Effect of moderate-intensity treadmill exercise on bone quality in adult rats and the underlying mechanisms

Abstract

Background

While exercise is widely recognized to enhance bone mass, the underlying molecular and cellular mechanisms remain incompletely elucidated. The present study was designed to investigate the effect of moderate-intensity exercise on skeletal quality, morphological characteristics, and metabolic homeostasis in adult Sprague-Dawley (SD) rats.

Methods

An animal treadmill exercise model was established using 16-week-old male specific pathogen-free SD rats. Following the 6-week moderate-intensity exercise, bilateral tibiae were harvested for analysis. Body indices of obesity and glucose metabolism were evaluated after the training period. Micro-computed tomography scanning was used to assess three-dimensional bone microarchitecture, while hematoxylin and eosin staining was employed to characterize bone morphological features. RNA sequence and reverse transcription-quantitative PCR identified and validated differentially expressed mRNAs in bone, with bioinformatics analyses predicting their target signaling pathways. Additionally, immunohistochemical staining quantified protein expression of osteogenic, osteoclastic, key pathway and mechanosensitive markers. The apoptosis rate was determined by TdT-mediated dUTP nick end labeling staining. Serum bone turnover markers and inflammatory cytokines were measured after exercise intervention via ELISA kits.

Results

Compared with the Control group, exercised rats showed decreasing trends in body weight, Lee’s index, and BMI, with a tendency toward increased tibial length. No significant difference was observed in fasting blood glucose between two groups. Micro-CT analysis revealed that exercise significantly increased trabecular bone volume fraction (BV/TV) and trabecular number (Tb.N). At the molecular level, exercise upregulated osteogenic proteins (COL1, OCN) and serum P1NP, while downregulating bone resorption markers (Sclerostin, RANKL, TRAP) and serum CTX. Further, differentially expressed genes were detected, and functional enrichment analyses revealed that the p53/Caspase-3 pathway and inflammatory factors were significantly down-regulated in the Exercise group. Apoptosis rate was significantly decreased after exercise in bone tissue. Treadmill training also resulted in increased protein expression of Piezo1.

Conclusions

Moderate-intensity treadmill exercise enhanced tibial cancellous bone microstructure and bone quality in adult SD rats by improving the balance of bone remodeling via p53/Caspase-3 signaling pathway. Furthermore, the alteration of p53 signaling pathway may be driven by the activation of mechanosensitive markers. These findings provide mechanistic insights into exercise-induced improvement of bone quality.

Clinical trial number

Not applicable.

Introduction

The skeletal system serves as a crucial structural support system for the body, not only providing protection for internal organs and maintaining motor function, but also participating in mineral metabolism and hematopoietic regulation [1]. Additionally, bone is a classic mechanosensitive tissue that can continuously optimize its morphological and mechanical properties through bone remodeling to adapt to external mechanical loads [2]. Consequently, the lack of mechanical stimulation is recognized as a primary cause of reduced bone mass and osteoporosis [3, 4].

Exercise, as a well-recognized non-pharmacological intervention, is widely endorsed as a preventive strategy for mitigating risk of osteoporosis [5]. Numerous studies have demonstrated that moderate exercise confers beneficial effects on bone tissue amid a wide spectrum of disease states, with such favorable impacts extending across the full lifespan, from childhood through old age [6–8]. Accumulating evidence has demonstrated that sustained, regular exercise could increase bone mass by 2%-3%, with exercise-induced mechanical stimulation maintaining a positive equilibrium in bone metabolism [9]. Clinical studies have confirmed that exercise alleviated menopause-associated bone loss in postmenopausal women through improvements in bone mineral density (BMD) and preserving the volume of cortical and trabecular bone [10, 11]. Moreover, moderate-intensity physical activity performed 3–4 times weekly significantly reduced fracture risk in both male and female volunteers [12]. Preclinical evidence from animal models further corroborated the skeletal benefits of exercise. Exercise training has been shown to increase BMD in rats and ameliorate bone loss while improving bone microstructure in mice [13, 14]. Treadmill exercise downregulated the expression of pro-inflammatory mediators including NLRP3, Caspase-1, IL-1β, and GSDMD-N, indicating that exercise may mitigate age-related bone loss in rats via modulation of the inflammatory microenvironment [15]. Additionally, exercise-regulated miRNA expression has been reported to influence bone formation and bone metabolic parameters, ultimately impacting osteoblast differentiation [16]. Despite the long-standing focus on exercise-induced skeletal effects in medical and sports science research, the underlying molecular and biological mechanisms by which exercise modulates bone tissue remain incompletely elucidated.

p53, a master transcription factor, orchestrates the activation of multiple target genes and plays an indispensable role in regulating the cell cycle, apoptosis, and genomic stability—earning it the well-recognized title of “guardian of the genome.” Mounting evidence has demonstrated that p53 further modulated diverse biological processes, including cellular metabolism, ferroptosis, tumor microenvironment remodeling, and autophagy, exerting profound regulatory impacts across these pathways [17]. Genetic investigations have firmly established that p53 signaling axis is pivotal to bone remodeling: p53 deficiency enhanced the proliferation and differentiation of bone marrow mesenchymal stem cells and osteoprogenitor cells, thereby driving bone formation and increasing bone mass and BMD [18]. Moreover, p53 has been shown to govern the proliferation and differentiation of osteoblasts and mesenchymal stem cells via the key transcription factors RUNX2/Osterix, thereby accelerating the repair of bone defect [19, 20]. Furthermore, targeting p53/miR17 axis has emerged as a promising therapeutic strategy for inflammation-associated osteoporosis [21]. However, the precise molecular mechanisms governing p53-mediated regulation of bone remodeling and metabolism, particularly in response to exercise-induced mechanical stimulation, remain incompletely characterized.

Based on preliminary studies, p53 is an important protein that regulates the proliferation and differentiation of bone cells and plays a crucial role in the cell apoptosis signaling pathway. Piezo1, a mechanosensitive protein in bone cells that responds to mechanical stimuli, is likely involved in multiple physiological processes of bone tissue. However, it remains unclear whether exercise affects bone quality by regulating p53 signaling pathway in bone tissue. Therefore, this study aims to investigate the effect of moderate-intensity treadmill exercise on improving skeletal health in adult rats and explore the roles of p53 signaling pathway and mechanosensitive factors in regulating the bone remodeling process.

Materials and methods

Animals and treadmill running exercise

Twenty 18-week-old male SD rats were purchased from the Beijing Keyu Animal Technology Co. Ltd (Beijing, China). The rats were fed a standard laboratory diet and kept in a sound-attenuated room under constant conditions (24 ± 1 °C, and 12/12 h light/dark cycle) in groups of 3–4 in standard cages. All animal procedures followed a protocol approved by the animal experiment committee of the Technical Institute of Physics and Chemistry, Chinese Academy of Sciences (LHDW-210102). After acclimatizing for one week, the rats were randomly divided into normal group (Ctrl) and exercise group (Exercise) with ten rats in each group. Rats in the Ctrl group were allowed ad libitum movement within their cages, while those in the Exercise group underwent a standardized treadmill training protocol (Fig. 1). Before the exercise intervention, rats underwent one week of acclimatization training to ensure that they can adapt to the experimental environment and training procedures. During the formal exercise period, rats were subjected to moderate-intensity aerobic treadmill training, with a standardized regimen of 1 h per day, 5 days per week, for a total duration of 6 weeks. The training intensity was set at 75% of the velocity of maximal oxygen consumption (VO₂max), 12 m/min for aerobic training [22, 23].

Fig. 1.

Timeline of the experimental protocol

Body indexes of rats

Fasting blood glucose (FBG) levels and body weights were monitored weekly until the end of the experiment. All rats were subjected to 12 h of fasting prior to the measurement of caudal vein blood glucose [24]. Body mass index (BMI) was calculated using the formula; weight in kg/body length in m² [25]. Lee’s index (weight 0.33/Naso-Anal Length), a measurement of obesity, was used to assay the changes of body weight [26].

Measurement of tibial length

At the end of the 6-week treadmill exercise, all rats were euthanized. Rats were placed in an acrylic glass chamber flushed with 3.0 Vol% isoflurane (R510-22-10, RWD, China) and oxygen at a flow velocity of 1 ml/min. After anesthetizing, the rat was transferred to a warm pad and the anesthesia was maintained via a nose chamber flushed with 1.5 Vol% isoflurane during the whole surgery process. Serum samples were obtained from anesthetized rats by cardiac puncture, and then stored at -80 °C until use. Finally, the bilateral tibiae of the rats were separated, and their lengths were measured using vernier calipers. Measurements were taken three times, averaged, and recorded.

Micro-computed tomography (micro-CT) scanning for bone tissue

Microstructures of the right tibiae were evaluated by micro-CT scanning using a Skyscan 1276 high-resolution scanner (Bruker, Belgium) with an X-ray setting of 85 kV voltage and 200 µA current at 13 μm resolution. Regions of interest (ROIs) in the scanned images were selected for three-dimensional reconstruction using a built-in NRecon software (Bruker, Belgium) (Fig. 2). The parameters, including bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), trabecular separation (Tb.Sp), and cortical thickness (Ct.Th) were obtained from the ROIs using the CTAn software (Bruker, Belgium).

Fig. 2.

Schematic diagram of micro-CT scanning for tibiae of rats

Hematoxylin and Eosin (HE) staining for bone tissue

The right tibiae were decalcified in 10% ethylenediaminetetraacetic acid (pH 7.4) for 4 weeks. They were then dehydrated using ethanol solutions and embedded in paraffin by using standard histological procedures. The slides were processed with HE staining. Bone histology was evaluated under a light microscope.

RNA sequencing data processing and differential expression analyses for bone tissue

After total RNA of left tibiae was isolated with TRIzol reagent (15596018, Invitrogen, USA), the purity of the RNA was assessed using the ND-2000 Nanodrop (Thermo Fisher Scientific, USA), and the integrity of RNA was evaluated using the 2100 Bioanalyzer (Agilent Technologies Inc., USA). Then, the RNA sequencing and subsequent bioinformatics analysis were performed and provide by Novogene Bioinformatics Technology Co., Ltd. The differential expression analysis of mRNAs was conducted using the DEGseq R package [27]. After obtaining the differentially expressed genes (DEGs), they were subjected to the enrichment of DEGs for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analysis. Terms with false discovery rate (FDR) < 0.05 were considered to be significantly enriched terms. Gene Set Enrichment Analysis (GSEA) was performed by the GSEA tool v4.1.0.

Quantitative Real-Time PCR (qRT-PCR) for bone tissue

Total RNA from the bone tissue was used for reverse transcription to obtain cDNA. Transcriptome data analysis identified the key genes associated with the bone remodeling process, which were selected for quantitative validation via qRT-PCR, with three biological replicates included for each sample. The primer pairs were shown in Table 1. The levels of mRNA were normalized to the β-actin housekeeping gene, and the gene expression was calculated according to the 2^−∆∆Ct method.

Table 1.

Primers used for qRT-PCR

Genes	Primers	Primer sequence (5’-3’)
Runx2	Forward	CACAAGTGCGGTGCAAACTT
	Reverse	AGCACTCACTGACTCGGTTG
Rankl	Forward	GGAAGGTTCGTGGCTCGATG
	Reverse	ATGGGATGTCGACAGCATTG
Trap	Forward	TCTCTTCTACTGAGAGGTGCGA
	Reverse	AATCCCTGGTTCCGTGCTTT
β-actin	Forward	GTCCACCCGCGAGTACAAC
	Reverse	GGATGCCTCTCTTGCTCTGG

Immunohistochemical analysis of bone protein expression

Immunohistochemical staining steps were performed according to the instructions of commercial kits (PK10006, Proteintech, China). Anti-COL1 (1:200, GB11022-100, Servicebio, China), anti-OCN (1:200, bs-4917R, Bioss, China), anti-ALP (1:200, bs-6292R, Bioss, China), anti-OPG (1:500, GB11151, Servicebio, China), anti-RNUX2 (1:100, AF5186, Affinity Biosciences, China), anti-Sclerostin (1:500, 21933-1-AP, Proteintech, China), anti-RANKL (1:500, GB11235, Servicebio, China), anti-p53 (1:200, 60283-2-Ig, Proteintech, China), anti-Caspase-3 (1:500, GB11532-100, Servicebio, China), anti-Ki67 (1:500, GB151499-100, Servicebio, China), anti-Piezo1 (1:100, DF12083, Affinity Biosciences, China) and anti-Yap1 (1:100, 29053, Signalway Antibody, China) primary antibodies overnight at 4 °C. Image J software was used to analyze the percentage of positive cell numbers.

TdT-mediated dUTP Nick end labeling (TUNEL) staining for bone tissue

TUNEL staining was used to detect the rate of apoptosis. Bone sections were incubated with TUNEL reagent at 37 °C for 1 h in the dark. The corresponding kit was purchased from Beyotime Biotechnology (C1089, Beyotime, China).

Measurement for serum bone turnover markers and inflammatory cytokines

Procollagen type 1 N-terminal propeptide (P1NP, E-EL-R1414, Elabscience, China), C-terminal telopeptide of type 1 collagen (CTX, NE-EL-R1405, Elabscience, China), Bone alkaline phosphatasein (BALP, RA20178, Bioswamp, China), Tumor necrosis factor-α (TNF-α, RA20035, Bioswamp, China), Interleukin 1β (IL-1β, RA20020, Bioswamp, China) and Interleukin6 (IL-6, RA20607, Bioswamp, China) in the rat serum were measured by Enzyme-Linked Immunosorbent Assay (ELISA) kits according to the manufacturer’s instructions.

Statistical analyses

Data are presented as the mean ± standard deviation from a minimum of three independent experiments, as detailed in the figure legends. After determining that the data were normally distributed and homoscedastic, statistical analyses were performed by unpaired two-tailed Student’s t-test for comparisons between two groups. All data were analyzed with the SPSS software version 25.0 (IBM, USA). Values of p < 0.05 were considered to be statistically significant. The experimental data were plotted using GraphPad Prism 10.0 software (GraphPad Software, United States).

Results

Effect of exercise on body indexes

Figure 1 illustrates the timeline of the experimental protocol. Body weight increased over time in both groups, but rats in the Exercise group had lower body weight than controls throughout the intervention (Fig. 3A). Only after six weeks of treadmill intervention, body weight of the Exercise group was significantly less than that of rats from the Ctrl group (p < 0.05). At the end of the 6-week treadmill intervention, the percentage of body weight gain for the Exercise and Ctrl groups were 101% and 121%, respectively. The FBG of rats in both groups fluctuated throughout the experimental period, but remained within the normal range (4–6 mmol/L), as seen in Fig. 3B. There was no significant difference in FBG between the two groups at each time point (p > 0.05).

Fig. 3.

Effect of exercise on body indexes. A-B Body weight and FBG of the rats. C-D Lee’s index and BMI of rats. E Statistical plot of tibia length in rats

To measure the effect of exercise on the degree of obesity in rats, Lee’s index and BMI of rats were examined at the end of the experiment. After six weeks of treadmill intervention, a significant difference in Lee’s index was observed between two groups, with Lee’s index values in the Exercise group showing a more concentrated distribution (Fig. 3C). But the difference was not statistically significant between two groups (p > 0.05). The trend of change in BMI was consistent with that of Lee’s index. Compared with the Ctrl group, BMI in the Exercise group trended downward but did not reach statistical significance (p > 0.05; Fig. 3D). The length of rat tibia was used to assess the effect of exercise on bone growth (Fig. 3E). Compared with the Ctrl group, the Exercise group exhibited an increasing trend in tibia length that did not reach statistical significance (p > 0.05).

Effect of exercise on bone histomorphology and microstructure analyses

To assess the effect of exercise on bone growth, micro-CT scanning and HE staining were used to measure proximal tibial microarchitecture of rats. Features of the tibiae and the microarchitecture of trabeculae and cortices of both groups were illustrated (Fig. 4). There was no significant difference in BMD between the two groups (p > 0.05). The microarchitecture of the trabeculae showed that the BV/TV increased by 25.42% (p < 0.05); Tb.N increased by 20.54% (p < 0.05); Tb.Sp decreased by 1.97% (p > 0.05) in the Exercise group compared with the Ctrl group, suggesting that rats from the Exercise group had higher bone mass and showed greater development of microarchitecture of trabecular bone (Fig. 4A and B). There was no significant difference in the thickness of trabeculae and cortices between two groups (p > 0.05, Fig. 4A and B).

Fig. 4.

Effect of exercise on bone histomorphology. A Three-dimensional reconstructed micro-CT results for trabecular and cortical bone in rat tibiae. B Morphological parameters of tibiae. C HE staining of trabecular and cortical bone in rat tibia. PZ, width of Proliferative zone (µm). HZ, width of Hypertrophic zone (µm). Scale bar, 50 μm. *p < 0.05, **p < 0.01 vs. Ctrl group, n = 3 rats per group

The representative histological images of tibia revealed bone formation by HE staining (Fig. 4C). The proliferative zone of the Exercise rats was longer than that of the Ctrl rats, suggesting increased osteogenesis in the Exercise group. In addition, the hypertrophic zone of chondrocytes and osteoid content of the primary spongiosa zone were similar between two groups, indicating the mineralization status of newly formed bones (Fig. 4B and C). In the secondary spongiosa zone, the disconnections and separation for the trabecular bone network were low in both groups (Fig. 4C). Additionally, the cortical bone structure in both groups was intact; the number of osteocytes was abundant, with no obvious empty bone lacunae observed (Fig. 4C).

Effect of exercise on gene expression

RNA-sequence methods employed samples collected from the bone tissue with or without exercise and a principal component analysis (PCA) of the samples was shown in Fig. 5A. The correlation between two groups of samples was shown in Fig. 5B. Using the classic criteria (Fold Change < -2 or > 2), a total of 2076 genes were expressed significantly different between two groups: 1552 up-regulated and 524 down-regulated, which accounted for 74.76% and 25.24% of the totally DEGs, respectively. (Fig. 5C). The cluster heatmap of two groups was also shown in Fig. 5D.

Fig. 5.

DEG analysis between Ctrl and Exercise groups. A PCA of the samples. B Sample correlation plot of two groups. C Volcano plot of DEGs. D Heatmap of samples. E-F Visualization of GO enrichment results for DEGs. (G) KEGG enrichment results of DEGs were visualized. F GSEA analysis for bone development. *p < 0.05, ***p < 0.001 vs. Ctrl group, n = 3 rats per group

To better explore the function and molecular pathway of DEGs, functional enrichment was conducted using GO (Fig. 5E and F) and KEGG (Fig. 5G) analyses. GO analysis was based on the aspects of molecular functions, biological processes and cellular components. Some of the biological processes such as bone remodeling, bone resorption, bone cell development and bone mineralization deserved special recognition, because they were significantly up-regulated in the Exercise group, while leukocyte mediated immunity and immune response-regulating signaling pathway were two of the most significantly up-regulated processes (Fig. 5F). Other biological processes such as fatty acid catabolic process, sarcomere organization, fatty acid oxidation and lipid oxidation were down-regulated in the Exercise group. In terms of molecular functions, the immune receptor activity and GTPase regulator activity showed significantly up-regulation in the Exercise group, whereas phosphatase activity and steroid hormone receptor activity were down-regulated. Some genes in cellular components involved in the response to exercise such as the chromosome, centromeric region and chromosomal region were significantly up-regulated, while I band-related genes were down-regulated.

KEGG pathway enrichment analysis revealed six significantly enriched major groups involving the DEGs of metabolism, genetic information processing, environmental information processing, cellular processes, organismal systems and human diseases. Among these, the “organismal systems” subgroup contained the highest number of annotated genes. Additionally, several bone remodeling-related pathways were identified, including osteoclast differentiation, ECM-receptor interaction, Hippo signaling pathway, NF-κB signaling pathway, p53 signaling pathway, and focal adhesion (Fig. 5G). And of these DEGs, 39 genes associated with bone formation, such as Igf1r, Bglap, Sp7, Smad6, Runx2, Ctnnb1, Col1α1, Pth1r were upregulated in Exercise group (Fig. 5H), which were related to the functional enrichment of bone development and osteoblast differentiation. To validate the accuracy of transcriptome sequencing results, three genes involved in bone remodeling-associated signaling pathways were selected for qRT-PCR validation (Fig. 5I). In the Exercise group, the expression of the bone formation-related gene Runx2 was significantly upregulated, whereas the expressions of the bone resorption-related genes Rankl and Trap were significantly downregulated. The results from GSEA also showed that extracellular matrix- and osteoblast differentiation-correlated genes were significantly enriched in exercised rats (Fig. 5J).

Effect of exercise on osteogenesis and osteoclastogenesis

To determine whether exercise alters the balance of bone remodeling, we examined the protein expression of bone remodeling markers in bone sections using immunohistochemical staining. First, we analyzed the expression of the bone formation markers (ALP, OCN, OPG, RANKL, RUNX2, and COL1). Immunohistochemical analyses demonstrated that exercise training significantly elevated the expression of COL1 and OCN in tibiae relative to the Ctrl group (p < 0.05), with COL1-positive cell counts exhibiting a 3-fold upregulation (p < 0.01, Fig. 6A and B). The expression levels of ALP, OPG, and RUNX2 did not differ significantly between two groups (p > 0.05, Fig. 6A and B). Since the RNA-sequence results showed that DEGs were enriched in the signaling pathway of osteoclastogenesis, the relevant indices of bone resorption were also measured. Immunohistochemical staining results demonstrated that exercise training significantly downregulated the expression of sclerostin and RANKL in tibiae (p < 0.05). Specifically, the expression of sclerostin was reduced by approximately 3-fold compared to the Ctrl group (p < 0.01); meanwhile, TRAP staining results showed that exercise significantly reduced the number of osteoclasts in rat tibiae (p < 0.05, Fig. 6C and D).

Fig. 6.

The expression of osteogenic and osteoclastic markers for rat tibia. A-B the expression of osteogenic markers. C-D The expression of osteoclastic markers. E The expression of bone turnover markers in serum. Scale bar, 50 μm. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. Ctrl group, n = 5 rats per group

The effect of exercise on both bone formation and resorption in adult rats was evaluated by bone turnover markers of PINP, CTX and BALP (Fig. 6E). Compared to the Ctrl group, the Exercise group showed significantly higher level of serum P1NP at the end of the intervention (p < 0.05); in contrast, serum CTX level showed a significant decrease at the same time point (p < 0.05; Fig. 6E). However, there was no significant difference between the two groups in terms of BALP (p > 0.05; Fig. 6E).

Effect of exercise on p53 signaling pathway and mechanosensitive markers

KEGG enrichment results from RNA-sequence showed that DEGs were enriched in p53 signaling pathway (Figs. 5G and 7A). Therefore, the expression of key proteins associated with p53 signaling pathway and proliferation-related markers was verified. As shown in Fig. 7B, the expression of p53 and Caspase-3 was significantly decreased in the bone tissues of rats in the Exercise group compared with the Ctrl group, while the expression of the proliferation-related factor Ki67 was significantly increased (p < 0.05, Fig. 7B and C). The p53 signaling pathway is closely linked to the expression of inflammatory mediators, including interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) [28]. We therefore examined the levels of these inflammatory mediators in serum, and our results showed that exercise significantly decreased the levels of IL-1β, IL-6, and TNF-α in serum (p < 0.05, Fig. 7D). Results from TUNEL staining showed that the number of apoptotic cells in the bone marrow cavity of rats in the Exercise group was significantly lower than that in the Ctrl group (p < 0.05, Fig. 7E and F). p53 has been reported to regulate the cell cycle by binding to p21, thereby influencing cell proliferation and differentiation. Accordingly, we examined the expression of p21 in bone tissue. As shown in the Fig. 7B and C, no significant difference in p21 protein expression was observed between two groups (p > 0.05). Subsequently, we further measured the expression of mechanosensitive factors. Compared with the Ctrl group, exercise significantly increased the expression of Piezo1 in bone tissue (p < 0.05; Fig. 7E and F), but the expression of Yap1 was not significantly different between two groups (p > 0.05; Fig. 7E and F).

Fig. 7.

The expression of p53 signaling pathway and mechanosensitive markers. A KEGG map of p53 pathway. B-C The expression of p53 pathway-related protein in bone tissue. D The inflammatory factors in serum of rats. E the expression of mechanosensitive markers and TUNEL staining in bone tissue. Scale bar, 50 μm. *p < 0.05, **p < 0.01, ***p < 0.001 vs. Ctrl group, n = 5 rats per group

Discussion

The primary aim of our study was to systematically investigate the effect of moderate-intensity treadmill exercise on bone mass, bone microstructure, and bone remodeling homeostasis in SD rats. Herein, we showed that exercise reduced the gain rate of weight and alleviated obesity. Specifically, exercise significantly increased key bone morphological parameters (including BV/TV and Tb.N) and increased tibial length. Mechanistically, exercise promoted osteoblast growth and proliferation by significantly inhibiting the activity of the p53/Caspase-3 signaling pathway, thereby improving bone formation. Additionally, we observed that exercise significantly upregulated the expression of the mechanosensitive factor Piezo1. Collectively, these findings indicated that exercise-induced mechanical stimuli may modulate bone remodeling balance through regulation of the p53/Caspase-3 signaling pathway, ultimately improving skeletal quality.

As a well-established non-invasive therapeutic modality, exercise is widely integrated into clinical rehabilitation practices, with particular utility in the management and rehabilitation of orthopedic conditions [29, 30]. Within the FITT principle for exercise prescription, exercise intensity represents a key determinant of effectiveness [31]. Appropriate exercise confers significant benefits to bone health. Clinical evidence has demonstrated that moderate-intensity exercise increased BMD and mitigated estrogen deficiency-associated bone loss in postmenopausal women [11]. Exercise also preserved bone strength to prevent age-related osteoporosis in aged people [32]. However, low-intensity exercise may lack a comparable bone-beneficial effect [33]. In a study of volunteers engaged in low-intensity aerobic exercise, Hettchen et al. reported that such exercise did not produce a significant increase in BMD [34]. Conversely, excessive exercise exerts deleterious effects on skeletal integrity. Studies have documented that female athletes engaging in high-intensity training regimens exhibited reduced BMD and an increased risk of stress fractures [35, 36]. Consistent with this, animal studies have shown that progressive load exercise led to decreased whole-body BMD in rats [37]. Mechanistically, excessive exercise disrupted bone metabolic homeostasis, shifting it toward a negative balance where bone resorption surpassed bone formation, thereby precipitating bone loss and fragility fractures. Given these observations, regular moderate-intensity treadmill exercise was employed as the experimental intervention in our study to systematically explore its regulatory effects on rat bone.

The present results demonstrated that moderate-intensity treadmill exercise significantly improved key trabecular bone morphological parameters (BV/TV, Tb.N) in the rat tibia (Fig. 4). These findings aligned with those reported by Wu et al. [12], providing further support for the conclusion that exercise training markedly enhances trabecular bone density and microstructural integrity. Contrary to the findings reported by Chen and colleagues [38], no statistically significant changes in cortical bone-associated parameters (e.g., Ct.Th) were observed after exercise intervention in our study. This discrepancy may arise from differences in animal models: Chen et al. used mice, which have a higher metabolic rate than rats, thus may induce more pronounced perturbations in bone metabolism and subsequent changes in cortical bone quality [38]. Although change of BMD and Ct.Th in our study did not achieve statistical significance, a discernible improvement trend was evident. This finding suggested that extending the exercise intervention period may induce measurable changes in cortical bone parameters.

Subsequently, RNA sequencing was employed to systematically dissect the molecular mechanisms underlying exercise-induced bone quality improvements. Compared with the Ctrl group, 2076 DEGs were significantly enriched in bone remodeling-related biological processes, including bone resorption, bone cell development, and bone mineralization (Fig. 5E and F). Consistently, KEGG pathway and GSEA analyses further confirmed enrichment of DEGs in signaling pathways functionally associated with bone remodeling (Fig. 5G and J). These integrated omics findings collectively indicated that exercise modulated bone remodeling homeostasis, which in turn drove the observed enhancements in bone quality and microstructural parameters.

Bone remodeling is a complex, tightly regulated physiological process characterized by the coordinated coupling of bone resorption and bone formation, which collectively contributes to bone damage repair and maintenance of skeletal integrity [39, 40]. The process of bone formation is primarily governed by the activity of osteoblasts, with their proliferation and differentiation being tightly regulated by master transcription factors such as RUNX2 [41]. Our study revealed that a noticeable upward trend was observed in the exercise group, suggesting that exercise may modulate RUNX2 transcriptional activity to promote the transcription of osteogenesis-related genes (Fig. 6A and B). This finding was consistent with the work of Farsani et al., which demonstrated that exercise significantly upregulated RUNX2 expression in the muscle tissue of aged rats [42]. A notable limitation of this study was the lack of assessment of exercise-induced effects on osteoblast activity and function. A crucial function of osteoblasts is the robust biosynthesis of COL1, which forms the fibrous scaffold of the bone matrix and confers flexibility and tensile strength to bone tissue [43]. In our analysis, COL1 expression in the bone tissue of exercised rats was significantly elevated, indicating that exercise enhances osteoblast activity and functional capacity, thereby promoting COL1 secretion to support bone matrix formation.

Furthermore, the OPG-RANKL-RANK axis functions as a central regulatory hub in bone remodeling [44]. The OPG/RANKL ratio is regarded as a critical indicator of bone resorption activity: an elevated ratio denotes suppressed bone resorption, whereas a reduced ratio indicates enhanced bone resorption [45]. Our findings demonstrated that exercise significantly elevated the OPG/RANKL ratio (Fig. 6D). This observation aligned with the work of Gao et al., which demonstrated increased OPG/RANKL ratios in rat bone tissue following treadmill training after extreme gravitational loading, thereby reinforcing the robustness of exercise-induced modulation of this critical regulatory axis governing bone resorption [46].

Beyond the aforementioned indices, ALP is widely recognized as one of the most validated markers of osteogenic activity. Synthesized during the maturation phase of bone matrix biosynthesis, ALP is tightly coupled to bone matrix mineralization processes [47]. Consistent with this paradigm, Zhang et al. demonstrated that aerobic exercise significantly upregulated ALP mRNA expression in bone tissue of type 2 diabetes mellitus (T2DM) rats [48]. Complementary clinical evidence further corroborated that aerobic exercise increased serum ALP levels in older adult populations [49]. In our study, no statistically significant difference in ALP protein expression level was observed between two groups, a finding that may be attributed to variations in detection methodologies. Similarly, no significant difference was observed in serum alkaline phosphatase (ALP), specifically bone-specific ALP (BALP), levels between the two groups, suggesting that ALP may not serve as a primary factor in exercise-mediated regulation. In summary, exercise enhanced skeletal quality by modulating bone remodeling homeostasis, thereby shifting the metabolic balance toward a state where bone formation predominated over bone resorption.

p53 is a well-characterized tumor suppressor protein that functions as a central regulator of fundamental cellular processes, including cell cycle arrest, DNA repair, cellular senescence, and apoptotic signaling [50]. As a master transcription factor governing the expression of multiple target genes, p53 drives the transcription and translation of p21, thereby inducing cell cycle arrest to facilitate DNA repair mechanisms [51]. In cases where cellular damage is irreparable, p53 initiates the apoptotic cascade [52]. Cumulative evidence demonstrated that p53 modulated key events in mitochondrial apoptotic pathways, such as cytochrome C release and reactive oxygen species (ROS) production, and subsequently activates caspase family proteases to execute apoptotic programs [53, 54]. Emerging evidence highlighted a critical role for p53 in the regulation of bone remodeling [18]. Wang et al. reported that p53-deficient mice exhibit a bone sclerosis phenotype, characterized by marked elevations in BMD and bone volume [19]. Notably, both bone formation and resorption were upregulated in these mutant mice; however, given the net increase in bone mass and density, the elevated bone resorption is likely a secondary adaptive response to enhanced bone formation. Conversely, murine models with constitutively active p53 exhibited perinatal lethality, accompanied by tail malformations and impaired ossification [55]. In addition, accumulating evidence demonstrated that p53 modulated osteogenesis through transcriptional regulation of RUNX2, thereby underscoring its critical role in maintaining bone remodeling homeostasis [55]. In the present study, p53 expression in bone tissue was significantly downregulated in the Exercise group compared to the Ctrl group. Concomitantly, a reduction in apoptotic cell counts was observed in the bone tissue of exercised rats. Further analyses of proliferation and apoptosis markers revealed that, relative to controls, the Exercise group exhibited elevated Ki67 expression and diminished Caspase-3 expression in bone tissue (Fig. 7B and C). Additionally, p53 can preserve cellular function by modulating inflammatory responses [56]. ELISA results revealed a significant reduction in serum levels of three inflammatory cytokines, including IL-1β, IL-6, and TNF-α, in rats of the Exercise group, suggesting that exercise may exert potent anti-inflammatory effects. These findings collectively suggested that moderate-intensity treadmill may promote osteoblast proliferation and differentiation via inhibition of the p53/Caspase-3 signaling axis, thereby enhancing bone formation, reducing inflammatory response and ultimately contributing to positive variations in bone mass.

Piezo1 ion channel is a phylogenetically conserved mechanosensitive protein in mammals, with ubiquitous expression across osteoblasts, nucleus pulposus cells, osteoclasts, and chondrocytes, among other skeletal cell types [57]. Piezo1 is capable of direct or indirect activation by diverse mechanical stimuli, including fluid shear stress, hydrostatic pressure, and low-intensity pulsed ultrasound [58–60]. It functions as a critical transducer of mechanical signals into intracellular biochemical cascades, thereby governing key cellular processes such as proliferation, differentiation, migration, and apoptosis. As a vital mechanosensor in multiple cells, Piezo1 plays an indispensable role in regulating cell proliferation and differentiation [61]. Accumulating research indicated that Piezo1 contributed to the maintenance of skeletal homeostasis by orchestrating osteoblast and osteoclast differentiation in response to mechanical cues [62]. Notably, combinatorial therapy involving Piezo1 activation via Yoda1 administration coupled with unilateral mechanical loading has been demonstrated to markedly enhance skeletal quality in aged mice models [63]. In contrast, moderate-intensity treadmill exercise was employed in the present study as a physiological source of mechanical stimulation to the skeletal system. Our results revealed that exercise-induced mechanical signals significantly upregulated Piezo1 expression in bone tissue, whereas the expression of Yap1—another well-characterized mechanosensitive factor—exhibited no statistically significant differences between two groups (Fig. 7D and E). These observations collectively suggested that exercise might modulate bone remodeling dynamics through Piezo1-mediated mechanotransduction.

Our study has some limitations. Although we used RNA-seq detection and bio-information analysis to reveal bone manifestation induced by moderate-intensity treadmill exercise, the more novel molecular mechanism for deeper exploration was needed in the further research. In addition, a limitation of the present study is the absence of in vitro validation to further substantiate the observed effects. We expect further and more studies to investigate the ability to regulate the balance of bone remodeling by activating the Piezo1, and p53/Caspase-3 pathway need to be further investigated in future research.

Conclusion

In summary, our findings demonstrated that moderate-intensity treadmill exercise exerted beneficial effects on enhancing bone mass in adult rats. The underlying mechanism may involve the inhibition of the p53/Caspase-3 signaling pathway, mediated by the mechanosensitive factor Piezo1. This process improved osteoblast proliferation and function, inhibited osteoclast activity, and further shifted the balance of bone remodeling toward bone formation, ultimately improving bone quality and bone microstructural parameters in adult rats. Further, these results suggest that targeting the mechanosensitive factor Piezo1 and the p53/Caspase-3 signaling pathway may represent a promising therapeutic strategy for restoring bone loss associated with skeletal diseases such as osteoporosis.

Authors’ contributions

CC L was responsible for the implementation of experiments. HP C and XD W discussed the results. CC L and H G wrote the manuscript. LZ W and YB F reviewed the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (12272029), and research grant from Hangzhou International Innovation Institute, Beihang University (2024KQ093).

Data availability

The datasets generated are available in the Gene Expression Omnibus (GEO) repository, accession number GSE310294 (https://www.ncbi.nlm.nih.gov/geo/).

Declarations

Ethics approval and consent to participate

All animal procedures followed a protocol approved by the animal experiment committee of the Technical Institute of Physics and Chemistry, Chinese Academy of Sciences (LHDW-210102). The study was carried out in compliance with the ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.