoodia-F; Hoodia-R) and one probe (Hoodia-P) was initially designed to specifically amplify a 88 bp fragment of the Hoodia ITS2 region (Fig. 1A; Tables S3, S9). The in-silico method's inclusivity was confirmed using all available Hoodia ITS2 sequences, obtained from both public databases and in-house sequencing efforts. For all these sequences, a match of 100% in terms of identity and coverage was observed with the expected PCR amplicon sequence from the developed Hoodia real-time PCR method (Fig. 1A; Table S3). In addition, the in-silico method's exclusivity was established by blasting the expected PCR amplicon sequence against the NCBI nucleotide collection (nr/nt). No sequence outside Hoodia showed a 100% match in identity and coverage (Table S4A).

Although the method specificity was successfully assessed in-silico, the high sequence similarity observed within the targeted ITS2 region between Hoodia and closely related species raised concerns about potential cross-hybridizations and false-positive amplifications (Fig. 1B; Table S4B). In particular, within the Hoodia-P probe sequence, 10 different clusters of sequence variations were identified among closely related species when compared to the consensus Hoodia PCR amplicon sequence. Each variation cluster differed from Hoodia by one or few single-nucleotide polymorphisms (SNPs). Consequently, for effectively discriminating target and non-target sequences, the initial set of two primers and one probe was supplemented by two additional probes (non-Hoodia-Pa; non-Hoodia-Pb) designed based on single-nucleotide variations identified within the Hoodia-P probe sequence, for increased probe hybridization competition (Fig. 1B; Table S4C). Furthermore, LNA bases were incorporated into all probes to enhance specific hybridization efficiency. The performance of the developed Hoodia real-time PCR method was then experimentally assessed according an international standard guidance document, being the MPR for GMO analysis of ENGL (Marchesi et al., 2015).

3.2. Experimental performance assessment of the developed real-time PCR method targeting Hoodia

3.2.1. Specificity

Following in-silico investigations, the specificity of the developed Hoodia real-time PCR method was then experimentally tested using DNA extracted from a range of several target and non-target materials (Table 1; Tables S1–2). This is crucial to ensure a harmonized and reliable control by all enforcement laboratories.

Table 1.

Experimental specificity assessment of the Hoodia real-time PCR method using different target and non-target DNA materials. If applicable, the common name for the species is provided while “n.a.” is indicated if not applicable. The presence and absence of amplification are respectively denoted by “+” and “-”. Each result was obtained from duplicate PCR reactions conducted on about 3000 estimated haploid genome copies. The means of the measured Cq values and associated standard deviations are provided in brackets. When multiple plant specimens belonging to the same species are tested, each is differentiated by a number within parentheses next to the plant's name. Plant species commonly found in herbal weight-loss dietary products are marked with an asterisk, and those reported to be combined with Hoodia ingredients in such products are marked with “Ψ” (Cohen et al., 2023; Corley & Miller, 2002; de Freitas Junior & de Almeida, 2017; Dutt et al., 2012; Elvir-Lazo et al., 2024; Gamboa-Gómez et al., 2015; König, 2024; Pittler et al., 2005; Sirotkin, 2022; Sun et al., 2021).

Kingdom Family Species Common name Hoodia real-time PCR assay
Animalia Hominidae Homo sapiens Human –
Bacteria Bacillaceae Bacillus licheniformis n.a. –
Fungi Trichocomaceae Aspergillus niger n.a. –
Pichiaceae Pichia pastori n.a. –
Plantae Amaranthaceae Beta vulgaris Sugar beet –
Apiaceae Foeniculum vulgare*Ψ Fennel –
Apocynaceae Caralluma europea *Ψ n.a. –
Caralluma europaea var. Europea*Ψ n.a. –
Caralluma joannis*Ψ n.a. –
Caralluma hesperidum*Ψ n.a. –
Ceropegia woodii String of hearts –
Dischidia nummularia Button orchid –
Dischidia ruscifolia Million hearts plant –
Dischidia sp. n.a. –
Hoodia currorrii* (specimen n°1) n.a. +
(Cq: 22.3 ± 0.1)
Hoodia currorrii* (specimen n°2) n.a. +
(Cq: 20.3 ± 0.0)
Hoodia gordonii* (specimen n°1) n.a. +
(Cq: 19.1 ± 0.0)
Hoodia gordonii* (specimen n°2) n.a. +
(Cq: 21.8 ± 0.0)
Hoodia gordonii* (specimen n°3) n.a. +
(Cq: 19.0 ± 0.0)
Hoodia gordonii* (specimen n°4) n.a. +
(Cq: 19.2 ± 0.1)
Hoodia juttae* n.a. +
(Cq: 16.6 ± 0.0)
Hoodia parviflora* (specimen n°1) n.a. +
(Cq: 19.3 ± 0.0)
Hoodia parviflora* (specimen n°2) n.a. +
(Cq: 21.3 ± 0.0)
Hoodia parviflora* (specimen n°3) n.a. +
(Cq: 25.9 ± 0.0)
Hoodia pedicellate* n.a. +
(Cq: 20.0 ± 0.1)
Hoodia pilifera* n.a. +
(Cq: 19.8 ± 0.1)
Hoodia ruschii* n.a. +
(Cq: 15.8 ± 0.1)
Hoya multiflora Shooting star hoya –
Huernia keniensis n.a. –
Huernia rubra n.a. –
Orbea variegate Starfish plant –
Rauvolfia vomitoria Poison devil's-pepper –
Senna alexandrina n.a. –
Stapelia flavirostris/grandiflora Carrion flower –
Stapelia tromotriche revoluta Carrion flower –
Strophanthus amboensis/petersianus n.a. –
Aquifoliaceae Ilex paraguariensis*Ψ Yerba mate –
Asteraceae Cynara scolymus* Artichoke –
Brassicaceae Brassica napus Rapeseed –
Cactaceae Opuntia ficus indica*Ψ Prickly pear cactus –
Caricaceae Carica papaya* Papaya –
Clusiaceae Garcinia cambogia/gummi-gutta*Ψ n.a. –
Fabaceae Glycine max Soybean –
Malvaceae Gossypium hirsutum Cotton –
Poaceae Oryza sativa Rice –
Triticum aestivum Wheat –
Zea mays Maize –
Rutaceae Citrus aurantium*Ψ Bitter orange –
Sapindaceae Paullinia cupana*Ψ Guarana –
Solanaceae Capsicum annuum*Ψ Paprika –
Nicotiana tabacum Tobacco –
Solanum lycopersicum Tomato –
Solanum tuberosum Potato –
Theaceae Camellia sinensis*Ψ Tea plant –
Open in a new tab

As target materials, a total of 13 Hoodia DNA samples, covering 7 different Hoodia species, were tested. For all these samples, as expected, a PCR amplification signal was detected with the Hoodia-P probe (Table 1; Tables S1–2, S10). Moreover, the PCR amplicon sequence generated experimentally using the developed Hoodia real-time PCR method matched the expected reference sequence (Table S6). Notably, variation in Cq values was observed among the Hoodia samples, despite testing each at comparable estimated haploid genome copy numbers (Table 1). This variability is likely attributable to the use of the ITS2 region as the assay target in the proposed taxon-specific real-time method. This multi-copy nuclear marker is known to exhibit both inter- and intra-specific variation, including sequence heterogeneity among rDNA repeats and differences in rDNA copy number (Gu et al., 2013; Liu et al., 2023; Saini et al., 2008; Song et al., 2012; Wang, Zhang, et al., 2023; Yao et al., 2010).

As non-target materials, a diverse set of DNA samples was tested in order to assess the real-time PCR method ability to discriminate Hoodia DNA from a wide range of non-targets, including species taxonomically related to Hoodia, as well as species commonly found in herbal weight-loss food products (Table 1; Tables S1–2). First, the panel comprised 17 DNA samples from plant species closely related to Hoodia, including Caralluma genus which is well-known for being used in herbal weight-loss food products. Second, 10 additional DNA samples from plant species not closely related to Hoodia but commonly used in herbal weight-loss food products were included, such as C. aurantium (bitter orange), C. annuum (paprika), C. papaya (papaya), C. scolymus (artichoke), C. sinensis (tea plant), F. vulgare (fennel), G. cambogia, I. paraguariensis (Yerba mate), O. ficus indica (Prickly pear cactus) and P. cupana (Guanara). Finally, this set also comprised 10 DNA samples from plant species neither closely related to Hoodia nor commonly observed in herbal weight-loss food products, as well as 4 non-plant DNA samples belonging to animal and microbial species. For all of these 41 negative materials, as expected, no PCR amplification signal was detected with the Hoodia-P probe (Table 1; Tables S1–2).

Based on all these results, the absence of false-positive and false-negative signals was demonstrated. No unexpected PCR amplification was observed, even with species closely related to Hoodia or commonly used in herbal weight-loss food products. Consequently, the developed Hoodia real-time PCR method was assessed as specific to target Hoodia DNA.

3.2.2. Sensitivity

The method's sensitivity was experimentally evaluated in accordance with international standard guidance documents (Grohmann et al., 2016; Marchesi et al., 2015; Uhlig et al., 2015). This assessment required determination of the limit of detection LOD95%, defined as the lowest number of target DNA sequence copies that can be detected with a 95% probability. To this end, a range of different estimated copy numbers (25, 20, 15, 10, 5, 1, 0.1 and 0) from an artificial control carrying a single copy of the 88 bp sequence fragment of the Hoodia ITS2 region targeted by the developed Hoodia real-time PCR method was used (Table 2; Tables S3B—C).

Table 2.

Experimental sensitivity assessment of the Hoodia real-time PCR method for the in house validation and transferability assays. The presence and absence of amplification are respectively denoted by “+” and “-”. Each result was obtained from 12 replicate PCR reactions. The number of positive replicate(s) out of the 12 replicates tested is indicated in brackets. The means of the measured Cq values and associated standard deviations are provided in brackets.

Estimated target copy number
25 20 15 10 5 1 0.1 0
In house real-time PCR validation assays + + + + + + − −
(12/12) (12/12) (12/12) (12/12) (9/12) (3/12) (0/12) (0/12)
(Cq: 34.2 ± 0.4) (Cq: 34.4 ± 0.2) (Cq: 35.0 ± 0.5) (Cq: 35.4 ± 0.5) (Cq: 36.4 ± 0.5) (Cq: 37.6 ± 0.1)
Transferability real-time PCR assays + + + + + + − −
(12/12) (12/12) (12/12) (12/12) (12/12) (4/12) (0/12) (0/12)
(Cq: 33.6 ± 0.3) (Cq: 34.0 ± 0.6) (Cq: 34.2 ± 0.4) (Cq: 35.2 ± 0.6) (Cq: 36.3 ± 0.8) (Cq: 37.7 ± 0.7)
Open in a new tab

A PCR amplification signal was observed at levels as low as 1 estimated target copy, and at 10 estimated target copies for all 12 replicates. According to POD (probability of detection) modelling, the limit of detection LOD95%, was determined at ∼10 estimated target copies (LOD95% = 9.166, with a 95% confidence interval of [5.908; 14.227]). Plausibility check revealed no irregularities (Table S7) (Grohmann et al., 2016; Uhlig et al., 2015). With an LOD95% below 25 estimated target copies, the developed Hoodia real-time PCR method was evaluated as sensitive and compliant with the MPR guidance document defined by ENGL (Marchesi et al., 2015). This is important because Hoodia DNA may be present in small amounts in the final commercial products, especially when mixed with other ingredients. Additionally, it is noteworthy that this sensitivity assessment was conducted using an artificial control carrying a single copy of the targeted Hoodia ITS2 region. This approach allows precise control of the number of target copies tested, regardless of the target copy number in the genome. In plant genomes, the ITS2 region typically occurs in multiple copies, which further increases the likelihood of successful real-time PCR detection (Yao et al., 2010).

3.2.3. Transferability

To evaluate the transferability of the in-house validated Hoodia real-time PCR method, the same experimental setup used for the in-house sensitivity testing was applied by an external laboratory. These results closely aligned with those from the in-house validation (Table 2; Table S7). Specifically, a PCR amplification signal was detected as low as 1 estimated target copies, and at 5 estimated target copies for all 12 replicates. Additionally, the plausibility check indicated no irregularities and the LOD95% was calculated at ∼6 estimated target copies (LOD95% = 5.222, with a 95% confidence interval of [3.044; 8.943]). The consistency between in-house and external laboratory results confirms the transferability of the Hoodia real-time PCR method.

3.2.4. Applicability

The method's applicability was experimentally evaluated to determine whether it can be reliably applied to commercial herbal dietary supplements, considering the complexity of food matrices and associated challenges (i.e., DNA degradation), which is crucial for enforcement purposes. The developed Hoodia real-time PCR method was applied to 10 different commercial herbal weight-loss food supplement products collected from the European market. These products were either purchased from e-commerce platforms and regular shops or sampled by competent authorities as part of their national control plans (Table 3; Table S8). All these samples were labelled as containing Hoodia ingredient, except for samples n°9–10. These two samples were suspected to contain Hoodia based on recent findings using multidimensional chromatographic fingerprinting combined with chemometrics (Ranjan et al., 2023). Furthermore, previous chemical-based analysis of all samples using LC-MS detected the presence of Hoodia ingredients in samples n°1–4, providing a reference for evaluating the consistency and robustness of the developed real-time PCR method across the diverse matrices tested (Table 3; Table S8).

Table 3.

Experimental applicability assessment of the Hoodia real-time PCR method using different commercial herbal weight-loss supplement products (samples n°1–10). Available labelling information is provided (Table S8). All samples, except n°9–10, listed Hoodia as an ingredient on the product label. For each sample, 25 ng of extracted DNA was tested in duplicate. Positive and negative PCR signals are respectively symbolized by “+” or “-”. The means of measured Cq values and associated standard deviations are indicated in brackets. The presence of previously detected plant DNA by real-time PCR in these samples is indicated by an asterisk. In addition, the presence of Hoodia ingredients previously detected in these samples by chemical-based analysis (LC-MS) is indicated by “Ψ” (Table S8).

N° Sample description Product formulation Hoodia real-time PCR assay
1*Ψ Hoodia nutritional supplement – Hoodia gordonii powder Solid - Capsule +
(Cq: 17.0 ± 0.1)
2*Ψ Hoodia dietary supplement – Hoodia gordonii powder Solid - Capsule +
(Cq: 25.8 ± 0.1)
3*Ψ Hoodia dietary supplement – Hoodia gordonii powder Solid - Capsule +
(Cq: 29.0 ± 0.0)
4*Ψ Metabolism support - Hoodia gordonii powder Solid - Capsule +
(Cq: 32.9 ± 0.0)
5* Hoodia dietary supplement – Hoodia gordonii powder Solid - Tablet +
(Cq: 33.1 ± 0.1)
6 Hunger control-herbal supplement – Hoodia root Solid - Capsule –
7 Metabolism booster-herbal supplement - Hoodia Solid - Capsule –
8* Weight loss supplement appetite suppressant - Hoodia Solid - Capsule –
9 Fat burning – controls appetite - promotes weight loss Solid - Capsule –
10 Weight loss formula Solid - Capsule –
Open in a new tab

First, using the developed real-time PCR method, the presence of Hoodia ingredients was detected in samples n°1–5, which is consistent with the labelling of these products (Table 3). These real-time PCR results were also largely in agreement with the LC-MS data, except for sample n°5 (Table 3; Table S8). This discrepancy observed for sample n°5 could however be explained by the low amount of Hoodia present, as suggested by the high Cq value obtained by real-time PCR, indicating levels probably near or below of the detection limit of the chemical-based method (Table 3; Table S7). This finding highlighted the added value of using the real-time PCR method for detecting trace amounts of Hoodia ingredients. Second, although the product labelling indicated the presence of Hoodia, neither the real-time PCR nor LC-MS methods detected any Hoodia ingredient in samples n°6–8. This suggests that the Hoodia ingredient is either present at trace level below the limit of detection of these methods or that mislabelling occurred (Table 3; Table S8). Finally, as expected, the presence of Hoodia was not observed by either the real-time PCR or LC-MS methods in sample n°9–10, which were not labelled as containing Hoodia (Table 3; Table S8). Taken together, these results demonstrate the applicability of the developed Hoodia real-time PCR method for reliable detection of Hoodia DNA across a range of commercial herbal weight-loss supplement products.

As a complementary investigation, all samples were also tested in parallel using a universal plant real-time PCR assay (Tables 3; S8). Amplifiable plant DNA was observed in all samples where Hoodia DNA was detected (n°1–5) as well as in sample n°8 where not Hoodia DNA was detected. No amplifiable plant DNA was detected in samples n°6–7 and 9–10 where consistently no Hoodia DNA was detected. These results transparently illustrate the variability encountered when monitoring processed herbal products and emphasize the importance of prior DNA quality assessment to ensure reliable data interpretation.

4. Conclusion

In this study, a Hoodia real-time PCR method was developed for the first time and validated according a widely recognized international standard for real-time PCR method performance (Marchesi et al., 2015). The assay targets ITS2, a well-established molecular marker for plant authentication (Banchi et al., 2020; Frigerio et al., 2021; Gu et al., 2013; Yao et al., 2010). This real-time PCR methods was specifically designed for genus-level detection of Hoodia, in line with CITES regulatory requirements and the practical needs of enforcement laboratories. The method's development was strongly supported by prior in-house sequencing efforts of the Hoodia ITS2 region, providing essential reference data for designing specific primers and probes capable of distinguishing the Hoodia genus from closely related taxa.

This novel real-time PCR method demonstrated high specificity for Hoodia DNA, with no PCR amplification signal observed for non-Hoodia species, including closely related ones and other species commonly found in commercial herbal weight loss products. This method also exhibited high sensitivity, with a limit of detection below 25 estimated target copies (LOD95% ∼ 10). Furthermore, the transferability of this in-house validated method to an external laboratory was confirmed, with consistent results between in-house and external assays. Finally, using 10 different commercial herbal weight-loss supplements, the applicability of this method was also successfully tested, where it reliably detected Hoodia DNA, even at trace levels. For enforcement laboratories, this real-time PCR method directly addresses the analytical challenges posed by marketed herbal weight-loss products, including complex processed mixtures of different plant species. Collectively, these results demonstrate the method's robustness and practical applicability, laying the groundwork for future efforts such as an international collaborative ring trial involving multiple enforcement laboratories to further strengthen confidence in method performance and promote harmonization of Hoodia testing across laboratories (Broeders et al., 2014; Marchesi et al., 2015).

This study offers enforcement laboratories a successfully validated real-time PCR method, which remains the gold standard for DNA-based taxon detection. This user-friendly key molecular tool is a valuable resource for official controls, helping to ensure sustainability, authenticity, traceability, quality and safety of commercial Hoodia-based products.

CRediT authorship contribution statement

Marie-Alice Fraiture: Writing – review & editing, Writing – original draft, Validation, Supervision, Methodology, Investigation, Formal analysis, Conceptualization. Andrea Gobbo: Writing – review & editing, Validation, Formal analysis. Patrick Philipp: Writing – review & editing, Formal analysis. Nina Papazova: Writing – review & editing, Validation, Formal analysis. Céline Vanhee: Writing – review & editing, Supervision, Funding acquisition, Formal analysis, Conceptualization. Nancy H.C. Roosens: Writing – review & editing, Supervision, Funding acquisition, Conceptualization.

Funding

The research that yielded these results was funded by Sciensano (Transversal activities in Applied Genomics Service).

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

The authors would like to thank Cambridge Botanical Garden (UK), Meise Botanical Garden (Belgium), Lyon Botanical Garden (France), and UGent Botanical Garden (Belgium) for providing plant materials. The authors also extend their gratitude to the technicians of the Transversal Activities in Applied Genomics (TAG) service at Sciensano (Brussels, Belgium) for their assistance with sequencing. The authors would also like to express their gratitude to Dr. Laura Van Poelvoorde (TAG, Sciensano) for her valuable advice on oligonucleotide design.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.fochms.2026.100367.

Contributor Information

Marie-Alice Fraiture, Email: Marie-Alice.Fraiture@sciensano.be.

Andrea Gobbo, Email: Andrea.Gobbo@sciensano.be.

Patrick Philipp, Email: patrick.philipp@scl.finances.gouv.fr.

Nina Papazova, Email: Nina.Papazova@sciensano.be.

Céline Vanhee, Email: Celine.Vanhee@sciensano.be.

Nancy H.C. Roosens, Email: Nancy.Roosens@sciensano.be.

Appendix A. Supplementary data

Supplementary material 1

mmc1.docx (329.9KB, docx)

Supplementary material 2

mmc2.pdf (1.3MB, pdf)

Data availability

Data will be made available on request.

References

  1. Arumuganathan K., Earle E.D. Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter. 1991;9:208–218. doi: 10.1007/BF02672069. [DOI] [Google Scholar]
  2. Avula B., Wang Y.-H., Isaac G., Yuk J., Wrona M., Yu K., Khan I. Metabolic profiling of Hoodia, chamomile, Terminalia species and evaluation of commercial preparations using ultrahigh-performance liquid chromatography quadrupole-time-of-flight mass spectrometry. Planta Medica. 2017;83:1297–1308. doi: 10.1055/s-0043-109239. [DOI] [PubMed] [Google Scholar]
  3. Avula B., Wang Y.-H., Pawar R.S., Shukla Y.J., Schaneberg B., Khan I.A. Determination of the appetite suppressant P57 in Hoodia gordonii plant extracts and dietary supplements by liquid chromatography/electrospray ionization mass spectrometry (LC-MSD-TOF) and LC-UV methods. Journal of AOAC International. 2006;89:606–611. doi: 10.1093/jaoac/89.3.606. [DOI] [PubMed] [Google Scholar]
  4. Avula B., Wang Y.-H., Pawar R.S., Shukla Y.J., Smillie T.J., Khan I.A. A rapid method for chemical fingerprint analysis of Hoodia species, related genera, and dietary supplements using UPLC–UV–MS. Journal of Pharmaceutical and Biomedical Analysis. 2008;48:722–731. doi: 10.1016/j.jpba.2008.07.005. [DOI] [PubMed] [Google Scholar]
  5. Banchi E., Ametrano C.G., Greco S., Stanković D., Muggia L., Pallavicini A. 2020. PLANiTS: A curated sequence reference dataset for plant ITS DNA metabarcoding. Database 2020, baz155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Biltes R., Villa C., Costa J., Mafra I. Molecular authentication of Centella asiatica products by a novel real-time PCR approach: Influence of plant matrix. Food Bioscience. 2025;68 doi: 10.1016/j.fbio.2025.106395. [DOI] [Google Scholar]
  7. Blom W.A., Abrahamse S.L., Bradford R., Duchateau G.S., Theis W., Orsi A.…Mela D.J. Effects of 15-d repeated consumption of Hoodia gordonii purified extract on safety, ad libitum energy intake, and body weight in healthy, overweight women: A randomized controlled trial. The American Journal of Clinical Nutrition. 2011;94:1171–1181. doi: 10.3945/ajcn.111.020321. [DOI] [PubMed] [Google Scholar]
  8. Bonetti G., Herbst K.L., Donato K., Dhuli K., Kiani A.K., Aquilanti B., Velluti V., Matera G., Iaconelli A., Bertelli M. Dietary supplements for obesity. Journal of Preventive Medicine and Hygiene. 2022;Vol. 63:E160. doi: 10.15167/2421-4248/JPMH2022.63.2S3.2757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Broeders S., Huber I., Grohmann L., Berben G., Taverniers I., Mazzara M., Roosens N.H., Morisset D. Guidelines for validation of qualitative real-time PCR methods. Trends in Food Science and Technology. 2014;37:115–126. doi: 10.1016/j.tifs.2014.03.008. [DOI] [Google Scholar]
  10. Cardeñosa D., Quinlan J., Shea K.H., Chapman D.D. Multiplex real-time PCR assay to detect illegal trade of CITES-listed shark species. Scientific Reports. 2018;8 doi: 10.1038/s41598-018-34663-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. CITES . 2006. Hoodia spp. [Google Scholar]
  12. CITES . 2025. Appendices I, II and III [WWW Document] URL https://cites.org/eng/app/appendices.php (accessed 1.5.26) [Google Scholar]
  13. Cohen P.A., Avula B., Katragunta K., Travis J.C., Khan I. Presence and quantity of botanical ingredients with purported performance-enhancing properties in sports supplements. JAMA Network Open. 2023;6 doi: 10.1001/jamanetworkopen.2023.23879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Corley D.G., Miller J. 2002. Plant derived or derivable material with appetite suppressing activity. US7008648B2. [Google Scholar]
  15. Coutinho Moraes D., Still D., Lum M., Hirsch A. DNA-based authentication of botanicals and plant-derived dietary supplements: Where have we been and where are we going? Planta Medica. 2015;81:687–695. doi: 10.1055/s-0035-1545843. [DOI] [PubMed] [Google Scholar]
  16. Deliveyne N., Cassey P., Linacre A., Delean S., Austin J.J., Young J.M. Recovering trace reptile DNA from the illegal wildlife trade. Forensic Science International: Animals and Environments. 2022;2 doi: 10.1016/j.fsiae.2021.100040. [DOI] [Google Scholar]
  17. Dutt H.C., Singh S., Avula B., Khan I.A., Bedi Y.S. Pharmacological review of Caralluma r.Br. With special reference to appetite suppression and anti-obesity. Journal of Medicinal Food. 2012;15:108–119. doi: 10.1089/jmf.2010.1555. [DOI] [PubMed] [Google Scholar]
  18. Elvir-Lazo O.L., Romero-Navarro A.L., White P.F. Update on the potential adverse effects of preoperative herbal medication use during the perioperative period. Journal of Clinical Anesthesia. 2024;97 doi: 10.1016/j.jclinane.2024.111553. [DOI] [PubMed] [Google Scholar]
  19. Fraiture M.-A., Gobbo A., Guillitte C., Barhdadi S., Gau C., Philipp P., Marmin L., Marchesi U., Verginelli D., Papazova N., Vanhee C., Roosens N.H.C. Development and validation of a ddPCR assay to detect and quantify tobacco DNA in smoke and smokeless tobacco and tobacco-free products. Heliyon. 2024;10 doi: 10.1016/j.heliyon.2024.e32964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fraiture M.-A., Herman P., Taverniers I., De Loose M., Deforce D., Roosens N.H. Current and new approaches in GMO detection: Challenges and solutions. BioMed Research International. 2015;2015 doi: 10.1155/2015/392872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. de Freitas Junior L.M., de Almeida E.B. Medicinal plants for the treatment of obesity: Ethnopharmacological approach and chemical and biological studies. American Journal of Translational Research. 2017;9:2050–2064. [PMC free article] [PubMed] [Google Scholar]
  22. Frigerio J., Agostinetto G., Mezzasalma V., De Mattia F., Labra M., Bruno A. DNA-based herbal teas’ authentication: An ITS2 and psbA-trnH multi-marker DNA Metabarcoding approach. Plants. 2021;10:2120. doi: 10.3390/plants10102120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gamboa-Gómez C.I., Rocha-Guzmán N.E., Gallegos-Infante J.A., Moreno-Jiménez M.R., Vázquez-Cabral B.D., González-Laredo R.F. Plants with potential use on obesity and its complications. EXCLI Journal. 2015;14 doi: 10.17179/EXCLI2015-186. Doc809; ISSN 1611-2156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gathier G., Van Der Niet T., Peelen T., Van Vugt R.R., Eurlings M.C.M., Gravendeel B. Forensic identification of CITES protected slimming Cactus Hoodia using DNA barcoding. Journal of Forensic Sciences. 2013;58:1467–1471. doi: 10.1111/1556-4029.12184. [DOI] [PubMed] [Google Scholar]
  25. Grazina L., Amaral J.S., Costa J., Mafra I. Authentication of Ginkgo biloba herbal products by a novel quantitative real-time PCR approach. Foods. 2020;9:1233. doi: 10.3390/foods9091233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Grohmann L., Broll H., Dagand E., Hildebrandt S., Hübert P., Kiesecker H.…Zur K. Guidelines for the validation of qualitative real-time PCR methods by means of a collaborative study. Technical Report, BVL. 2016;1:1–17. [Google Scholar]
  27. Gu W., Song J., Cao Y., Sun Q., Yao H., Wu Q.…Duan J. Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PLoS One. 2013;8 doi: 10.1371/journal.pone.0067818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Henger C.S., Straughan D.J., Xu C.C.Y., Nightingale B.R., Kretser H.E., Burnham-Curtis M.K.…Seimon T.A. A new multiplex qPCR assay to detect and differentiate big cat species in the illegal wildlife trade. Scientific Reports. 2023;13 doi: 10.1038/s41598-023-36776-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Janssen H.-G., Swindells C., Gunning P., Wang W., Grün C., Mahabir K., Maharaj V.J., Apps P.J. Quantification of appetite suppressing steroid glycosides from Hoodia gordonii in dried plant material, purified extracts and food products using HPLC-UV and HPLC–MS methods. Analytica Chimica Acta. 2008;617:200–207. doi: 10.1016/j.aca.2008.01.022. [DOI] [PubMed] [Google Scholar]
  30. Joshi V., Techen N., Scheffler B.E., Khan I.A. Identification and differentiation between Hoodia gordonii (Masson) sweet ex Decne., Opuntia ficus indica (L.) P. Miller, and related Hoodia species using microscopy and PCR. Journal of Herbs, Spices & Medicinal Plants. 2009;15:253–264. doi: 10.1080/10496470903378953. [DOI] [Google Scholar]
  31. Kang T.S. Basic principles for developing real-time PCR methods used in food analysis: A review. Trends in Food Science & Technology. 2019;91:574–585. doi: 10.1016/j.tifs.2019.07.037. [DOI] [Google Scholar]
  32. Koncz D., Tóth B., Roza O., Csupor D. A systematic review of the European rapid alert system for food and feed: Tendencies in illegal food supplements for weight loss. Frontiers in Pharmacology. 2021;11 doi: 10.3389/fphar.2020.611361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. König S. The composition and biochemical properties of Strophantus (Apocynaceae), with a focus on S. Sarmentosus. Molecules. 2024;29:2847. doi: 10.3390/molecules29122847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Le Nevé B., Foltz M., Daniel H., Gouka R. The steroid glycoside H.G.-12 from Hoodia gordonii activates the human bitter receptor TAS2R14 and induces CCK release from HuTu-80 cells. American journal of physiology-gastrointestinal and liver. Physiology. 2010;299:G1368–G1375. doi: 10.1152/ajpgi.00135.2010. [DOI] [PubMed] [Google Scholar]
  35. Liu Y., Liang N., Xian Q., Zhang W. GC heterogeneity reveals sequence-structures evolution of angiosperm ITS2. BMC Plant Biology. 2023;23:608. doi: 10.1186/s12870-023-04634-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lou Q., Xin T., Xu W., Li R., Song J. TaqMan probe-based quantitative real-time PCR to detect Panax notoginseng in traditional Chinese patent medicines. Frontiers in Pharmacology. 2022;13 doi: 10.3389/fphar.2022.828948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. MacLean D.B., Luo L.-G. Increased ATP content/production in the hypothalamus may be a signal for energy-sensing of satiety: Studies of the anorectic mechanism of a plant steroidal glycoside. Brain Research. 2004;1020:1–11. doi: 10.1016/j.brainres.2004.04.041. [DOI] [PubMed] [Google Scholar]
  38. Madgula V., Ashfaq M., Wang Y.-H., Avula B., Khan I., Walker L., Khan S. Bioavailability, pharmacokinetics, and tissue distribution of the Oxypregnane steroidal glycoside P57AS3 (P57) from Hoodia gordonii in mouse model. Planta Medica. 2010;76:1582–1586. doi: 10.1055/s-0030-1249818. [DOI] [PubMed] [Google Scholar]
  39. Marchesi U., Mazzara M., Broll H., Giacomo M.D., Grohmann L., Herau V.…Woll K. 2015. European network of GMO laboratories (ENGL) - definition of minimum performance requirements for analytical methods of GMO testing. JRC report JRC95544. [DOI] [Google Scholar]
  40. National Center . National Center for Biotechnology Information [Internet]; 2024. For biotechnology information (NCBI) [Google Scholar]
  41. Patel R., Faller A.C., Nguyen T., Quan Z., Eminger C., Kaul S.…Lu Z. Validation of a real-time PCR assay for identification of fresh and processed Carica papaya botanical material: Using synthetic DNA to supplement specificity evaluation. Foods. 2023;12:530. doi: 10.3390/foods12030530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pellicer J., Leitch I.J. The plant DNA C-values database (release 7.1): An updated online repository of plant genome size data for comparative studies. The New Phytologist. 2020;226:301–305. doi: 10.1111/nph.16261. [DOI] [PubMed] [Google Scholar]
  43. Pittler M.H., Schmidt K., Ernst E. Adverse events of herbal food supplements for body weight reduction: Systematic review*. Obesity Reviews. 2005;6:93–111. doi: 10.1111/j.1467-789X.2005.00169.x. [DOI] [PubMed] [Google Scholar]
  44. Prigigallo M.I., Abdelfattah A., Cacciola S.O., Faedda R., Sanzani S.M., Cooke D.E.L., Schena L. Metabarcoding analysis of Phytophthora diversity using genus-specific primers and 454 pyrosequencing. Phytopathology®. 2016;106:305–313. doi: 10.1094/PHYTO-07-15-0167-R. [DOI] [PubMed] [Google Scholar]
  45. Quaresma A., Ankenbrand M.J., Garcia C.A.Y., Rufino J., Honrado M., Amaral J., Brodschneider R., Brusbardis V., Gratzer K., Hatjina F., Kilpinen O., Pietropaoli M., Roessink I., Van Der Steen J., Vejsnæs F., Pinto M.A., Keller A. Semi-automated sequence curation for reliable reference datasets in ITS2 vascular plant DNA (meta-)barcoding. Sci Data. 2024;11:129. doi: 10.1038/s41597-024-02962-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ranjan S., Adams E., Deconinck E. Multidimensional chromatographic fingerprinting combined with Chemometrics for the identification of regulated plants in suspicious plant food supplements. Molecules. 2023;28:3632. doi: 10.3390/molecules28083632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ríos-Hoyo A., Gutiérrez-Salmeán G. New dietary supplements for obesity: What we currently know. Current Obesity Reports. 2016;5:262–270. doi: 10.1007/s13679-016-0214-y. [DOI] [PubMed] [Google Scholar]
  48. Rojas M., González I., Pavón M.Á., Pegels N., Hernández P.E., García T., Martín R. Development of a real-time PCR assay to control the illegal trade of meat from protected capercaillie species (Tetrao urogallus) Forensic Science International. 2011;210:133–138. doi: 10.1016/j.forsciint.2011.02.021. [DOI] [PubMed] [Google Scholar]
  49. Rumalla C.S., Avula B., Shukla Y.J., Wang Y., Pawar R.S., Smillie T.J., Khan I.A. Chemical fingerprint of Hoodia species, dietary supplements, and related genera by using HPTLC. Journal of Separation Science. 2008;31:3959–3964. doi: 10.1002/jssc.200800441. [DOI] [PubMed] [Google Scholar]
  50. Saini A., Reddy S.K., Jawali N. Intra-individual and intra-species heterogeneity in nuclear rDNA ITS region of Vigna species from subgenus Ceratotropis. Genetical Research. 2008;90:299–316. doi: 10.1017/S001667230800983X. [DOI] [PubMed] [Google Scholar]
  51. Sievers F., Higgins D.G. In: Multiple sequence alignment, methods in molecular biology. Katoh K., editor. Springer; US, New York, NY: 2021. The Clustal Omega multiple alignment package; pp. 3–16. [DOI] [PubMed] [Google Scholar]
  52. Sirotkin A.V. Can nopal cactus (Opuntia ficus-indica L. Miller) treat obesity? Obesity Medicine. 2022;30 doi: 10.1016/j.obmed.2022.100390. [DOI] [Google Scholar]
  53. Smith C., Krygsman A. Hoodia gordonii: To eat, or not to eat. Journal of Ethnopharmacology. 2014;155:987–991. doi: 10.1016/j.jep.2014.06.033. [DOI] [PubMed] [Google Scholar]
  54. Song J., Shi L., Li D., Sun Y., Niu Y., Chen Z.…Chen S. Extensive pyrosequencing reveals frequent intra-genomic variations of internal transcribed spacer regions of nuclear ribosomal DNA. PLoS One. 2012;7 doi: 10.1371/journal.pone.0043971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sun W., Shahrajabian M.H., Cheng Q. Natural dietary and medicinal plants with anti-obesity therapeutics activities for treatment and prevention of obesity during lock down and in post-COVID-19 era. Applied Sciences. 2021;11:7889. doi: 10.3390/app11177889. [DOI] [Google Scholar]
  56. Tao Y., Duan S., Yu K., Cheng X., Li X., Zhang W.…Wei F. Development of TaqMan real-time fluorescent quantitative PCR method for identification and quantification of Sinomenium acutum-originated herbal drugs. Molecules. 2025;30:3763. doi: 10.3390/molecules30183763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Uhlig S., Frost K., Colson B., Simon K., Mäde D., Reiting R.…Grohmann L. Validation of qualitative PCR methods on the basis of mathematical–statistical modelling of the probability of detection. Accreditation and Quality Assurance. 2015;20:75–83. doi: 10.1007/s00769-015-1112-9. [DOI] [Google Scholar]
  58. Van Heerden F.R. Hoodia gordonii: A natural appetite suppressant. Journal of Ethnopharmacology. 2008;119:434–437. doi: 10.1016/j.jep.2008.08.023. [DOI] [PubMed] [Google Scholar]
  59. Vermaak I., Hamman J., Viljoen A. Hoodia gordonii: An up-to-date review of a commercially important anti-obesity plant. Planta Medica. 2011;77:1149–1160. doi: 10.1055/s-0030-1250643. [DOI] [PubMed] [Google Scholar]
  60. Villanueva-Zayas J.D., Rodríguez-Ramírez R., Ávila-Villa L.A., González-Córdova A.F., Reyes-López M.Á., Hernández-Sierra D., Los Santos-Villalobos S. Using a COI mini-barcode and real-time PCR (qPCR) for sea turtle identification in processed food. Journal of Food Processing & Preservation. 2021;45 doi: 10.1111/jfpp.15808. [DOI] [Google Scholar]
  61. Wang R., Xiao L., Pan J., Bao G., Zhu Y., Zhu D.…Dang Y. Natural product P57 induces hypothermia through targeting pyridoxal kinase. Nature Communications. 2023;14:5984. doi: 10.1038/s41467-023-41435-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wang W., Zhang X., Garcia S., Leitch A.R., Kovařík A. Intragenomic rDNA variation - the product of concerted evolution, mutation, or something in between? Heredity. 2023;131:179–188. doi: 10.1038/s41437-023-00634-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Yao H., Song J., Liu C., Luo K., Han J., Li Y.…Chen S. Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS One. 2010;5 doi: 10.1371/journal.pone.0013102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhao J., Avula B., Joshi V., Techen N., Wang Y.-H., Smillie T., Khan I. NMR fingerprinting for analysis of Hoodia species and Hoodia dietary products. Planta Medica. 2011;77:851–857. doi: 10.1055/s-0030-1250583. [DOI] [PubMed] [Google Scholar]
  65. Zheng Y., Gao H., Song M., Lin Y., Fan J., Zhang Y., Liu X. Identification of plant materials containing ephedrine alkaloids based on DNA barcoding and TaqMan real-time PCR assay. Acta Physiologiae Plantarum. 2021;43:143. doi: 10.1007/s11738-021-03304-3. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1

mmc1.docx (329.9KB, docx)

Supplementary material 2

mmc2.pdf (1.3MB, pdf)

Data Availability Statement

Data will be made available on request.

Articles from Food Chemistry: Molecular Sciences are provided here courtesy of Elsevier

RESOURCES