Abstract
Background
Ovarian cancer (OC) is one of the most lethal gynecological malignant tumors globally.
Objectives
The objective of this research was to investigate the clinical significance and biological roles of the microRNA (miR)-758-5p/MMP-2 axis in OC.
Materials and methods
This study recruited 150 epithelial ovarian cancer (EOC) patients. The Kaplan-Meier survival analysis examined the association between miR-758-5p levels and patient survival outcomes. Cox regression analysis identified critical factors influencing patient mortality risk. RT-qPCR quantified the expression of miR-758-5p and matrix metalloproteinase-2 (MMP-2). Cell proliferation was assessed by the CCK-8 assay, while cell migration and invasion were evaluated by the Transwell assay. Flow cytometry was utilized to measure the cell’s apoptosis rate. The dual-luciferase reporter assay confirmed the targeted regulatory relationship.
Results
MiR-758-5p was reduced in EOC patients (P < 0.0001). The expression of miR-758-5p (HR = 0.272, 95%CI = 0.131–0.561, P < 0.001), lymph node metastasis (HR = 1.951, 95%CI = 1.085–3.506, P = 0.026), and tumor stage (HR = 2.125, 95%CI = 1.108–4.078, P = 0.023) were critical factors influencing patient mortality risk. Specifically, high expression of miR-758-5p was significantly correlated with improved patient survival outcomes. Moreover, elevated levels of miR-758-5p effectively suppress the proliferation, migration, and invasion of OC cells while promoting apoptosis (P < 0.0001). The study further revealed that miR-758-5p directly negatively regulated MMP-2 expression. Overexpression of MMP-2 partially counteracted the effects of the miR-758-5p mimic on cell behavior (P < 0.0001).
Conclusion
The miR-758-5p/MMP-2 axis may play a critical role in the OC progression.
Keywords: MiR-758-5p, Ovarian cancer, MMP-2, Prognosis
Introduction
Ovarian cancer (OC) ranks as one of the most prevalent malignant tumors in females [1]. Owing to the absence of specific clinical symptoms in the early stages, approximately 70% of patients are diagnosed at an advanced stage, making it challenging to treat effectively and achieve a complete cure [2]. Epithelial ovarian cancer (EOC), which constitutes over 90% of all OC, is the predominant pathological subtype [3]. Currently, the treatment for OC involves surgical resection combined with adjuvant therapies such as radiotherapy, chemotherapy (including paclitaxel and platinum-based regimens), maintenance therapy, and targeted immunotherapy [4]. Despite these treatments leading to disease remission in the majority of patients, a significant proportion of EOC cases experience recurrence post-treatment [5]. Consequently, achieving early diagnosis of EOC and monitoring recurrence after surgery or chemotherapy is critically important [6]. The exploration of novel biomarkers may offer new avenues for precise diagnosis and personalized therapeutic strategies in OC.
MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules with a length of approximately 18–25 nucleotides [7]. They bind to the 3’ untranslated region (3’UTR) of target messenger RNA (mRNA) through complementary pairing at the post-transcriptional level, regulating gene expression and mainly exerting inhibitory effects on translation or promoting mRNA degradation [8, 9]. miRNAs have extensive and crucial functions in the body, participating in various physiological processes such as cell proliferation, differentiation, apoptosis, and metabolism, and also playing important roles in pathological processes such as tumors, cardiovascular diseases, and neurological disorders [10, 11]. miRNAs are involved in the regulation of various tumors [12]. Research has demonstrated that miR-758-5p plays a pivotal role in the progression of various diseases. MiR-758-5p is aberrantly expressed in adenomas [13], where it regulates cholesterol uptake by reducing lipid accumulation in foam cells [14]. Additionally, its overexpression effectively suppresses migration in glioblastoma [15]. In noise-exposed rats, miR-758-5p in the cochlear nucleus (CN) is significantly decreased [16]. Meanwhile, miR-758-5p plays a crucial role in the synthesis and secretion of androgens within presinusoidal follicles in mice [17]. However, the role of miR-758-5p in ovarian cancer remains unknown. Notably, matrix metalloproteinase-2 (MMP-2) not only promotes tumor invasion and metastasis but also plays a significant role in regulating cell proliferation and apoptosis [18]. Existing evidence confirms that MMP-2 expression in OC tissues is markedly higher than in benign or normal ovarian tissues, correlating closely with the malignancy and lymph node metastasis of OC [19]. Through bioinformatics analysis, we identified MMP-2 as a potential downstream target gene of miR-758-5p. Based on these findings, we hypothesized that miR-758-5p may contribute to OC progression by targeting MMP-2.
This study primarily investigated the differential expression of miR-758-5p between OC cells and normal cells and evaluated its impact on cell behaviors. Additionally, the related downstream genes were identified, and the interaction mechanisms were verified.
Materials and methods
Study population
This study had been approved by the Ethics Committee of Xiang Yang No.1 People’s Hospital, Hubei University of Medicine. All participants provided voluntary informed consent by signing the consent form, and all procedures were conducted in strict adherence to the principles of the Declaration of Helsinki.
A total of 150 patients with EOC were recruited from Xiang Yang No.1 People’s Hospital, Hubei University of Medicine, between January 2018 and January 2025. Tissue specimens, including EOC tissues and adjacent normal tissues located at least 3 centimeters away from the tumor margin, were collected immediately after surgery and stored in liquid nitrogen. Inclusion criteria: patients diagnosed with EOC based on pathological and imaging evidence, fulfilling the diagnostic criteria for EOC [20]; no prior radiotherapy or chemotherapy before surgery; no targeted drug treatment history; complete medical records and willingness to cooperate. The exclusion criteria included: the presence of severe diseases affecting major organs; a history of malignant tumors; and women who were pregnant or breastfeeding.
For patients with EOC, follow-up examinations were scheduled every three months, and the total follow-up duration was 60 months.
Cell culture and transfection
The human OC cell lines SKOV3, A2780, OVCAR3, COV644, and the normal ovarian epithelial cell line (IOSE cells) were obtained from American Type Culture Collection (ATCC). The cells were cultured in DMEM-F12 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Thermo Fisher Scientific). Once the cells reached approximately 80% confluency, they were gently detached using 0.25% trypsin (Thermo Fisher) and passaged for further expansion. For subsequent experiments, only cells in the logarithmic growth phase were selected to ensure consistent and healthy cell performance. The expression of miR-758-5p was downregulated in ovarian cancer cells. Among the cell lines screened, SKOV3 and OVCAR3 exhibited the lowest levels of miR-758-5p expression, making them ideal candidates for investigating the functional effects of miRNA overexpression. Therefore, these two cell lines were selected for subsequent transfection and functional validation experiments.
The miR mimics, miR-inhibitor, and their respective negative controls, as well as the pCDNA3.1 plasmid carrying the MMP-2 sequence (p-MMP-2) and control (p-NC), were purchased from Shanghai GenePharma (China). The transfection of SKOV3 and OVCAR3 cells was performed using Lipofectamine®3000 (Invitrogen). The concentration of miR-758-5p mimic was 50 nm. The transfection efficiency was determined by RT-qPCR.
RT- qPCR
RNA was extracted using the TRIzol reagent (Yeasan). RNA was reverse-transcribed into cDNA using the miScript II RT Kit (QIAGEN, Germany), and the expression of miR-758-5p and MMP-2 was quantified by RT-qPCR (miScript SYBR Green PCR Kit, Qiagen) using an ABI VIIA 7 device (Applied Biosystems). U6 and GAPDH were employed as internal reference genes for normalization. All primers were synthesized by Shanghai GenePharma Co., Ltd. The primer sequences were as follows:
miR-758-5p forward: GATGGTTGACCAGAGAGCACAC,
reverse: ATCCAGTGCAGGGTCCGAGG;
MMP-2 forward: 5'-TTTCCATTCCGCTTCCAGGGCACAT-3',
reverse: 5'-TCGCACACCACATCTTTCCGTCACT-3';
U6 forward: 5'-CTTCGGCAGCACATATACT-3',
reverse: 5'-AAAATATGGAACGCTTCACG-3';
GADPH forward: 5'-GAGAGACCCTCACTGCTG-3',
reverse: 5’-GASTGGTAGATGACAAGGTGC-3’. The relative expression levels were determined using the 2−ΔΔCt method.
Determination of cell viability
A single-cell suspension was prepared, and approximately 2 × 10³ cells per well were seeded into a 96-well plate. At different time points, the CCK-8 reagent was added for incubation. Subsequently, the absorbance was measured at 450 nm.
Transwell assay
The Transwell assay was employed to evaluate cell migration and invasion. 2 × 10⁵ cells per well were seeded into the upper chamber of the Transwell insert. Simultaneously, 600 µL of culture medium was added to the lower chamber. Following incubation, the cells that had migrated or invaded through the membrane were fixed with 4% paraformaldehyde and subsequently stained with a 0.1% crystal violet solution.
Apoptosis test
After the cells were cultured to an appropriate density, they were harvested, washed two to three times, and prepared as a cell suspension. Subsequently, Annexin V-FITC and PI staining solutions were added. The mixture was incubated in the dark for 15–20 min. Following staining, PBS was added to the sample, the cells were gently resuspended, and the sample was analyzed using a FACSCalibur flow cytometer (Becton Dickinson) and analyzed with CellQuest Software (Becton Dickinson). Annexin V could specifically label early apoptotic cells, while PI could penetrate damaged cell membranes of necrotic cells and late apoptotic cells and mark them. The formula for calculating the apoptosis rate was (number of early apoptotic cells + number of late apoptotic cells) / total cell number × 100%.
Bioinformatics analysis and dual-luciferase assay
To identify potential downstream target genes of miR-758-5p, we integrated bioinformatic predictions from TargetScan and miRDB databases and applied an intersection analysis to narrow down the candidate gene list, thereby enhancing the reliability of our selection. MMP-2 was located in this intersection. Given that MMP-2 has been consistently reported to be significantly upregulated in OC and was implicated in key tumorigenic processes [19], it was prioritized as a biologically relevant target for further experimental validation in the context of miR-758-5p regulation. The wild-type (WT) and mutant (MUT) MMP-2 fragments were cloned into pmirGLO (Promega). Subsequently, the luciferase plasmid was co-transfected with miR-mimics or miR-NC using Lipofectamine®3000 (Invitrogen). The luciferase activity was quantified 48 h post-transfection.
Statistical analysis
For continuous variables that did not follow a normal distribution, the non-parametric test was employed to evaluate differences between the two groups. For normally distributed data, an independent samples t-test was conducted for comparisons between two groups, while categorical data were analyzed using chi-square tests. Multiple groups were compared by one-way ANOVA. Kaplan-Meier survival curves assessed the prognosis of patients with EOC, and Cox regression identified prognostic factors for EOC patients. Each cell experiment was repeated three times. All data were analyzed using SPSS 21.0 and GraphPad Prism 9.0. A P < 0.05 was considered statistically significant.
Results
General clinical characteristics of EOC
MiR-758-5p was statistically decreased in EOC patients (Fig. 1A), and the patients were categorized into a high-expression group (levels above the mean) and a low-expression group (levels below the mean). The results indicated that there were 72 cases in the high-expression group and 78 cases in the low-expression group. The expression of miR-758-5p was significantly associated with lymph node metastasis and tumor stage in EOC patients (P < 0.05). Patients exhibiting low levels of miR-758-5p were more frequently classified as having tumor stage III and were at a higher risk for developing lymph node metastasis (Table 1).
Fig. 1.
The relationship between miR-758-5p and ovarian cancer. A Relative expression of miR-758-5p in EOC patients. B Relationship between different expressions of miR-758-5p and survival probability. *** means P < 0.001. An independent sample t-test and a Kaplan-Meier survival curve were the statistical methods employed
Table 1.
The correlations between miR-758-5p expression levels and clinicopathological characteristics in EOC
| Characteristics | Total (n = 150) | Lower expression (n = 78) | Higher expression (n = 72) | P-value |
|---|---|---|---|---|
| Age (years) | 0.223 | |||
| ≤ 50 | 41 | 18 | 23 | |
| > 50 | 109 | 60 | 49 | |
| Tumor size (cm) | 0.132 | |||
| ≤ 3 | 75 | 37 | 43 | |
| > 3 | 75 | 41 | 29 | |
| Tumor Organizational Type | 0.230 | |||
| Serous | 46 | 21 | 25 | |
| Mucinous | 43 | 27 | 16 | |
| Endometroid | 61 | 30 | 31 | |
| Lymph node metastasis | 0.032* | |||
| No | 93 | 42 | 51 | |
| Yes | 57 | 36 | 21 | |
| Tumor stage | 0.025* | |||
| I–II | 67 | 28 | 39 | |
| III | 83 | 50 | 33 |
Data are expressed as n
EOC Epithelial ovarian cancer
*means P < 0.05, Chi-square analysis was used as the statistical method
MiR-758-5p was associated with the EOC prognosis
The Kaplan-Meier survival curve analysis revealed that elevated miR-758-5p expression may positively influence patient survival (Fig. 1B).
Cox regression analysis results indicated that age, tumor size, and tumor organization were not statistically significantly associated with changes in patient mortality risk (P > 0.05). Patients with lymph node metastasis exhibited a 1.919-fold increased risk of death compared to those without lymph node metastasis (HR = 1.951, 95% CI = 1.805–3.506). Tumor stage was significantly correlated with patient prognosis (HR = 2.125, 95% CI = 1.108–4.078). Additionally, miR-758-5p expression level was strongly associated with patient prognosis (HR = 0.272, 95% CI = 0.131–0.561), with higher expression corresponding to reduced mortality risk (Table 2).
Table 2.
Cox regression analysis of the prognosis of OC patients
| Items | P-value | HR | 95% CI |
|---|---|---|---|
| Age | 0.110 | 1.024 | 0.995–1.055 |
| Tumor size (cm) | 0.189 | 1.461 | 0.829–2.572 |
| Tumor Organizational | 0.116 | 1.646 | 0.884–3.065 |
| Lymph node metastasis | 0.026* | 1.951 | 1.085–3.506 |
| Tumor stage | 0.023* | 2.125 | 1.108–4.078 |
| MiR-758-5p | < 0.001*** | 0.272 | 0.131–0.561 |
Cox regression analysis was employed as the statistical method
OC Ovarian cancer, HR Hazard ratio, CI Confidence interval
*means P < 0.05, *** means P < 0.001
Study on the functions of miR-758-5p in OC
MiR-758-5p was markedly reduced in all OC cell lines. Among the tested OC cell lines, miR-758-5p expression was lowest in SKOV3 cells and OVCAR3. Consequently, these two cell lines were selected for further investigation in subsequent experiments (Fig. 2A).The findings revealed that transfection with miR-758-5p mimics markedly increased miR-758-5p expression in both SKOV3 and OVCAR3 cells (Figs. 2B and C). Cell proliferation results indicated that in both cell lines, the miR-758-5p mimics treatment group was significantly lower (Figs. 2D and E). Additionally, the miR-758-5p mimics treatment group exhibited significantly reduced migration and invasion capabilities (P < 0.001) (Figs. 2F and G). The apoptosis rate in the miR-758-5p mimics treatment group was significantly higher (Fig. 2H).
Fig. 2.
Overexpression of miR-758-5p inhibits the proliferation, migration, and invasion of ovarian cancer cells and promotes apoptosis. A Relative expression of miR-758-5p in different cell lines (IOSE, SKOV3, A2780, OVCAR3, COV644). B-C Transfection with miR-758-5p mimics could effectively increase the expression of miR-758-5p in SKOV3 and OVCAR3 cells. D-E Results of cell proliferation experiments in SKOV3 and OVCAR3 cell lines. F-G Results of cell migration and invasion experiments in SKOV3 and OVCAR3 cell lines. H Results of cell apoptosis experiments in SKOV3 and OVCAR3 cell lines. *** means P < 0.001. Non-parametric tests were the statistical methods employed
MiR-758-5p targeted MMP-2
The target genes of miR-758-5p were predicted using the miRDB and TargetScan. It was identified that MMP-2 was the common target gene shared by both databases and was associated with OC. The dual-luciferase reporter assay further confirmed that in the WT-MMP-2 group, the luciferase activity in the miR-mimic group was significantly lower in SKOV3 and OVCAR3 cells. However, in the MUT-MMP-2 group, no significant difference in luciferase activity was observed among the three groups, suggesting that the binding of miR-758-5p to MMP-2 was specific (Figs. 3A-C). MMP-2 expression was significantly higher in EOC tissues (Fig. 3D). Furthermore, the expression of miR-758-5p and MMP-2 was negatively correlated (r = -0.6650, P < 0.0001) (Fig. 3E). For the SKOV3 and OVCAR3 cell lines, MMP-2 expression was significantly reduced in the miR-758-5p mimics treatment group. When miR-758-5p mimics were co-transfected with the plasmid overexpressing MMP-2 (p-MMP-2), MMP-2 expression increased, indicating that miR-758-5p negatively regulated MMP-2 expression (Figs. 3F and G).
Fig. 3.
MiR-758-5p targeted and inhibited MMP-2. A-C The targeting relationship between miR-758-5p and MMP-2 was verified by the dual-luciferase assay. D Relative expression of MMP-2 in the control group and the OC group. E Relationship between the expression of miR-758-5p and MMP-2. F-G Relative expression of MMP-2 in different treatment groups in SKOV3 and OVCAR3 cell lines. *** means P < 0.001. Independent sample t-test, non-parametric test, and Pearson correlation coefficient analysis were the statistical methods employed
The impact of miR-758-5p and MMP-2 on OC biological behaviors
When miR-758-5p was upregulated, the cell proliferation rate was significantly reduced. Following the introduction of the p-MMP-2 plasmid, the cell proliferation rate increased to a certain extent (Figs. 4A and B). Cell migration and invasion capabilities of the miR-mimic treatment were significantly lower. After the addition of p-MMP-2 plasmid, these capabilities were enhanced (Figs. 4C and D). In addition, transfection with miR-mimic was found to increase the rate of apoptosis. However, upon overexpression of MMP-2, the apoptosis rate was observed to decrease (Fig. 4E).
Fig. 4.
Overexpression of MMP-2 could partially reverse the effect of miR-758-5p overexpression on cell functionality. A-B Results of cell proliferation experiments in OC cell lines under different treatments. C-D Results of cell migration and invasion experiments in OC cell lines under different treatments. E Results of cell apoptosis experiments in OC cell lines under different treatments. *** means P < 0.001. Non-parametric tests were the statistical methods employed
Discussion
OC is one of the most lethal gynecological malignant tumors globally. It exhibits high heterogeneity and invasiveness, posing a significant threat to the lives and health of patients [21]. In recent years, microRNAs have played a crucial role in OC initiation and progression [22]. Prior studies have revealed that miR-758-5p is closely associated with glioblastoma development [15]. After analyzing clinical data from 150 patients with EOC, this study identified that high miR-758-5p expression was significantly correlated with reduced lymph node metastasis and earlier tumor stages. Moreover, miR-758-5p may modulate the OC behaviors by regulating MMP-2, thereby influencing the progression of OC.
A study has demonstrated that low expression of miR-758-5p correlates with poor prognosis in glioblastoma multiforme (GBM) patients [15]. Our study identified that high expression of miR-758-5p was significantly associated with improved survival rates. Moreover, patients with lymph node metastasis or advanced tumor stages exhibited higher mortality risks and poorer prognoses. Additionally, research findings confirmed that miR-758-5p expression levels were significantly linked to the prognosis of patients with EOC, where its high expression correlates with reduced mortality risk. This underscored the potential value of miR-758-5p in prognostic evaluation for EOC patients. In the future, integrating miR-758-5p expression levels with clinical indicators such as lymph node metastasis and tumor stage may enable more precise prognostic stratification. For patients with low miR-758-5p expression, accompanied by lymph node metastasis or advanced tumor stages, a more intensive follow-up strategy and enhanced treatment regimen were recommended.
MiR-758-5p suppresses the proliferation, migration, and invasion of glioblastoma [15]. Our experimental results showed that high expression of miR-758-5p significantly inhibited the proliferation, migration, and invasion of OC cells while promoting apoptosis. These findings suggested that miR-758-5p may serve as a key regulatory factor in OC progression, and its reduced or absent expression could represent a potential molecular event in ovarian carcinogenesis. In the future, targeting and modulating the expression level of miR-758-5p might pave the way for novel therapeutic strategies against OC. For instance, gene therapy approaches could be employed to enhance miR-758-5p expression in OC, effectively suppressing tumor growth and metastasis.
MMP-2 is dysregulated in OC [23, 24]. We identified MMP-2 as a target gene of miR-758-5p. Subsequently, our study confirmed the direct targeting and regulatory effect of miR-758-5p on MMP-2. Additionally, our study revealed that MMP-2 was significantly upregulated in OC tissues. Other studies have also indicated that MMP-2 is overexpressed in epithelial cancers [25] and OC [26], contributing to the pathogenesis of OC. The upregulation of MMP-2 enhances the invasive capacity of OC cells [27]. Through cellular experiments, we verified that miR-758-5p significantly influenced the proliferation, migration, invasion, and apoptosis of OC cells by targeting and regulating MMP-2 expression. Specifically, miR-758-5p mimics markedly suppressed the proliferation, migration, and invasion of SKOV3 and OVCAR3 while promoting cell apoptosis. However, when MMP-2 was overexpressed, it partially counteracted the effects of miR-758-5p mimics on these cellular behaviors. These findings suggested that miR-758-5p may function as a tumor suppressor in OC by negatively regulating MMP-2 expression. In the future, modulating the expression of miR-758-5p and MMP-2 might offer novel therapeutic strategies for OC treatment.
This study has discovered the tumor-suppressing mechanism of the miR-758-5p/MMP-2 axis in ovarian cancer. Clinically, in the future, it may be possible to detect the level of miR-758-5p in tissue or peripheral blood, which could potentially become a novel, non-invasive diagnostic and prognostic biomarker for ovarian cancer, used for early screening, efficacy assessment, and recurrence warning. Additionally, our functional experiments have shown that restoring the expression of miR-758-5p can effectively inhibit the malignant behavior of tumors. Incorporating miR-758-5p expression into the existing clinical pathological staging system may help achieve more precise patient risk stratification. Of course, the clinical application prospects of these still need to be verified through larger-scale prospective clinical trials and in-depth pharmacological research.
This study has several limitations. First, as a single-center investigation with a relatively limited sample source, it may be subject to selection bias and restrict the generalizability of the findings to broader and more diverse populations. Second, the cohort exhibits high racial homogeneity, necessitating validation of our results in multi-ethnic and larger-scale cohorts to enhance external validity. Furthermore, although this study confirms that MMP-2 is a direct and critical functional target of miR-758-5p, we did not systematically investigate other potential downstream targets of miR-758-5p. Given that microRNAs typically exert their effects through complex regulatory networks by modulating multiple genes [28–30], bioinformatics analyses suggest that miR-758-5p may also regulate additional genes involved in other cancer-related pathways. Thus, the “miR-758-5p/MMP-2” axis identified here may represent only a central node within a broader tumor-suppressive network. Future studies should include multi-center, prospective designs with more diverse racial and ethnic representation, and further validate the functional role of the miR-758-5p/MMP-2 axis in animal in vivo models through rescue experiments. Additionally, systematic screening of other miR-758-5p targets is warranted to fully elucidate its tumor-suppressive mechanisms in OC.
In conclusion, the miR-758-5p/MMP-2 axis played a critical role in the OC progression. The low expression of miR-758-5p was closely associated with poor prognosis in OC patients. Furthermore, miR-758-5p directly targeted and negatively regulated MMP-2 expression to affect the cell biological behavior of OC. These findings may provide potential molecular targets and a theoretical foundation for the development of novel therapeutic strategies for OC.
Acknowledgements
Not applicable.
Clinical trial number
Not applicable.
Authors’ contributions
Conceptualization, Q.G., Y.L.; Data curation, Q.G., Y.L.; Formal analysis, Q.G., Y.L.; Funding acquisition, Y.L.; Investigation, Q.G., Y.L.; Methodology, Q.G., Y.L.; Project administration, Y.L.; Resources, Q.G.; Software, Q.G.; Supervision, Y.L.; Validation, Q.G., Y.L.; Visualization, Q.G.; Roles/Writing - original draft, Q.G.; Writing - review & editing, Y.L.
Funding
No funding was received to assist with the preparation of this work.
Data availability
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Xiang Yang No.1 People’s Hospital, Hubei University of Medicine before the study began. The written informed consent has been obtained from the participants involved.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Oliveira L, Horvat N, Andrieu PIC, Panizza PSB, Cerri GG, Viana PCC. Ovarian cancer staging: what the surgeon needs to know. Br J Radiol. 2021;94(1125):20210091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Budiana ING, Angelina M, Pemayun TGA. Ovarian cancer: pathogenesis and current recommendations for prophylactic surgery. J Turk Ger Gynecol Assoc. 2019;20(1):47–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Alyahri N, Abdi S, Khan W, Elrobh M, Addar MH, Babay ZA, et al. Novel associations between BRCA1 variants C.181 T > G (Rs28897672) and ovarian crisk in Saudi females. J Med Biochem. 2019;38(1):13–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Richardson DL, Eskander RN, O’Malley DM. Advances in ovarian cancer care and unmet treatment needs for patients with platinum resistance: A narrative review. JAMA Oncol. 2023;9(6):851–9. [DOI] [PubMed] [Google Scholar]
- 5.Si W, Kang S, Sun H, Chen J, Cao S, Li Y. Genetic polymorphisms in hMSH2 and hMLH1 genes are associated with prognosis in epithelial ovarian cancer patients. Int J Gynecol Cancer. 2019;29(7):1148–55. [DOI] [PubMed] [Google Scholar]
- 6.Deng Y, Liu L, Feng W, Lin Z, Ning Y, Luo X. High expression of MYL9 indicates poor clinical prognosis of epithelial ovarian cancer. Recent Pat Anticancer Drug Discov. 2021;16(4):533–9. [DOI] [PubMed] [Google Scholar]
- 7.Zhao R, Liu J, Li Z, Zhang W, Wang F, Zhang B. Recent advances in CXCL12/CXCR4 antagonists and Nano-Based drug delivery systems for cancer therapy. Pharmaceutics. 2022;14(8):1–20. [DOI] [PMC free article] [PubMed]
- 8.Peng B, Li C, He L, Tian M, Li X. miR-660-5p promotes breast cancer progression through down-regulating TET2 and activating PI3K/AKT/mTOR signaling. Braz J Med Biol Res. 2020;53(12):e9740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wang J, Shi J, Xiang Y, Wang ZW, Qi FF, Li ZY, et al. LINC00525 enhances ZNF460-regulated CD24 expression through the sponge miR-125a-5p to promote malignant progression of breast cancer. J Cancer Res Clin Oncol. 2024;150(6):317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Costa C, Teodoro M, Rugolo CA, Alibrando C, Giambò F, Briguglio G et al. MicroRNAs alteration as early biomarkers for cancer and neurodegenerative diseases: new challenges in pesticides exposure. Toxicol Rep. 2020;7:759–67. [DOI] [PMC free article] [PubMed]
- 11.Meinag FE, Fatahi M, Vahedian V, Maroufi NF, Mosayyebi B, Ahmadi E, et al. Modulatory effects of MiRNAs in doxorubicin resistance: A mechanistic view. Funct Integr Genomics. 2024;24(5):150. [DOI] [PubMed] [Google Scholar]
- 12.Drusco A, Croce, CMJAicr. MicroRNAs and cancer: a long story for short RNAs. 2017;135:1–24. [DOI] [PubMed]
- 13.Zhang Y, Li M, Ding Y, Fan Z, Zhang J, Zhang H, et al. Serum MicroRNA profile in patients with colon adenomas or cancer. BMC Med Genomics. 2017;10(1):23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Li BR, Xia LQ, Liu J, Liao LL, Zhang Y, Deng M, et al. miR-758-5p regulates cholesterol uptake via targeting the CD36 3’UTR. Biochem Biophys Res Commun. 2017;494(1–2):384–9. [DOI] [PubMed] [Google Scholar]
- 15.Liu J, Jiang J, Hui X, Wang W, Fang D, Ding L. Mir-758-5p suppresses glioblastoma Proliferation, migration and invasion by targeting ZBTB20. Cell Physiol Biochem. 2018;48(5):2074–83. [DOI] [PubMed] [Google Scholar]
- 16.Lee CH, Jeon J, Lee SM, Kim SY. Differential Expression of miRNAs and Their Predicted Target Pathways in Cochlear Nucleus Following Chronic Noise Exposure in Rats. Cells. 2022;11(15):1–13. [DOI] [PMC free article] [PubMed]
- 17.Zhang X, Liu J, Wu H, Chen Y, Zhang X, Xu B. CircEpha5 regulates the synthesis and secretion of androgen in mouse preantral follicles by targeting miR-758-5p. J Obstet Gynaecol. 2023;43(2):2237574. [DOI] [PubMed] [Google Scholar]
- 18.Lv Y, Zhao X, Zhu L, Li S, Xiao Q, He W, et al. Targeting intracellular MMPs efficiently inhibits tumor metastasis and angiogenesis. Theranostics. 2018;8(10):2830–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Liu C. Pathological and prognostic significance of matrix metalloproteinase-2 expression in ovarian cancer: a meta-analysis. Clin Exp Med. 2016;16(3):375–82. [DOI] [PubMed] [Google Scholar]
- 20.Armstrong DK, Alvarez RD, Backes FJ, Bakkum-Gamez JN, Barroilhet L, Behbakht K, et al. NCCN Guidelines® insights: ovarian Cancer, version 3.2022. J Natl Compr Canc Netw. 2022;20(9):972–80. [DOI] [PubMed] [Google Scholar]
- 21.Konstantinopoulos PA, Matulonis UA. Clinical and translational advances in ovarian cancer therapy. Nat Cancer. 2023;4(9):1239–57. [DOI] [PubMed] [Google Scholar]
- 22.Ismail A, Abulsoud AI, Fathi D, Elshafei A, El-Mahdy HA, Elsakka EGE et al. The role of MiRNAs in ovarian cancer pathogenesis and therapeutic resistance - A focus on signaling pathways interplay. Pathol Res Pract. 2022;240:154222. [DOI] [PubMed]
- 23.Afzal S, Lalani EN, Poulsom R, Stubbs A, Rowlinson G, Sato H, et al. MT1-MMP and MMP-2 mRNA expression in human ovarian tumors: possible implications for the role of desmoplastic fibroblasts. Hum Pathol. 1998;29(2):155–65. [DOI] [PubMed] [Google Scholar]
- 24.Hu XX, Li L, Li DR, Zhang W, Cheng XQ, Zhang JQ, et al. [Expression of matrix metalloproteinases-9,2,7,and tissue inhibitor of metalloproteinases-1,2,3 mRNA in ovarian tumors and their clinical significance]. Ai Zheng. 2004;23(10):1194–8. [PubMed] [Google Scholar]
- 25.Boyd RS, Balkwill FR. MMP-2 release and activation in ovarian carcinoma: the role of fibroblasts. Br J Cancer. 1999;80(3–4):315–21. [DOI] [PMC free article] [PubMed]
- 26.Jeleniewicz W, Cybulski M, Nowakowski A, Stenzel-Bembenek A, Guz M, Marzec-Kotarska B, et al. MMP-2 mRNA expression in ovarian cancer tissues predicts patients’ response to Platinum-Taxane chemotherapy. Anticancer Res. 2019;39(4):1821–7. [DOI] [PubMed] [Google Scholar]
- 27.Ke X, Zhang S, Wu M, Lou J, Zhang J, Xu T, et al. Tumor-associated macrophages promote invasion via Toll-like receptors signaling in patients with ovarian cancer. Int Immunopharmacol. 2016;40:184–95. [DOI] [PubMed]
- 28.Zhang T, Li D, Wang Y, Zhang C, Yang W, Gao G. Delivering umbilical cord mesenchymal stem cell exosomes through hydrogel ameliorates vaginal atrophy in ovariectomized rats. Aging. 2023;15(23):14292–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sufianov A, Bessonova M, Begliarzade S, Kudriashov V, Danilov A, Ilyasova T, et al. Studies on the role of non-coding RNAs in controlling the activity of T cells in asthma. Noncoding RNA Res. 2023;8(2):211–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zhou W, Xi D, Shi Y, Wang L, Zhong H, Huang Z, et al. MicroRNA–1929–3p participates in murine cytomegalovirus–induced hypertensive vascular remodeling through Ednra/NLRP3 inflammasome activation. Int J Mol Med. 2021;47(2):719–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.




